ID: 1001435699

View in Genome Browser
Species Human (GRCh38)
Location 5:171697620-171697642
Sequence ATAAGCCTGCCTGGGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435699_1001435709 13 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435709 5:171697656-171697678 CAAGCAGTCGGGCCCCACCTGGG No data
1001435699_1001435707 2 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435699_1001435708 12 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435708 5:171697655-171697677 ACAAGCAGTCGGGCCCCACCTGG No data
1001435699_1001435714 30 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data
1001435699_1001435706 1 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435699 Original CRISPR ATAAGCCTGCCTGGGGAGTG AGG (reversed) Intergenic