ID: 1001435704

View in Genome Browser
Species Human (GRCh38)
Location 5:171697628-171697650
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435704_1001435707 -6 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435704_1001435706 -7 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435704_1001435708 4 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435708 5:171697655-171697677 ACAAGCAGTCGGGCCCCACCTGG No data
1001435704_1001435709 5 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435709 5:171697656-171697678 CAAGCAGTCGGGCCCCACCTGGG No data
1001435704_1001435714 22 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435704 Original CRISPR AGCCCCTCATAAGCCTGCCT GGG (reversed) Intergenic