ID: 1001435706

View in Genome Browser
Species Human (GRCh38)
Location 5:171697644-171697666
Sequence AGGGGCTGAGAACAAGCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435696_1001435706 14 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435703_1001435706 -6 Left 1001435703 5:171697627-171697649 CCCCAGGCAGGCTTATGAGGGGC No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435704_1001435706 -7 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435699_1001435706 1 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435705_1001435706 -8 Left 1001435705 5:171697629-171697651 CCAGGCAGGCTTATGAGGGGCTG No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data
1001435694_1001435706 30 Left 1001435694 5:171697591-171697613 CCTGTTGACAATGGTGCCTCTAA No data
Right 1001435706 5:171697644-171697666 AGGGGCTGAGAACAAGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435706 Original CRISPR AGGGGCTGAGAACAAGCAGT CGG Intergenic