ID: 1001435707

View in Genome Browser
Species Human (GRCh38)
Location 5:171697645-171697667
Sequence GGGGCTGAGAACAAGCAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435705_1001435707 -7 Left 1001435705 5:171697629-171697651 CCAGGCAGGCTTATGAGGGGCTG No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435703_1001435707 -5 Left 1001435703 5:171697627-171697649 CCCCAGGCAGGCTTATGAGGGGC No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435699_1001435707 2 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435696_1001435707 15 Left 1001435696 5:171697607-171697629 CCTCTAAGTGAGGCCTCACTCCC No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data
1001435704_1001435707 -6 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435707 Original CRISPR GGGGCTGAGAACAAGCAGTC GGG Intergenic