ID: 1001435714

View in Genome Browser
Species Human (GRCh38)
Location 5:171697673-171697695
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435704_1001435714 22 Left 1001435704 5:171697628-171697650 CCCAGGCAGGCTTATGAGGGGCT No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data
1001435703_1001435714 23 Left 1001435703 5:171697627-171697649 CCCCAGGCAGGCTTATGAGGGGC No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data
1001435699_1001435714 30 Left 1001435699 5:171697620-171697642 CCTCACTCCCCAGGCAGGCTTAT No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data
1001435705_1001435714 21 Left 1001435705 5:171697629-171697651 CCAGGCAGGCTTATGAGGGGCTG No data
Right 1001435714 5:171697673-171697695 CCTGGGACCCCCTCTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435714 Original CRISPR CCTGGGACCCCCTCTCACTC AGG Intergenic