ID: 1001435760

View in Genome Browser
Species Human (GRCh38)
Location 5:171698108-171698130
Sequence TCCCCAGCTCCTCCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001435760_1001435766 9 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435766 5:171698140-171698162 TCTCAGGAAAGGTGGGGTCGTGG No data
1001435760_1001435765 3 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435765 5:171698134-171698156 TGTTGATCTCAGGAAAGGTGGGG No data
1001435760_1001435763 1 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435763 5:171698132-171698154 AGTGTTGATCTCAGGAAAGGTGG No data
1001435760_1001435767 27 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435767 5:171698158-171698180 CGTGGCCTCTCAGAGCTTAGAGG No data
1001435760_1001435761 -7 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435761 5:171698124-171698146 CTGGGGAGAGTGTTGATCTCAGG No data
1001435760_1001435762 -2 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435762 5:171698129-171698151 GAGAGTGTTGATCTCAGGAAAGG No data
1001435760_1001435764 2 Left 1001435760 5:171698108-171698130 CCTGAAGGAGGAGGAGCTGGGGA No data
Right 1001435764 5:171698133-171698155 GTGTTGATCTCAGGAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001435760 Original CRISPR TCCCCAGCTCCTCCTCCTTC AGG (reversed) Intergenic
No off target data available for this crispr