ID: 1001437863

View in Genome Browser
Species Human (GRCh38)
Location 5:171714594-171714616
Sequence ACTCCCAGAGGCCCAAGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001437852_1001437863 23 Left 1001437852 5:171714548-171714570 CCACATGAAGCCTAATGGTCTGC No data
Right 1001437863 5:171714594-171714616 ACTCCCAGAGGCCCAAGCCGGGG No data
1001437857_1001437863 -7 Left 1001437857 5:171714578-171714600 CCTTGGCCATCCTTGGACTCCCA No data
Right 1001437863 5:171714594-171714616 ACTCCCAGAGGCCCAAGCCGGGG No data
1001437854_1001437863 13 Left 1001437854 5:171714558-171714580 CCTAATGGTCTGCAGCTGGTCCT No data
Right 1001437863 5:171714594-171714616 ACTCCCAGAGGCCCAAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001437863 Original CRISPR ACTCCCAGAGGCCCAAGCCG GGG Intergenic