ID: 1001439176

View in Genome Browser
Species Human (GRCh38)
Location 5:171725697-171725719
Sequence GGGGGTGGTAAGTGTAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001439176_1001439186 25 Left 1001439176 5:171725697-171725719 CCCCAACTACACTTACCACCCCC No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001439176 Original CRISPR GGGGGTGGTAAGTGTAGTTG GGG (reversed) Intergenic
No off target data available for this crispr