ID: 1001439184

View in Genome Browser
Species Human (GRCh38)
Location 5:171725724-171725746
Sequence ACAAAGAAACTGAACTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001439184_1001439186 -2 Left 1001439184 5:171725724-171725746 CCATCCTAGTTCAGTTTCTTTGT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001439184 Original CRISPR ACAAAGAAACTGAACTAGGA TGG (reversed) Intergenic
No off target data available for this crispr