ID: 1001439186

View in Genome Browser
Species Human (GRCh38)
Location 5:171725745-171725767
Sequence GTTATACGTTACCATACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001439176_1001439186 25 Left 1001439176 5:171725697-171725719 CCCCAACTACACTTACCACCCCC No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439178_1001439186 23 Left 1001439178 5:171725699-171725721 CCAACTACACTTACCACCCCCAT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439180_1001439186 7 Left 1001439180 5:171725715-171725737 CCCCCATCTCCATCCTAGTTCAG No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439181_1001439186 6 Left 1001439181 5:171725716-171725738 CCCCATCTCCATCCTAGTTCAGT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439179_1001439186 10 Left 1001439179 5:171725712-171725734 CCACCCCCATCTCCATCCTAGTT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439177_1001439186 24 Left 1001439177 5:171725698-171725720 CCCAACTACACTTACCACCCCCA No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439182_1001439186 5 Left 1001439182 5:171725717-171725739 CCCATCTCCATCCTAGTTCAGTT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439183_1001439186 4 Left 1001439183 5:171725718-171725740 CCATCTCCATCCTAGTTCAGTTT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439184_1001439186 -2 Left 1001439184 5:171725724-171725746 CCATCCTAGTTCAGTTTCTTTGT No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data
1001439185_1001439186 -6 Left 1001439185 5:171725728-171725750 CCTAGTTCAGTTTCTTTGTTATA No data
Right 1001439186 5:171725745-171725767 GTTATACGTTACCATACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001439186 Original CRISPR GTTATACGTTACCATACAAC TGG Intergenic
No off target data available for this crispr