ID: 1001442443

View in Genome Browser
Species Human (GRCh38)
Location 5:171754401-171754423
Sequence TTTTTATTCTGGGACATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001442437_1001442443 -3 Left 1001442437 5:171754381-171754403 CCTTTCTTGTGCACCTCCCTTTT No data
Right 1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG No data
1001442436_1001442443 20 Left 1001442436 5:171754358-171754380 CCTTAGTTCAGCTTTGTGCTTGA No data
Right 1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001442443 Original CRISPR TTTTTATTCTGGGACATTAA TGG Intergenic
No off target data available for this crispr