ID: 1001445838

View in Genome Browser
Species Human (GRCh38)
Location 5:171782224-171782246
Sequence CAGAAGGACAGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001445833_1001445838 2 Left 1001445833 5:171782199-171782221 CCACTAAAGGAACAAACTCTGGA No data
Right 1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001445838 Original CRISPR CAGAAGGACAGGAGGGAAGA TGG Intergenic
No off target data available for this crispr