ID: 1001447061

View in Genome Browser
Species Human (GRCh38)
Location 5:171793956-171793978
Sequence GGCCCACACCAGCACTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001447061_1001447067 -7 Left 1001447061 5:171793956-171793978 CCCCCCCAGTGCTGGTGTGGGCC 0: 1
1: 0
2: 1
3: 29
4: 223
Right 1001447067 5:171793972-171793994 GTGGGCCCCCAACCCATTGATGG 0: 1
1: 0
2: 1
3: 11
4: 92
1001447061_1001447075 6 Left 1001447061 5:171793956-171793978 CCCCCCCAGTGCTGGTGTGGGCC 0: 1
1: 0
2: 1
3: 29
4: 223
Right 1001447075 5:171793985-171794007 CCATTGATGGTGGCTACTTTTGG 0: 1
1: 0
2: 1
3: 6
4: 106
1001447061_1001447076 14 Left 1001447061 5:171793956-171793978 CCCCCCCAGTGCTGGTGTGGGCC 0: 1
1: 0
2: 1
3: 29
4: 223
Right 1001447076 5:171793993-171794015 GGTGGCTACTTTTGGTGTGTTGG 0: 1
1: 0
2: 1
3: 7
4: 157
1001447061_1001447068 -4 Left 1001447061 5:171793956-171793978 CCCCCCCAGTGCTGGTGTGGGCC 0: 1
1: 0
2: 1
3: 29
4: 223
Right 1001447068 5:171793975-171793997 GGCCCCCAACCCATTGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001447061 Original CRISPR GGCCCACACCAGCACTGGGG GGG (reversed) Intronic
900230877 1:1556701-1556723 GGCTCAGGCCAGCTCTGGGGGGG + Intronic
900420000 1:2552065-2552087 GGGTCACCCCAGCCCTGGGGTGG - Intergenic
900424425 1:2569577-2569599 GGGTCACCCCAGCCCTGGGGTGG + Intergenic
900605176 1:3520630-3520652 GGGGCACACCAGGACTGGGCGGG + Intronic
902234218 1:15047423-15047445 GGTCCACACGTGCAGTGGGGAGG + Intronic
904211172 1:28887611-28887633 GGCCCGCAGCAGCGCTGGAGCGG + Intronic
904762884 1:32817974-32817996 GGCCCCCACCCCCACTGGGCAGG - Exonic
905127671 1:35726928-35726950 GCCCCACACCAGTATTGGGCAGG - Intronic
906100487 1:43257285-43257307 GGCCCACTCCAGCACTGTCGGGG - Intronic
907372169 1:54010640-54010662 GGAACACACCAGAGCTGGGGAGG - Intronic
908351005 1:63286370-63286392 GGCCCACCCCAGCACCAGGTTGG + Intergenic
909873668 1:80777974-80777996 GACCCACACCAGTCCTGGGTAGG - Intergenic
915071530 1:153272735-153272757 GGCCCACCCCAGCACCAGGTTGG - Intergenic
915587077 1:156849584-156849606 GGCTCACACCAGCACACCGGGGG + Intronic
915622742 1:157095805-157095827 GGCCCCCAGCAGCTCAGGGGTGG + Intronic
916045767 1:160999011-160999033 GGCCCACCCCTGCCCAGGGGAGG + Intronic
916791575 1:168129816-168129838 TGCCCACCCCAGCCCTGGGTTGG - Intronic
917212417 1:172644247-172644269 CGCCCCCATCAGCACTGCGGAGG - Intergenic
917678347 1:177341093-177341115 TGCCCACACCAGAGCTGGAGAGG - Intergenic
918143796 1:181738701-181738723 AGCCAAGACAAGCACTGGGGAGG - Intronic
919452550 1:197788331-197788353 GGCCCACTCCAGCACCAGGCTGG - Intergenic
919840153 1:201603058-201603080 GGTTCACGCCAGGACTGGGGCGG - Intergenic
922191733 1:223324741-223324763 CACCCACAACAGCACTTGGGAGG + Intronic
922724714 1:227917513-227917535 CGCCCACCACAGCACCGGGGAGG - Intergenic
923297610 1:232610393-232610415 GGGCCCCACCAGCACTGGGCTGG + Intergenic
923758086 1:236812138-236812160 GGCTCACGCCAGCACTGTGGGGG - Intronic
1063156567 10:3384782-3384804 GGCCCTCCCCAGGACTTGGGAGG + Intergenic
1066165854 10:32788013-32788035 GGCCCACCTCAGCACTAGGCTGG + Intronic
1067877842 10:50020460-50020482 GAGCCACCCCGGCACTGGGGTGG - Intergenic
1068060723 10:52064505-52064527 GTCCCCCAACAGCACAGGGGAGG + Intronic
1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG + Intergenic
1073766436 10:106687938-106687960 GGCCCTCATCAGAACTTGGGCGG + Intronic
1074137137 10:110637567-110637589 GGCCCAGAGCAGCAAGGGGGAGG - Intergenic
1075712593 10:124538528-124538550 GGTCCACCCCACCACTTGGGGGG - Intronic
1076679657 10:132165184-132165206 GCCACACACCAGGGCTGGGGAGG + Intronic
1076691328 10:132225161-132225183 TGCCCCCACCAGTGCTGGGGAGG - Intronic
1077009349 11:373298-373320 GGACGACACCAGGGCTGGGGTGG - Intronic
1078156691 11:8805972-8805994 GGCCCTCAGAAGCACTGGAGGGG - Intronic
1078480837 11:11673805-11673827 GGCCCACCCCAGCACTGCCCAGG - Intergenic
1081810088 11:45909632-45909654 GGCACTGGCCAGCACTGGGGAGG - Intergenic
1084660786 11:70545129-70545151 CGCCCACGGCAGGACTGGGGTGG - Intronic
1087107409 11:94423942-94423964 TTCCCAGACCAGCACTGTGGAGG - Intronic
1091664754 12:2411224-2411246 AGCCCACAGCAGCCCTGCGGTGG + Intronic
1091716564 12:2781500-2781522 GGCTCACGTCAGCACTTGGGAGG - Intergenic
1093011496 12:14111846-14111868 TGCCCACCTCAGCAGTGGGGAGG - Intergenic
1096102986 12:48980549-48980571 GGCCCCGACTGGCACTGGGGGGG + Exonic
1096586036 12:52620519-52620541 TCAGCACACCAGCACTGGGGTGG + Intergenic
1096773404 12:53950345-53950367 GGCCCGGCCCAGCTCTGGGGAGG - Intergenic
1098416042 12:70236590-70236612 GACCCACAAAAGCACTGGAGGGG + Intergenic
1099915363 12:88885842-88885864 GGCACACACCTGTACTTGGGAGG + Intergenic
1100294195 12:93245642-93245664 GGGCCTCGCCAGCACAGGGGCGG - Intergenic
1101062412 12:100986025-100986047 GGCACCCACCTGCACTGGGGAGG - Intronic
1102302256 12:111779524-111779546 GGCTCACAACAGGGCTGGGGAGG - Intronic
1102589832 12:113948860-113948882 GCCCTACACCAGCACCGAGGAGG - Exonic
1104871914 12:132005632-132005654 GGCCCACAGGAGCCTTGGGGAGG + Intronic
1105417124 13:20223205-20223227 GGCCACCAGCAGCGCTGGGGTGG + Exonic
1106143834 13:27034737-27034759 GGCCCACACACCCACTGGGGAGG + Intergenic
1107909822 13:45095311-45095333 GGCTCATCCCAGCACTTGGGAGG + Intergenic
1109653140 13:65354117-65354139 GGCTCACCCCAGCACCTGGGTGG + Intergenic
1111607906 13:90564235-90564257 GCCCCACAGCAGCACTGAGGTGG - Intergenic
1112318837 13:98388962-98388984 GGCCCACGCCAGGACTGGGACGG + Intronic
1113504192 13:110801964-110801986 GGCCAACACCAGCTCGTGGGAGG - Intergenic
1116356704 14:43939050-43939072 GGCACCAACCAGCACTGGAGAGG + Intergenic
1117063621 14:51987351-51987373 GGCCACCACCAGGAGTGGGGAGG - Intergenic
1122577419 14:102751017-102751039 GGCCCACACCAGCCCAGGGGTGG - Intergenic
1122623838 14:103074269-103074291 GTCCCAGGACAGCACTGGGGCGG - Intergenic
1122695554 14:103550537-103550559 GTCCCAGCCCAGCCCTGGGGTGG - Intergenic
1122771274 14:104099008-104099030 GCCCAGCACCAGCACTGGGCAGG - Intronic
1122942267 14:104986647-104986669 GGAACACAGCAGCACTTGGGGGG + Exonic
1124040944 15:26103058-26103080 CGCCCCCACCAGCACGGAGGAGG + Intergenic
1125520160 15:40343977-40343999 GGCCCGGACCAGGTCTGGGGAGG + Intergenic
1125579544 15:40775715-40775737 GGCCCTCACCAGAGCTGGGCAGG - Intronic
1126446321 15:48748943-48748965 GGCTGACTCCAGTACTGGGGAGG + Intronic
1128075345 15:64822308-64822330 GGCCACTGCCAGCACTGGGGTGG - Exonic
1128557978 15:68644703-68644725 GGCCCACAGCAGGAGTGGGGTGG - Intronic
1129450701 15:75649578-75649600 GGCCCAAGCCACCACTGGAGCGG + Exonic
1132502626 16:291332-291354 GGCGGCCACCAGCCCTGGGGAGG + Intronic
1132551453 16:555472-555494 GGGCCACCCCAGGACTGGGGTGG - Intergenic
1132924643 16:2422687-2422709 GGTCCACACAAGCACTGATGGGG - Intergenic
1134110380 16:11511893-11511915 GGCGCACAGCTGTACTGGGGAGG + Intronic
1135101984 16:19613854-19613876 TGCCGATACCAGCAATGGGGGGG + Intronic
1135981100 16:27148061-27148083 GGCCAACAACAGCTCTGGGGTGG + Intergenic
1138103993 16:54277265-54277287 GGGCCTCACCAGCACTGAGGTGG + Intergenic
1138577112 16:57915152-57915174 TGCCCCCAGCAGCACTGGGGAGG - Intronic
1139521730 16:67486668-67486690 GGCCCACACCCTCACTTAGGAGG - Intergenic
1140409758 16:74734581-74734603 GGCCCACAGCAGCACGGCAGGGG + Intronic
1141930297 16:87197672-87197694 GGCACCCACCTACACTGGGGAGG + Intronic
1142537833 17:632123-632145 GGCACACACCTGTACTCGGGAGG + Intronic
1142768472 17:2079680-2079702 GACCCACAGCAGGGCTGGGGAGG + Intronic
1143105875 17:4530396-4530418 GTCCCATACCAGCACTGGGCCGG + Intronic
1143317120 17:6041126-6041148 GGACCACAGCATCCCTGGGGTGG + Intronic
1144958720 17:19032917-19032939 TGCCCACACCATCCCGGGGGTGG + Intronic
1144976439 17:19141607-19141629 TGCCCACACCATCCCGGGGGTGG - Intronic
1146058646 17:29593376-29593398 GGCCCCCACCCGCCCTGGGAGGG - Intronic
1146064550 17:29623916-29623938 GGCAGGAACCAGCACTGGGGAGG + Intergenic
1146143493 17:30389093-30389115 GGCCCAGAGCAGCACAGCGGGGG - Intronic
1147782997 17:42957083-42957105 GGCCCATCCCAGCACTGGGAGGG - Intronic
1150209850 17:63435951-63435973 GGCCCATCACAGCTCTGGGGAGG + Intronic
1151327945 17:73390425-73390447 GGCCAACACCGCCACTGTGGAGG - Exonic
1152014147 17:77738784-77738806 TGCCCAAGCCAGCACTGGTGTGG + Intergenic
1152353237 17:79794847-79794869 GGCCCCCCCCAGAGCTGGGGGGG + Exonic
1152380775 17:79941398-79941420 GACCAACACCAGCACAGGGCCGG + Intronic
1152755805 17:82086545-82086567 TGCCTGCACCAGCCCTGGGGAGG + Exonic
1155509929 18:26566388-26566410 GGCCCACACCTGCACTGCAGAGG + Intronic
1156098705 18:33566796-33566818 TGCCCACATGTGCACTGGGGTGG - Intergenic
1159982567 18:74803256-74803278 GGCTGACATCAGCACTGTGGTGG + Intronic
1160263195 18:77314998-77315020 GGCCCACTCCCACACTGTGGAGG - Intergenic
1160442215 18:78901615-78901637 AGCCCACACCAGCAGGTGGGAGG + Intergenic
1160467538 18:79094160-79094182 GGCCCTGACAAGCACTGGCGGGG - Intronic
1160524543 18:79527174-79527196 GGTCCACACCAGCACTTCTGTGG - Intronic
1160538490 18:79607807-79607829 CACGCACACCAGCAGTGGGGAGG - Intergenic
1160574322 18:79842126-79842148 GGCCTACCCCAGCACAAGGGTGG + Intergenic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1162410612 19:10503035-10503057 GGCCCGCACCAGGGGTGGGGTGG + Intronic
1162910828 19:13847171-13847193 GCCCCAGGCCAGAACTGGGGGGG + Intergenic
1163484631 19:17578454-17578476 TGCCCCCAGCAGCACTGGGCAGG - Intronic
1164498776 19:28793954-28793976 GGCGCCCACCAGTACTGGGGAGG - Intergenic
1166701716 19:44886044-44886066 GGCCCCTCCCAGCCCTGGGGTGG - Intronic
1166884867 19:45954217-45954239 TGCCCACAGCAGCCCTGGGCAGG + Intronic
1167609699 19:50501244-50501266 GACCCACACCAGCAGAGGCGTGG + Intergenic
1167772504 19:51530056-51530078 GGTCCACACTAGCTCTGAGGAGG + Intronic
1168665157 19:58199439-58199461 GGCTCACACCTGTACTGGAGTGG + Intronic
1168676180 19:58279380-58279402 GACCGACCCCAGCCCTGGGGAGG - Exonic
924973455 2:152386-152408 CGCCCACTCCCGCACTGTGGAGG + Intergenic
925312227 2:2893047-2893069 CTCCCTCACCAGCACTGTGGTGG + Intergenic
925891240 2:8436805-8436827 GGCCCACCCCAGCCCAGGTGCGG - Intergenic
926095926 2:10080463-10080485 GGCGCACACCGGCCCTAGGGAGG + Intronic
926932447 2:18053897-18053919 GGCCCACCCCCACCCTGGGGGGG + Intronic
927178364 2:20426094-20426116 GGCGCCCACCCACACTGGGGAGG - Intergenic
928121520 2:28587101-28587123 GGCCCACATCAGAAGAGGGGCGG + Intronic
930032959 2:47069513-47069535 ATCCCACCCCAGCACTGGGTGGG + Intronic
930761201 2:55039520-55039542 CGCTCACACCAGCACTTTGGGGG + Intronic
932314322 2:70769264-70769286 GTTCCACAGCAGCACTGTGGTGG - Intergenic
932438648 2:71717907-71717929 GGCCCACCCCAGCATTTGGGTGG - Intergenic
934518102 2:95001433-95001455 GCCCCACTACAGCACTGGGCAGG + Intergenic
934847895 2:97674149-97674171 CTGCCACACAAGCACTGGGGAGG - Intergenic
937439441 2:121903852-121903874 AGAACACACCAGCAGTGGGGTGG - Intergenic
938876834 2:135540536-135540558 GGCATGCACCAGCACTGAGGTGG - Intronic
944579460 2:201118931-201118953 GGGCGACACCAGCCCAGGGGCGG - Intronic
945943722 2:215974341-215974363 AGCCCACATCAGAACTGGGCAGG + Intronic
946401167 2:219469090-219469112 GGGCCAGCCCAGCCCTGGGGTGG + Intronic
946403942 2:219483159-219483181 CACCCACACCCGCTCTGGGGGGG - Exonic
947605067 2:231480918-231480940 ATCCCACCCCAGCCCTGGGGAGG - Intronic
948002256 2:234577831-234577853 GGCCCACGGCAGCACTGGTAGGG - Intergenic
948525875 2:238570495-238570517 GGGACACAGCAGCACAGGGGAGG + Intergenic
948850533 2:240703316-240703338 GGCCCACACCTGCCCTGTGTTGG + Intergenic
1169357448 20:4919494-4919516 GGCCCACAGCAGAGCTCGGGCGG + Intronic
1169910142 20:10641573-10641595 CGCCCACACCAGTGCAGGGGTGG + Exonic
1170849609 20:19993237-19993259 AGCCCAGACAAGCCCTGGGGGGG + Intronic
1170964253 20:21052440-21052462 AGCCCACCCCAGCACTGGGCTGG + Intergenic
1171347989 20:24480180-24480202 GGCCCATCCCAGCACTGGTGTGG + Intronic
1172135127 20:32681533-32681555 GGCCCACACCAGCCCATGGGAGG + Intergenic
1172326205 20:34037264-34037286 GCCCCAAATCAGCACTGGGCAGG + Intronic
1172506392 20:35466025-35466047 CTCTCACACCTGCACTGGGGAGG - Exonic
1173569559 20:44067594-44067616 GGCCCACAGGAGGACTAGGGAGG - Intronic
1173784953 20:45786131-45786153 GGCTCACGCCAGCCCTTGGGAGG + Intronic
1174166037 20:48584149-48584171 GGCCCAGACAAGCACTGGTTCGG + Intergenic
1174443199 20:50572663-50572685 TGCCCACCCCAGCACGGGTGGGG + Intronic
1174547538 20:51337008-51337030 AGCCCATTCCAGCACTGGGGAGG + Intergenic
1175810187 20:61853603-61853625 GACCCCCACCAGCAGTGAGGAGG + Intronic
1179511601 21:41877439-41877461 TGCCCACACCAGCACTGTGAGGG + Intronic
1179537321 21:42060978-42061000 CGCCCACACCAGCACAGGCCAGG - Intergenic
1179725932 21:43341228-43341250 GGCCCCCAGCAGCAGTGGGCCGG - Intergenic
1179779019 21:43687721-43687743 GGCCACGTCCAGCACTGGGGAGG + Exonic
1180595207 22:16968447-16968469 GACCCTAAGCAGCACTGGGGAGG - Intronic
1180700958 22:17781234-17781256 AGCCCACCCCAGTACTGGCGGGG + Intergenic
1180700961 22:17781237-17781259 GGCCCCCGCCAGTACTGGGGTGG - Intergenic
1180980959 22:19877752-19877774 GACACACAGCAGCCCTGGGGTGG + Intronic
1181533522 22:23530408-23530430 GGCCCCCCCTAGCCCTGGGGAGG + Intergenic
1183710566 22:39501144-39501166 GGCCCTTACCAGAACTGGGAGGG - Intronic
1184583824 22:45434511-45434533 GTCCCACACCAGCCTGGGGGTGG - Intergenic
1185137156 22:49079612-49079634 GGCCCACCTCAGCTCAGGGGCGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
949819100 3:8095877-8095899 GGCCCTGACCAGCAATGGGCTGG + Intergenic
950276594 3:11666437-11666459 GGCCCACTCCAGCACCAGCGTGG + Intronic
952706128 3:36380199-36380221 GGCGCACGCCGGCACTGGGTGGG - Intergenic
953793831 3:45967881-45967903 GGCCCACACGAGCTCCTGGGAGG - Exonic
954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG + Intergenic
954717979 3:52536364-52536386 AGCTCAGACCTGCACTGGGGAGG + Intronic
958883514 3:99699994-99700016 TGCGCACATTAGCACTGGGGAGG - Intronic
960036933 3:113111278-113111300 GGCCAACACCTCCTCTGGGGAGG + Intergenic
961957000 3:130814895-130814917 AGCCCACTGCAGCAGTGGGGCGG + Intergenic
967212761 3:187183371-187183393 TGCCCACACAAGCCCTGGGCAGG - Intergenic
968080958 3:195846836-195846858 GTCCCACAGCCTCACTGGGGAGG - Intergenic
968612248 4:1562645-1562667 GGCCCACGCCAGCCCTGGGCTGG - Intergenic
968835872 4:2963857-2963879 GGCCCTCACCAGCAGGGGAGCGG - Exonic
968920029 4:3517720-3517742 GGCCAACAGCAGCACGGGAGGGG + Intronic
969447522 4:7253630-7253652 GGCCCACAGGGTCACTGGGGAGG + Intronic
969449238 4:7263723-7263745 GCCCCACACCAGCATGGAGGAGG - Intronic
969480221 4:7442942-7442964 GGCCCCCACCAGAACCTGGGAGG - Intronic
973140824 4:46765935-46765957 GGCCTACTCCAGCACTAGGATGG + Intronic
976274020 4:83258022-83258044 GGCCTGCAGCAGCACTGGCGAGG + Intergenic
985657993 5:1142092-1142114 GGCCCAGTGCAGCTCTGGGGAGG - Intergenic
986743730 5:10726437-10726459 GGCCCACCCCAGCCCTGCTGAGG + Intronic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
988884358 5:35539415-35539437 AGCCCACACTAGCACTGATGTGG - Intergenic
992524938 5:77599896-77599918 GGCCCACAATGGCACTGGAGAGG + Intronic
992644020 5:78795386-78795408 GAGCCACACCAGCTTTGGGGAGG + Intronic
992895811 5:81244282-81244304 GGCCCACACCAGGAAGGGGCAGG - Intronic
995409910 5:111845024-111845046 GACCCACCCCAGCACTAGGCTGG - Intronic
996336303 5:122387559-122387581 GGCCCAAACCAGCAGCTGGGAGG - Intronic
996659295 5:125981213-125981235 AGCCCAAAGCAGCACTGGGCTGG - Intergenic
998037460 5:138929020-138929042 GGCCCACAGCAGGCCTGGGCTGG - Intronic
998040279 5:138947093-138947115 GCCCCACACCAGGACTGGACTGG - Exonic
1001447061 5:171793956-171793978 GGCCCACACCAGCACTGGGGGGG - Intronic
1002092575 5:176813743-176813765 GGCCCAGAGCAGCACTAGGCAGG - Intronic
1002092705 5:176814308-176814330 GCCCCACATCAGCTCTGGGCTGG + Intronic
1002098965 5:176848022-176848044 TTCCCACACCAGACCTGGGGGGG + Intronic
1006314177 6:33280375-33280397 GACCCTCTCCAGCAATGGGGGGG + Intronic
1006435440 6:34023637-34023659 ACTCCACACCAGGACTGGGGTGG + Intronic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1011493564 6:87916826-87916848 GGCCCACAGCAGCATCTGGGGGG - Intergenic
1011825793 6:91303572-91303594 AGCCCACCCCTGCACTGTGGGGG - Intergenic
1017318332 6:153058632-153058654 AGCCCACTTCAGCACTGGGGTGG + Intronic
1018424977 6:163671776-163671798 GGAACCCACCAGCTCTGGGGAGG - Intergenic
1018736018 6:166687927-166687949 CCCCCAGACCACCACTGGGGAGG + Intronic
1019338237 7:495097-495119 GGCCCAGCCCACCCCTGGGGTGG + Intergenic
1025213170 7:57032942-57032964 GGCTCACAGCAGCACTGGCAGGG + Intergenic
1025658783 7:63543882-63543904 GGCTCACAGCAGCACTGGCAGGG - Intergenic
1029075380 7:97929977-97929999 ACCCCACAGCAGCCCTGGGGTGG + Intergenic
1030678421 7:112408826-112408848 TGCCCAGAGCAGCAATGGGGAGG + Intergenic
1031937899 7:127754679-127754701 GGCCAAGACCAGCAGTGGGTTGG + Intronic
1032128106 7:129209226-129209248 GTCCCGCAGCAGCAGTGGGGAGG - Intronic
1034417149 7:150971230-150971252 GGCCTGCAGGAGCACTGGGGAGG + Intronic
1035929937 8:3768995-3769017 GGCCCACAGCACACCTGGGGAGG + Intronic
1037262817 8:17027248-17027270 CGCCCACACCAGAGCTGGGAGGG - Exonic
1040107661 8:43549615-43549637 GCCCCCCACCCACACTGGGGTGG + Intergenic
1040464218 8:47679378-47679400 GGCACAGGCCAGCACTGGAGGGG - Intronic
1040464235 8:47679421-47679443 GGCACAGGCCAGCACTGGAGGGG - Intronic
1040464276 8:47679549-47679571 GGCACAGGCCAGCACTGGAGGGG - Intronic
1040464288 8:47679592-47679614 GGCACAGGCCAGCACTGGAGGGG - Intronic
1040464300 8:47679635-47679657 GGCACAGGCCAGCACTGGAGGGG - Intronic
1042859574 8:73298782-73298804 GGCTCACGCCAGCACTTTGGGGG - Intronic
1045816776 8:106285584-106285606 GGCCTCCACCTGCACTTGGGAGG + Intronic
1046573890 8:116001042-116001064 GGCCCACACCAGGACTGTGAGGG + Intergenic
1049192968 8:141298941-141298963 GGCCCACAACTGCACTAGGCCGG + Intronic
1049297934 8:141853164-141853186 GGCCCACCCCAGCACCCTGGAGG + Intergenic
1049609914 8:143550114-143550136 GGCCCAGAGCACCCCTGGGGGGG - Intergenic
1051546305 9:18279884-18279906 GGCCCACCCCAGCACCAGGCTGG - Intergenic
1053050089 9:34954218-34954240 GACCCACAGCAGCAGTGGGTAGG + Intergenic
1061510569 9:131058543-131058565 AGCCCCCACCTGCTCTGGGGAGG - Intronic
1062540589 9:137040142-137040164 AGCCCACCTCAGCCCTGGGGTGG + Intronic
1188640931 X:32503799-32503821 GCCCCACCCCAGCACTGAGCTGG - Intronic
1191842643 X:65524050-65524072 GGCCAACACCAAGACTGGTGAGG - Exonic
1192248172 X:69389806-69389828 GGCCCATGCCACCACTTGGGAGG - Intergenic
1192314968 X:70044168-70044190 GGCCCAGATCAGAACTGGAGTGG - Intronic
1192451148 X:71245873-71245895 GAACCACACCAGCAGTTGGGGGG + Intronic
1193962232 X:87939991-87940013 AGCCCACAGCTGCACTGTGGGGG - Intergenic
1194019237 X:88666500-88666522 TGCTCACACCAGCAGTGGTGAGG - Intergenic
1197862761 X:130987947-130987969 CCTCCTCACCAGCACTGGGGTGG - Intergenic
1198718297 X:139586423-139586445 GGAACACACCAGCACTGTGGTGG - Exonic
1198967792 X:142245175-142245197 GGCCTACACCAGCACCAGGCTGG + Intergenic
1199963534 X:152799284-152799306 CCCCCTCACCAGCACTGGAGTGG - Intergenic
1200071143 X:153530068-153530090 GGCCTACCCCAGCAGTGGGGTGG + Intronic