ID: 1001447102

View in Genome Browser
Species Human (GRCh38)
Location 5:171794126-171794148
Sequence GGACCTGGGATTGTGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001447091_1001447102 1 Left 1001447091 5:171794102-171794124 CCCCCCAAATCCAGGGACATACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447096_1001447102 -3 Left 1001447096 5:171794106-171794128 CCAAATCCAGGGACATACCAGGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447098_1001447102 -9 Left 1001447098 5:171794112-171794134 CCAGGGACATACCAGGACCTGGG 0: 1
1: 0
2: 2
3: 21
4: 286
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447093_1001447102 -1 Left 1001447093 5:171794104-171794126 CCCCAAATCCAGGGACATACCAG 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447088_1001447102 10 Left 1001447088 5:171794093-171794115 CCAGAATCTCCCCCCAAATCCAG 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447094_1001447102 -2 Left 1001447094 5:171794105-171794127 CCCAAATCCAGGGACATACCAGG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255
1001447092_1001447102 0 Left 1001447092 5:171794103-171794125 CCCCCAAATCCAGGGACATACCA 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG 0: 1
1: 0
2: 3
3: 16
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001447102 Original CRISPR GGACCTGGGATTGTGGAGAC TGG Intronic
900358544 1:2276462-2276484 GGCCCTGGGATTGGGGAGCCAGG + Intronic
901266391 1:7914083-7914105 GGGGCTGGGATTGAGGAGAGGGG - Intergenic
904286398 1:29455451-29455473 GGACCAGGGATCCTGGGGACAGG + Intergenic
905226893 1:36484808-36484830 GGACATGGGAATGTGGAGAAAGG - Intergenic
905294119 1:36943287-36943309 GGACCTGGGATGGGGGAGGGAGG - Intronic
905356995 1:37391651-37391673 TGACCTGGGATTGGGCAGAAGGG - Intergenic
905614104 1:39382035-39382057 GGAGCTGGGATTCTGCAGCCTGG - Exonic
905834025 1:41101004-41101026 GAACCTGGGGTTGGGGAGGCGGG + Intronic
905934966 1:41816115-41816137 AGACTTGGGATTGTGGAGTCAGG - Intronic
906814919 1:48868949-48868971 GGACCTGGGAATATTTAGACTGG - Intronic
911262414 1:95701923-95701945 GGGCCTGGGTCTGTGGAGGCTGG - Intergenic
913494679 1:119417572-119417594 GGCCCTGGAATGGTGGAGGCAGG - Intronic
914880265 1:151541158-151541180 GGCCCTGGGATAGTGGAGGAAGG + Intronic
915795273 1:158724881-158724903 ATACATGGGGTTGTGGAGACGGG + Intergenic
916970849 1:170013584-170013606 AGAGCTAGGATTGTGGAGCCAGG - Intronic
917506789 1:175634668-175634690 GAACTTAGGATGGTGGAGACAGG - Intronic
918080758 1:181206253-181206275 CGAGGTGGGACTGTGGAGACAGG - Intergenic
918086541 1:181250197-181250219 AGTCCTGGGACTGTGGAGATTGG - Intergenic
919072073 1:192768423-192768445 GGACCTAGGGGTGTGGAGAGGGG + Intergenic
919843698 1:201627744-201627766 GGACCTGGGATTTTGAAGTAGGG - Intronic
920455723 1:206099685-206099707 GGGCCTGGGAACCTGGAGACTGG - Exonic
921821403 1:219621198-219621220 GGTCCTGGGGATGTGGACACAGG + Intergenic
923010251 1:230082913-230082935 GGAGCTGGGATGATGGAGCCGGG + Intronic
924322575 1:242864646-242864668 GAACCTAAGTTTGTGGAGACCGG - Intergenic
1062863055 10:825101-825123 GGGCCTGGGCGTGTGGAGCCAGG - Exonic
1063212546 10:3894297-3894319 TGATGTGGGATTGAGGAGACGGG + Intergenic
1065161453 10:22927189-22927211 GGAGCTTGGATGGTGGAGATCGG + Intergenic
1066789528 10:39047240-39047262 AGTCCTGGGACTGTGGAGATTGG - Intergenic
1067737978 10:48873556-48873578 GGAGCTGGGCTTGTGGAGCCAGG + Exonic
1069897472 10:71688533-71688555 GAACCAGGGATGGTGGAGTCAGG + Intronic
1071371068 10:84952396-84952418 GGACATGGGGTGGTGGAGAGAGG + Intergenic
1072940522 10:99759768-99759790 GGACATGGGATTGGGGGGTCAGG - Intergenic
1074375744 10:112939462-112939484 GGAGTTGGGATTGGGGAGAAGGG + Intergenic
1074846394 10:117402492-117402514 GGACCTGGAGTTATAGAGACAGG - Intergenic
1074882470 10:117669594-117669616 GGGCCTGGGTGTGTGGACACTGG - Intergenic
1075535630 10:123269764-123269786 GGACCTGGTAGTGAGGAGTCTGG + Intergenic
1075678314 10:124313289-124313311 GGACTTGAGATTGGGGATACTGG + Intergenic
1076791369 10:132778713-132778735 GGGCCTGGGACAGTGGAGAGGGG - Intronic
1077389599 11:2293996-2294018 GGACCTAGAGTTGTGGGGACAGG + Intergenic
1078839668 11:15066840-15066862 AGTCCTGGGACTGTGGAGATTGG + Intronic
1079094396 11:17501459-17501481 GTACCTGGGCATGTGGAGGCCGG - Intronic
1079593394 11:22209539-22209561 GGAGCTGGGATTCTGAACACAGG + Intronic
1081343226 11:41952666-41952688 GAGACTGGGGTTGTGGAGACTGG + Intergenic
1082906908 11:58318208-58318230 GTACATGGGAATGTGGAGCCGGG + Intergenic
1082913405 11:58403236-58403258 GTACATGGGATTGTGGAGACAGG + Exonic
1082916182 11:58439978-58440000 GTACATGGGGGTGTGGAGACAGG + Exonic
1083403488 11:62440743-62440765 GGATCTGCCTTTGTGGAGACGGG - Intronic
1083888042 11:65582215-65582237 GCACCTGGTATTGAGGGGACAGG + Exonic
1084068334 11:66718373-66718395 GGACCTGGGTGTGGGGAGAGTGG - Intronic
1084215721 11:67645878-67645900 GGGCCTGGAACTGTGGAGACGGG + Exonic
1084406470 11:68976831-68976853 GGCTCTGGGAGTGAGGAGACGGG - Intergenic
1084497350 11:69512796-69512818 GCACCTGGGGAAGTGGAGACAGG + Intergenic
1085242721 11:75071897-75071919 GTACATGGGCTTGTGGAGGCTGG + Intergenic
1085244568 11:75089519-75089541 GTACATGGGCTTGTGGAGGCTGG + Exonic
1085256568 11:75176948-75176970 GGACCTGGCTTTGTACAGACAGG - Intronic
1086690370 11:89783587-89783609 GGACTTAGAATAGTGGAGACTGG + Intergenic
1086715485 11:90056370-90056392 GGACTTAGAATAGTGGAGACTGG - Intergenic
1086972675 11:93100395-93100417 GGCCCTGTGCTTGGGGAGACTGG + Intergenic
1087181237 11:95144515-95144537 GGAGCTCTGATTCTGGAGACGGG + Intergenic
1088683386 11:112264611-112264633 GGACATGGGATTGGGGGGATGGG + Intronic
1089314395 11:117581454-117581476 GGAGCTGGGGTTGGGGAGAGGGG - Intronic
1089605407 11:119638594-119638616 GGACCTGGCCTTGTGGGAACTGG + Intronic
1089762993 11:120741979-120742001 TGATCTGGGAATTTGGAGACTGG + Intronic
1091618356 12:2066925-2066947 GGGCCTGAGCTTGAGGAGACCGG + Intronic
1093441556 12:19203451-19203473 GGAACTGGTGGTGTGGAGACTGG - Intronic
1093912013 12:24759164-24759186 GGAGTTTGGATTGTGCAGACTGG + Intergenic
1101348839 12:103909127-103909149 AGAGCTTGCATTGTGGAGACAGG - Intergenic
1101501631 12:105309569-105309591 AGTCCTGGGACTGTGGAGATTGG - Intronic
1101708340 12:107241697-107241719 TGTCCTGGGATTCTGGATACAGG - Intergenic
1102187102 12:110957477-110957499 GGACCTGGGAAGGAGAAGACAGG + Intergenic
1103807140 12:123582458-123582480 TGACCTGGGAATGAGGAGCCTGG - Intergenic
1103941912 12:124505905-124505927 GGACGTGGCACTGGGGAGACAGG - Intronic
1104325943 12:127798514-127798536 GGTCATGTGATTATGGAGACTGG - Intergenic
1104689455 12:130814397-130814419 TGACCTGGGAGTGGAGAGACTGG + Intronic
1105702895 13:22946897-22946919 GGACCCAGGATGGTGAAGACAGG - Intergenic
1106230190 13:27815498-27815520 GGGCATGGGAGTGGGGAGACAGG - Intergenic
1108824765 13:54399219-54399241 GCTCCTGTGATTTTGGAGACTGG - Intergenic
1109715803 13:66220385-66220407 GGACCTTGGGTTGGGGAGAGAGG - Intergenic
1110365622 13:74681837-74681859 AGACCTTGGATTGTGGGCACTGG - Intergenic
1110806932 13:79765571-79765593 GGACCTGGGAGTGTGTAGATAGG - Intergenic
1113765495 13:112878326-112878348 GCACCTGGGATGGTAGACACGGG + Intronic
1115582603 14:34776625-34776647 GAACTTGGGGTTGTGGAGAGGGG - Intronic
1116950448 14:50874015-50874037 GGACTTGGGATAGTGGAAATGGG - Intronic
1118593746 14:67420267-67420289 GGAGCTGGGTGTATGGAGACAGG - Intergenic
1119617337 14:76107505-76107527 GCACCTGGGCCTGTGCAGACTGG + Intergenic
1121070877 14:91019543-91019565 GCTCCTGTGATTATGGAGACTGG - Intronic
1122931180 14:104933653-104933675 GGACCTGCGACTGAGGGGACAGG + Exonic
1122931291 14:104933926-104933948 GGACCTGCGACTGAGGGGACGGG + Exonic
1129953515 15:79612649-79612671 GAGCCTGGGATTGTGAGGACAGG - Intergenic
1130673816 15:85935193-85935215 GGACCTGGGCAAGTGGTGACAGG + Intergenic
1131960310 15:97783544-97783566 GCACCTGGGACATTGGAGACAGG - Intergenic
1132794419 16:1712417-1712439 GACCCTGGGATGGTGGTGACTGG - Intronic
1135565042 16:23505613-23505635 GGACCTGGAATTGAGGAGAGGGG - Intronic
1136076348 16:27819988-27820010 GGCCCTGGGCTTGTGGTGAGCGG + Intronic
1136359161 16:29766721-29766743 GCAACTGGGTTTGTGGTGACAGG - Intergenic
1136669168 16:31840028-31840050 GAGCCTGGGATTGTGGATACTGG - Intergenic
1136687276 16:32002852-32002874 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1136787891 16:32946403-32946425 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1136881893 16:33907386-33907408 GGGCCTGGGAGTGGGGAGGCAGG - Intergenic
1137861911 16:51855435-51855457 ATACCTGGGATTCTGGAGAATGG + Intergenic
1138033171 16:53577408-53577430 GAACCTATGATTGTGGGGACGGG + Intergenic
1138204978 16:55118080-55118102 GGACCTGGGACTGGGAAGAGAGG - Intergenic
1140652917 16:77108081-77108103 GGACTTGGGATTCTGGATGCGGG - Intergenic
1203090118 16_KI270728v1_random:1208060-1208082 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1143587628 17:7858493-7858515 GAACCTGGGATTGTGGGTAGAGG + Intronic
1146458300 17:33024139-33024161 GGGGCAGGGATTGTGGAGAGAGG + Intronic
1146589854 17:34119512-34119534 GGAGATGGGGTTGTGGAGGCTGG - Intronic
1146655301 17:34631425-34631447 GGAGCTGGGATGGGGGAGTCTGG - Intronic
1147148255 17:38498521-38498543 GGGCCTGGGAGTGGGGAGGCGGG + Intronic
1147906509 17:43826670-43826692 AGACCTGGGATGGTGGGGAAGGG + Intronic
1148067779 17:44885515-44885537 GGACCTTGAATTGTGGAAAGAGG + Intronic
1150165988 17:62943771-62943793 TGACCTGTGCTTGTGGAGCCAGG - Intergenic
1151553594 17:74835682-74835704 GGGCCTGGGTATGTGGGGACAGG - Intronic
1151600692 17:75104368-75104390 GGAGCTGGGACTTTGGAGGCTGG + Intronic
1152404352 17:80087953-80087975 GGCCATGGGATTGTGGATGCCGG - Intronic
1152685833 17:81693563-81693585 GTACCTGGGACTGCTGAGACAGG - Exonic
1155498714 18:26466270-26466292 GGCCCTGGGCTTGCTGAGACTGG + Intronic
1157241719 18:46016103-46016125 GTGCCTGGGATTGAGGAAACTGG - Intronic
1158024974 18:52885562-52885584 GGACCTGCCATTGTCCAGACGGG - Intronic
1160954196 19:1682615-1682637 GGCCCTGGGACTGGGGAGATTGG - Intergenic
1161620398 19:5294045-5294067 GGACCTGGGGGTCTGGGGACGGG + Intronic
1161850409 19:6735252-6735274 GGAACTGGGATTCTGGGGCCAGG - Intronic
1162001352 19:7746785-7746807 GGACCTGGGAATGTAGAGGCTGG - Intronic
1162003713 19:7764015-7764037 GGACCTGGAGATGTGGAGGCTGG + Intronic
1162965810 19:14155524-14155546 GGATCTGGGAGTGGGGCGACAGG + Exonic
1164516617 19:28942265-28942287 GAACCAGGTATTGTGGAGAAAGG + Intergenic
1165771170 19:38381161-38381183 GGTCATGGGATTGTGGATAACGG + Intronic
1165879518 19:39032341-39032363 GGCCCAGGGATGGTGAAGACGGG - Intronic
1166059101 19:40313836-40313858 GTAGCTGGGATTATGGAGACAGG - Intergenic
1167263914 19:48474037-48474059 GGTCCTGGGAAAGAGGAGACTGG + Intronic
1167263959 19:48474224-48474246 GACATTGGGATTGTGGAGACTGG - Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167410461 19:49341039-49341061 GTATCAGGGATTGTGGGGACAGG - Exonic
1167600316 19:50451153-50451175 GGAACTGGGGTGCTGGAGACAGG - Intronic
1167749653 19:51372003-51372025 GGATCTGGGGGTGTGGAGGCTGG + Exonic
925043233 2:750463-750485 GAACCTGGGATGGTGGAGACTGG - Intergenic
927185188 2:20477217-20477239 GGACCTGGTTTTGGGGAAACTGG - Intergenic
928020666 2:27702242-27702264 GGACCTGGCATTGATGAGGCAGG + Intergenic
929928084 2:46231616-46231638 GGGTCAGGGCTTGTGGAGACTGG + Intergenic
936233918 2:110726706-110726728 ACACCTGGGCTTGTGGAGATGGG + Intergenic
936561588 2:113543178-113543200 GGACCTGGGAAAGAGGAAACTGG - Intergenic
937150971 2:119685369-119685391 GAACCTTGCATTGTGGACACTGG - Intronic
938079996 2:128364797-128364819 GGCCCTGGGAGTGTGGGCACTGG - Intergenic
947049954 2:226031091-226031113 GGAACTGGGATTCTGCAGAGAGG - Intergenic
947406348 2:229781529-229781551 GGAGCAGGGAATGTGGAGCCTGG - Intronic
947547046 2:231017514-231017536 GGAACTGGGAATGTGTTGACTGG + Intronic
947590526 2:231382702-231382724 GGACCCAGGATTCTGGAGAGTGG - Intergenic
948074699 2:235156728-235156750 GGACCTAGGATAGTGGGAACAGG - Intergenic
1168893405 20:1308433-1308455 GGCCCTGGGACTGTGGTGGCCGG + Exonic
1169017546 20:2304216-2304238 GGCTTTGGGATTGGGGAGACAGG + Intronic
1170072230 20:12381374-12381396 GGAACTGGGATGGGGGAGAAAGG - Intergenic
1170929017 20:20751966-20751988 GCAATTGGGATTTTGGAGACTGG + Intergenic
1173580406 20:44142950-44142972 GCACCTGGGACTGGGGAGCCGGG + Intronic
1173888291 20:46480902-46480924 GCAGCTGGGATTTTGGATACTGG - Intergenic
1174056600 20:47802500-47802522 GGAACTGGGTGTCTGGAGACGGG + Intergenic
1174216452 20:48920269-48920291 GGACCTGGGCTTTGGGAGTCAGG - Intergenic
1174388752 20:50203920-50203942 GGATCTGGGAATGTGGGGGCAGG - Intergenic
1174598814 20:51707439-51707461 GGACTTGGCATGGTGGAGAGAGG - Intronic
1175127482 20:56763311-56763333 GGACCTGAGAATGTGGGGAAGGG + Intergenic
1175804719 20:61821065-61821087 GGACCTGGGATCTTGGGGAGTGG - Intronic
1175943297 20:62547621-62547643 AGCCCAGGGAATGTGGAGACAGG - Intergenic
1178606740 21:34043769-34043791 GGACCTGGGCGTGGGGAGACAGG + Intergenic
1179640511 21:42744688-42744710 GGAGGTGGCATCGTGGAGACTGG - Intronic
1180735893 22:18017149-18017171 GGGCATGGGATTGTGGACAAGGG - Intronic
1181268052 22:21642568-21642590 GGGGTTGGGAGTGTGGAGACAGG + Intronic
1181423128 22:22815559-22815581 GGTCCTGGGAATTTGGGGACTGG - Intronic
1182254482 22:29028597-29028619 TGGCCTGGGATTATGGAGAGAGG + Intronic
1182471091 22:30548724-30548746 GGACCTGGGATAAGGGAGAAAGG - Intergenic
1182736061 22:32532883-32532905 GGAGCTGTGAGTGTGGAGATGGG + Intronic
1183336116 22:37247580-37247602 GGTCCTGGGATTGTGTGGACAGG + Intergenic
1183368680 22:37420212-37420234 GGACCTGGCGTGGTGGGGACGGG - Intronic
1183370640 22:37429993-37430015 GGACCTGGGAATGCGGGGAGCGG + Intergenic
1184534630 22:45078015-45078037 GAAGCTGGGAGTGTGGAGCCGGG + Intergenic
1185170710 22:49292109-49292131 GTACCTGAGAGTGTGGAGAAAGG - Intergenic
950478273 3:13227752-13227774 TGACAGGGGGTTGTGGAGACAGG + Intergenic
951761609 3:26153243-26153265 GGAGGTGGGGGTGTGGAGACTGG + Intergenic
953234433 3:41093817-41093839 GGAACTGGGCCTTTGGAGACAGG + Intergenic
954124875 3:48522283-48522305 GGTCCTGGGGTTGGGGAGCCTGG - Intronic
954627955 3:52033005-52033027 GGACCTGGGAGAGTGGTGCCAGG - Intergenic
954796158 3:53162123-53162145 GGAAGGGGGATGGTGGAGACTGG - Intronic
956396617 3:68832931-68832953 TGACCTGGGATGCTGGAGATGGG - Intronic
957435384 3:80168555-80168577 GGACCTGGGCTTGTAGAGCTTGG - Intergenic
959625592 3:108446111-108446133 GGGCCTGGGTCTGTGGGGACTGG - Intronic
962254550 3:133861485-133861507 GGACCTGGGTGTGTGGAGCTGGG - Intronic
970553883 4:17212366-17212388 AGACATGGGATTCTGGAAACAGG - Intergenic
973847402 4:54927144-54927166 GGAACTAGCATTGTGCAGACTGG - Intergenic
974754666 4:66187417-66187439 GGTGCTGGGTTTGTGGGGACTGG + Intergenic
977233582 4:94480581-94480603 GGAGCTGGGACTGTAGAGCCAGG + Intronic
978195797 4:105970440-105970462 GGAACTGGGATTATTGAGCCTGG + Intronic
981726158 4:147849678-147849700 GGAACTGGGCTTCTGGAAACCGG - Intronic
981753699 4:148118583-148118605 GGGACTGGGACTGTGAAGACAGG - Intronic
984533998 4:180950239-180950261 GGACCTGGGGATGGGGAGGCAGG - Intergenic
984643809 4:182199290-182199312 GTAGCTGGGATAGTAGAGACGGG - Intronic
985664593 5:1175449-1175471 GGTCCTGGGATGGAGGAGGCTGG + Intergenic
987112789 5:14702433-14702455 GAACCTGGGCTTGTGAGGACTGG + Intergenic
988754417 5:34231663-34231685 GGGCCTGTGGTTGTGCAGACGGG + Intergenic
990487895 5:56277212-56277234 GCTCATGGGATTGTGGAGCCTGG - Intergenic
992421869 5:76614122-76614144 GGCCTTGGGTTTGTGGAGTCAGG - Intronic
995642968 5:114278594-114278616 GGACCTGGGATGCTGGAGCAAGG - Intergenic
995752434 5:115467512-115467534 ACACATGGGATTGAGGAGACAGG + Intergenic
995975881 5:118034159-118034181 GGACCTGGCACTGTGGAGCAGGG - Intergenic
996423784 5:123290866-123290888 AGCCATGGGATTGCGGAGACTGG - Intergenic
1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG + Intronic
1002137537 5:177117143-177117165 CGAACTGGGAGTGTGGAGCCGGG + Intergenic
1002543042 5:179919013-179919035 GACCCTGGGCATGTGGAGACTGG + Intronic
1002981149 6:2140145-2140167 GGACCTTGCGTTGGGGAGACTGG + Intronic
1003331257 6:5130405-5130427 GGACCTGGGAACAGGGAGACTGG + Intronic
1004424108 6:15496310-15496332 GGAACTGGGCTTGTGGTGATTGG - Exonic
1005773380 6:29101103-29101125 GTACATGGGAGTGTGGAGATGGG - Exonic
1005836468 6:29713194-29713216 GGGCCTGGGATTCTGGAGTAAGG + Intergenic
1005897218 6:30188674-30188696 GCCCCTTGGATTGTGAAGACTGG - Intronic
1006066365 6:31465172-31465194 GGGCCTGGGATTCTGGAGTAAGG - Intergenic
1006095370 6:31652842-31652864 GGACCTTGGACTTTGGAGATGGG + Intronic
1009979907 6:70715643-70715665 GGACTTGGGATGGTGGAGTAGGG + Intronic
1010492403 6:76491686-76491708 AGTCCTGGGACTGTGGAGATTGG + Intergenic
1011209171 6:84936344-84936366 GGACCTGGGATGCTGGAGCTTGG + Intergenic
1012472980 6:99591178-99591200 GGCCCTGGGATTGAGGAGACAGG + Intergenic
1013390238 6:109679242-109679264 TGACCTGGGATGCTGGAGCCTGG + Intronic
1014344277 6:120248054-120248076 GGAGATGATATTGTGGAGACTGG + Intergenic
1015775495 6:136809789-136809811 GCTCATGGGATTGTGGAGGCTGG - Intergenic
1016329786 6:142944800-142944822 GGACCCGGGCGCGTGGAGACGGG - Intronic
1018544227 6:164918415-164918437 GCACCTGGGTTTGTGGAGTTGGG + Intergenic
1019142550 6:169957406-169957428 GGACCTGGGTTTGTGGCTGCTGG + Intergenic
1019736247 7:2651110-2651132 GGACGTGGGAATCTGGAGATCGG + Intronic
1020052124 7:5088588-5088610 GAGCCTGGGCTTGTGAAGACAGG + Intergenic
1020811548 7:12855402-12855424 GCTCCTGTGATTATGGAGACTGG + Intergenic
1021692876 7:23247637-23247659 GGGCCTGGGATTGCGGGGACGGG + Intronic
1021931999 7:25590180-25590202 GGGCAAGGGAGTGTGGAGACTGG + Intergenic
1021994585 7:26167296-26167318 AGACATGGGATTTTAGAGACAGG + Intronic
1022550938 7:31238129-31238151 GGACATGAGTTTGTGGGGACAGG - Intergenic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1023175948 7:37435622-37435644 GGACCTGGGAATGATAAGACAGG - Intronic
1023909102 7:44541246-44541268 AGACCTGGGATGGCGGAGGCCGG - Exonic
1024238285 7:47414546-47414568 GGAACTGGGGATGTGGAGACAGG + Intronic
1025230752 7:57202001-57202023 GCACCTGGGCTAGTGGAGCCAGG + Intergenic
1025236402 7:57237682-57237704 GGAACTGGGTGTCTGGAGACGGG - Intergenic
1025993208 7:66511656-66511678 GGACCTGGGATGGTGGTGCTTGG + Intergenic
1026797661 7:73376784-73376806 GGTCCTGGAATTGGGGAGGCAGG + Intergenic
1027834192 7:83219482-83219504 GGACCTGCCATTCTGGGGACTGG - Intergenic
1028605585 7:92651828-92651850 GGCCCTGGGATCTTGGAGAGGGG + Intronic
1031558189 7:123204529-123204551 GGAGCTGGGAATGTAGAGAAGGG + Intergenic
1037822073 8:22139882-22139904 GGACCTGGGATTTAGGATGCTGG - Intronic
1038535302 8:28349225-28349247 GGACCTGGGCGTGGGGAGAGGGG + Exonic
1039948801 8:42152441-42152463 GGAACTGAGATTGTGGAGGGTGG + Intergenic
1040352848 8:46585975-46585997 AGTCCTGGGACTGTGGAGATTGG - Intergenic
1043853142 8:85236870-85236892 GGACTTGGGACTCTGCAGACTGG + Intronic
1044142617 8:88673789-88673811 AGTCCTGGGACTGTGGAGATTGG + Intergenic
1045574289 8:103402823-103402845 GGACCTGGGATAATGTAGTCTGG - Intronic
1048990984 8:139759971-139759993 GGGCCTGGGCTTGGAGAGACAGG - Intronic
1049157228 8:141074562-141074584 GGACCTGGGCTTGGAGAGAAGGG - Intergenic
1049430453 8:142560733-142560755 GGACATGGCATTCTGGAAACAGG - Intergenic
1049529580 8:143147717-143147739 TCACCTGGGAGTGTGGGGACAGG + Intergenic
1049891096 9:72140-72162 GGACCTGGGAAAGAGGAAACTGG + Intergenic
1050647290 9:7733750-7733772 GGACCTGGGATTTTGGAAAATGG - Intergenic
1051062060 9:13056071-13056093 GGACCTGGGAGAGAGGAGAGGGG - Intergenic
1051186562 9:14466784-14466806 GGAGCTGGGGCTGAGGAGACTGG + Intergenic
1051420218 9:16881666-16881688 GTACCAGGGATGGTGGAGAGTGG - Intergenic
1053732537 9:41073195-41073217 GGACCTGGGAAAGAGGAAACTGG + Intergenic
1054695896 9:68358380-68358402 GGACCTGGGAAAGAGGAAACTGG - Intronic
1056942237 9:90965500-90965522 GTTCCTGTGATTGTGGAGCCTGG + Intergenic
1057004743 9:91547277-91547299 GAACCTGAGGTTGTGGAGACAGG + Intergenic
1057118118 9:92545220-92545242 GGACCTGGGATGGCCGAGGCCGG + Intronic
1060053750 9:120395519-120395541 GGAGCTGGTTTGGTGGAGACTGG - Intronic
1060173749 9:121482107-121482129 GTGCCTGGGATTGGGGAGGCAGG - Intergenic
1061544876 9:131298805-131298827 GGACCTGGGCTAGGGGAGAAGGG + Intronic
1061725307 9:132579294-132579316 GGACCTGGGGCTGGGGAGAGGGG + Intergenic
1186998190 X:15146726-15146748 GGGGCTGGGGTTGTGGGGACGGG - Intergenic
1187511514 X:19923969-19923991 GAAGCTGGGATTGTAGAGATAGG + Intronic
1188823201 X:34799566-34799588 AGTCCTGGGACTGTGGAGATTGG - Intergenic
1189892033 X:45612830-45612852 GAGCCTGGAGTTGTGGAGACAGG - Intergenic
1190249594 X:48712203-48712225 GGACCTCACATTGTGGACACAGG + Intergenic
1190322095 X:49185396-49185418 TGACCTGGGAATGTGGGGTCTGG - Intronic
1193083317 X:77426442-77426464 GGGTCTGTGATTGTGGAGAAAGG - Intergenic
1198186352 X:134257414-134257436 GGCCCTGGGGTTCTGGAGAAAGG - Intergenic
1198558409 X:137821516-137821538 GGACCTGGGAATGGGGAAAATGG + Intergenic