ID: 1001447246

View in Genome Browser
Species Human (GRCh38)
Location 5:171794999-171795021
Sequence CAGAGTCCCCACAGGTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001447240_1001447246 7 Left 1001447240 5:171794969-171794991 CCAAGAATGAGGTGGGAGGTGCT No data
Right 1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001447246 Original CRISPR CAGAGTCCCCACAGGTGAGT GGG Intergenic
No off target data available for this crispr