ID: 1001454068

View in Genome Browser
Species Human (GRCh38)
Location 5:171847412-171847434
Sequence CTTTCTCCCAATAAGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001454065_1001454068 -8 Left 1001454065 5:171847397-171847419 CCTGGTTTCTGGCCACTTTCTCC No data
Right 1001454068 5:171847412-171847434 CTTTCTCCCAATAAGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001454068 Original CRISPR CTTTCTCCCAATAAGGACTC TGG Intergenic
No off target data available for this crispr