ID: 1001455941

View in Genome Browser
Species Human (GRCh38)
Location 5:171859664-171859686
Sequence ATGTCTAAGTTGAAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001455935_1001455941 11 Left 1001455935 5:171859630-171859652 CCTCCCCTCTGAGCATTCTGTTC No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455937_1001455941 7 Left 1001455937 5:171859634-171859656 CCCTCTGAGCATTCTGTTCCCTT No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455933_1001455941 16 Left 1001455933 5:171859625-171859647 CCCTTCCTCCCCTCTGAGCATTC No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455938_1001455941 6 Left 1001455938 5:171859635-171859657 CCTCTGAGCATTCTGTTCCCTTT No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455932_1001455941 21 Left 1001455932 5:171859620-171859642 CCTGTCCCTTCCTCCCCTCTGAG No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455931_1001455941 30 Left 1001455931 5:171859611-171859633 CCACTAACTCCTGTCCCTTCCTC No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455936_1001455941 8 Left 1001455936 5:171859633-171859655 CCCCTCTGAGCATTCTGTTCCCT No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data
1001455934_1001455941 15 Left 1001455934 5:171859626-171859648 CCTTCCTCCCCTCTGAGCATTCT No data
Right 1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001455941 Original CRISPR ATGTCTAAGTTGAAGCTGCA AGG Intergenic
No off target data available for this crispr