ID: 1001458348

View in Genome Browser
Species Human (GRCh38)
Location 5:171885485-171885507
Sequence GAAGCTGCTGCCCCACAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001458348_1001458351 17 Left 1001458348 5:171885485-171885507 CCAATTTGTGGGGCAGCAGCTTC 0: 1
1: 0
2: 2
3: 8
4: 159
Right 1001458351 5:171885525-171885547 TCTTATGAATCTAAGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001458348 Original CRISPR GAAGCTGCTGCCCCACAAAT TGG (reversed) Intronic
900091016 1:920669-920691 GGAGCTGCTGCGCCACACACAGG + Intergenic
901458624 1:9378139-9378161 GAAGCTGCTGGGCCACAAGGAGG - Intergenic
902600644 1:17538663-17538685 GAGGCTGGTGCCTGACAAATAGG + Intergenic
906540634 1:46583188-46583210 GAAGCTGCAGGCCCAGATATAGG + Intronic
909420876 1:75463492-75463514 AAATCTGCTGCCCGACATATTGG - Intronic
910161356 1:84275978-84276000 CAAACTGCTGTCCCCCAAATTGG - Intergenic
910372958 1:86537447-86537469 CAAACTGCTGCCCCCAAAATAGG - Intergenic
911851087 1:102822270-102822292 GAGGCTGCTGCCACACACAAAGG + Intergenic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG + Intergenic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
916416442 1:164596646-164596668 GAAGCTTCTGCCCCACAAACAGG - Intronic
917104619 1:171479921-171479943 GTATCTGCTGCCCAACCAATTGG - Intergenic
920543860 1:206799429-206799451 GAAGCTGCTGCACGACACAGAGG + Intronic
920937339 1:210447896-210447918 GAGGCTCCTGACCCACAAAGCGG + Intronic
922652779 1:227355521-227355543 GAGGCTGTTGCCTCACAAAATGG - Intergenic
1062818713 10:518510-518532 GAAGCTGGAGCCCCATGAATGGG + Intronic
1063015267 10:2070669-2070691 GGAGCTTCTGCCCTACAAAGCGG + Intergenic
1067277765 10:44850131-44850153 GAGGCTGCAGCCCCACACAGAGG + Intergenic
1068850311 10:61731339-61731361 GAAGCTGCTTCCACACATACTGG + Intronic
1072939261 10:99745328-99745350 GAAGGTGCTGCCACCAAAATAGG + Intronic
1076236065 10:128864624-128864646 CAAGCTGCTGCGACACAACTAGG + Intergenic
1076532399 10:131153741-131153763 GAAGCTGTTTCCCCACACTTTGG - Intronic
1078890555 11:15552957-15552979 GAAACTGCTGCCTCAAAATTTGG - Intergenic
1079515851 11:21268060-21268082 AAAACTGCTGCCCCCCAAACTGG + Intronic
1083202914 11:61131188-61131210 GGCGCTGCTGCCACTCAAATAGG + Exonic
1084282671 11:68108768-68108790 GAAACTGCTGCCTCCCAAATTGG + Intronic
1086392688 11:86381643-86381665 CAAACTGCTGCCCCTAAAATTGG - Intronic
1086840115 11:91674520-91674542 GAAGATGGAGCCCCACAAAGGGG + Intergenic
1089839769 11:121405717-121405739 GAAGCTGCTACAACACAAATTGG - Intergenic
1090362899 11:126185771-126185793 GAAGTTGCTGCAGCACAACTTGG + Intergenic
1090861472 11:130656568-130656590 GTAGCTGATGCCCCTTAAATCGG - Intergenic
1091876007 12:3933479-3933501 TAAACTGCTGCCCCCAAAATTGG + Intergenic
1095609085 12:44106132-44106154 CAAGCTGCTGCCCCCAAAACTGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095900677 12:47325085-47325107 GAAGTTGCTTCCTCACAATTCGG - Intergenic
1096204496 12:49709352-49709374 CAAGCTGATGTCCCACAAGTTGG + Intronic
1098858871 12:75685082-75685104 GAACCTTCTGCCCCATAAGTTGG - Intergenic
1100312801 12:93413262-93413284 GAAGCTGCTGCCAGACAAGGAGG - Intronic
1104653567 12:130556571-130556593 GAAGCTGGTGACCCCCACATGGG + Intronic
1104722405 12:131052170-131052192 GCTGCTGCTGCTCCACAAATTGG + Intronic
1110214506 13:73011166-73011188 CAAACTGCTGCCCCCAAAATTGG + Intronic
1111092296 13:83462798-83462820 GAAGCTGCTGACCCTTGAATGGG - Intergenic
1112328905 13:98462190-98462212 GAAGCTGATGTCCCAGAGATGGG - Intronic
1112661406 13:101512914-101512936 GAATTTCCTGCCACACAAATGGG - Intronic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1115681387 14:35742531-35742553 ATAGCTGCTGCTTCACAAATTGG + Exonic
1119167124 14:72503805-72503827 GATGATGCTGCCACCCAAATGGG - Intronic
1120827810 14:88970885-88970907 GATGCTGCTGCTCCTCCAATAGG - Intergenic
1121714780 14:96065801-96065823 GAGGCTGCTGACCCACACAGGGG + Intronic
1122806160 14:104259635-104259657 CAAACTGCTGTCCCTCAAATTGG + Intergenic
1126032813 15:44516477-44516499 TAAGCTGCAGTCACACAAATGGG + Intronic
1128390700 15:67180676-67180698 GAAGCTGCTGCTCCACAGGCTGG + Intronic
1128627195 15:69221966-69221988 GAAGTTGCTGTCCTTCAAATGGG + Intronic
1129997786 15:80021722-80021744 CAAACTGCTGCCCCCAAAATTGG - Intergenic
1131285321 15:91052158-91052180 GAAGCTGCTGCAGCACTTATGGG - Intergenic
1133829855 16:9311415-9311437 GTAGCTGCTGCCTCACAGACTGG - Intergenic
1138790279 16:59895675-59895697 GAAACTACTGCCCCTCAAATTGG - Intergenic
1140134712 16:72195769-72195791 GATGCTGCTGTCCCACACAAAGG + Intergenic
1140584850 16:76277324-76277346 GCAGCAGCGGTCCCACAAATTGG - Intronic
1142718837 17:1762999-1763021 GAAGCAGCAGCCCCAAGAATAGG - Intronic
1145775433 17:27524620-27524642 TAAGATGCTGCCCCAGGAATTGG + Intronic
1145965920 17:28917174-28917196 GAAACTGAAGCCCCAGAAATAGG - Intronic
1147720499 17:42536706-42536728 GGAGCCGCTGCCACCCAAATCGG + Intronic
1149929924 17:60741170-60741192 CAAACTGCTGCCCCAAAAATTGG - Intronic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1152379305 17:79934248-79934270 GAACCAGCTGCCGGACAAATTGG + Exonic
1153024304 18:658836-658858 GAATCTGCTTCACCACGAATGGG - Intronic
1155910669 18:31501108-31501130 GATACTGCTGCATCACAAATTGG + Intronic
1156716731 18:40021374-40021396 CAAACTGCTGCCCCCAAAATTGG + Intergenic
1156933407 18:42673039-42673061 CAAACTGCTGCCCCCAAAATTGG + Intergenic
1158770752 18:60514333-60514355 TAAGCTGCTTCTCCACAACTGGG + Intergenic
1162782643 19:13014465-13014487 GAAGCTGCTTCCCCACACCCGGG - Intronic
1163410284 19:17149723-17149745 GAAGCTGCAGCCTCATAAATTGG - Intronic
1164538522 19:29105308-29105330 GAAGCTGCTTCCCTACAAGGGGG - Intergenic
1164755561 19:30686466-30686488 GAAGCTGCAGCCCCCCCAAGTGG + Intronic
1166687434 19:44803934-44803956 GCCTCTGCTGCCCCAGAAATAGG + Intergenic
1167337287 19:48894917-48894939 GAAGCTGCTGCCTAAGAAAGGGG + Intronic
1168081715 19:54014895-54014917 GAAGCTGTTGCCCCAGCCATAGG - Intergenic
925847022 2:8043654-8043676 GAAGGTGGAACCCCACAAATGGG + Intergenic
926944441 2:18171488-18171510 GAATCTGAAGCCCGACAAATTGG - Intronic
928235049 2:29531958-29531980 CCAGCTGCTGCCCCACAACGAGG - Exonic
930552593 2:52853812-52853834 CAAACTGCTGCCCCCCAAATTGG - Intergenic
932510491 2:72283381-72283403 TAAACTGCTGCCTCTCAAATTGG + Intronic
938898830 2:135780592-135780614 GAAGCTGCTTTCCAAAAAATTGG - Intronic
939582144 2:143962896-143962918 GCAGATGTTGCCCCACAAGTGGG + Intronic
941143602 2:161815787-161815809 GAAGCTTCTGCCTCTCAATTTGG + Intronic
944244358 2:197516285-197516307 GGAGCTGCAGCCCCTCAATTTGG + Intronic
944496806 2:200315455-200315477 TCAGCTGGTGCCTCACAAATAGG - Intronic
947300568 2:228684221-228684243 AAAACTGCTGCCCCCAAAATTGG + Intergenic
947866370 2:233400507-233400529 GAAGTGGCACCCCCACAAATGGG - Intronic
1169156234 20:3332150-3332172 GGAGCTGGAGGCCCACAAATTGG + Intronic
1170022724 20:11853987-11854009 TAAACTGCTGCCCTAAAAATTGG + Intergenic
1173004895 20:39132780-39132802 GCAGCTCCAGCCCCTCAAATAGG - Intergenic
1176081021 20:63273043-63273065 GAGGCTGCTGCCCCAGAGCTTGG + Intronic
1179154584 21:38838864-38838886 GGAGCTGCTGACCCACACAGGGG - Intergenic
1180205400 21:46256348-46256370 GAAGATGCTGCCACAGAAAGGGG + Intronic
1182257507 22:29049527-29049549 GAAGCTGCGGCCACTCAACTTGG - Exonic
1183431585 22:37769166-37769188 GGAGCTGCTGCGCCACAACCAGG + Exonic
949984096 3:9525442-9525464 CAAACTGCTGCCCCCAAAATTGG - Intronic
956097503 3:65732947-65732969 GAATCTCCTGCCCCATTAATGGG + Intronic
959578794 3:107963286-107963308 GAAGATGCTGTCCCCAAAATGGG - Intergenic
961080095 3:124019312-124019334 GAAGCTGCAGTCCCACCAACAGG + Intergenic
961817569 3:129559079-129559101 GAAGCTGCTGCCCTGCACAGAGG + Intronic
963844724 3:150143684-150143706 AAAGCTGCTGCCTCAGAATTTGG + Intergenic
965114887 3:164476781-164476803 CAAACTGCTGCCCCTAAAATAGG - Intergenic
968078339 3:195829513-195829535 TAAGCTGCTGCCCCAGAGAGGGG - Intergenic
968712313 4:2127721-2127743 GAAGCCCCTGGCCCACAGATGGG + Intronic
974894859 4:67926763-67926785 CAAGCTGCTCCCCCACCAGTGGG - Intronic
976134352 4:81920003-81920025 TAAGCTGCTGCCCCACTAGGTGG - Intronic
976454668 4:85232576-85232598 AAAACTGCTGCCACACAGATTGG - Intergenic
976612416 4:87043658-87043680 GAAGCTGCTGAACCAGAAACTGG - Intronic
977845008 4:101758107-101758129 GCAGCTGCTGCCACACTAGTAGG + Intronic
977952422 4:102987859-102987881 CAAACTGCTGCCCAAAAAATAGG - Intronic
978872227 4:113593318-113593340 CAAACTGCTGCCCCTAAAATTGG + Intronic
978971603 4:114814234-114814256 CTATCTGCTGCCCCACAGATTGG - Intergenic
979552791 4:122009881-122009903 TAGGCTGCTGTACCACAAATTGG + Intergenic
979739679 4:124133384-124133406 CAAGCTGCTGTCCCCCAAAATGG - Intergenic
984636796 4:182119547-182119569 AAAGCTGCTGCCCCCAAATTTGG - Intergenic
985667017 5:1186608-1186630 GAAGCTGCTGCTCAATAACTTGG + Intergenic
986644413 5:9902596-9902618 CAAACTTCTGCCCCACAAACTGG + Intergenic
987179347 5:15350388-15350410 GAAGCTGCTGCCAAAATAATTGG - Intergenic
992033325 5:72746303-72746325 CAAATTGCTGCCCCCCAAATTGG + Intergenic
994717980 5:103346725-103346747 CAAACCGCTGCCCCAAAAATTGG - Intergenic
995251101 5:109994202-109994224 CATCCTGCTGCCCCAGAAATGGG + Intergenic
996757133 5:126946884-126946906 CAAGTTGCTGCCCAACCAATTGG + Intronic
997303890 5:132824971-132824993 CAAGCTGCTTCCCCCCAACTTGG + Intronic
999095035 5:148970185-148970207 GAAGCTGCTGCCTCTGAAACTGG - Intronic
999223998 5:150004789-150004811 GAAGCTGCTGCCCCTCTTAGGGG + Intronic
999706243 5:154274865-154274887 GTAGCAGCTGCCCCTCACATGGG + Intronic
1000048437 5:157541109-157541131 GACGCTGCTGTCCCACAGAGAGG + Intronic
1000054455 5:157592644-157592666 CAAGCTGCTGCCCACAAAATTGG - Intergenic
1001458348 5:171885485-171885507 GAAGCTGCTGCCCCACAAATTGG - Intronic
1003007100 6:2392283-2392305 GAAGCTTCAGCCCCACACACAGG - Intergenic
1003253097 6:4449688-4449710 GTAGCTGCTGCTCTATAAATAGG + Intergenic
1003854233 6:10256031-10256053 TAAACTGCTGCCCCTAAAATTGG + Intergenic
1007253029 6:40509398-40509420 TGAGCTGCTGACCCACAAGTGGG - Intronic
1010079631 6:71844907-71844929 CAAACTGCTGCCCCACAAATTGG - Intergenic
1012487735 6:99740898-99740920 GAAGCAGCTGGATCACAAATTGG + Intergenic
1014792818 6:125693745-125693767 GGAGCTGCTGCTGCTCAAATAGG - Intergenic
1015757513 6:136622390-136622412 GAGGCAGCTGCCCCTGAAATTGG - Intronic
1023212058 7:37816610-37816632 CAAACTGCTGCTCCCCAAATTGG - Intronic
1024770216 7:52713479-52713501 GAAGCTGGTGCTCCCCAAACTGG - Intergenic
1028681925 7:93545545-93545567 GCATCAGCTGCCCCAAAAATGGG - Intronic
1031049768 7:116933179-116933201 GAAACTGATGCTCCAAAAATTGG + Intergenic
1032408231 7:131673324-131673346 GAAGCTCCTGGCCCAGAAGTTGG - Intergenic
1032658427 7:133955997-133956019 GCAGCTGCTGCCACCCAAACTGG - Intronic
1034898817 7:154894905-154894927 GCAGCTGCTGCCTCAGAGATGGG + Intergenic
1035074678 7:156169710-156169732 GAAGCTGCTTCCCCACTCAGTGG - Intergenic
1038524022 8:28257900-28257922 GAAGCTCCTGACCCACACTTTGG - Intergenic
1040449164 8:47526857-47526879 CAAACAGCTGCCCCCCAAATTGG + Intronic
1048468029 8:134683733-134683755 GAAGCTCCTGCCCCGCAAGCAGG + Intronic
1050208980 9:3232160-3232182 GAAGTTGCAGCATCACAAATTGG + Intronic
1055381964 9:75717085-75717107 GATGCTGCTGGCCTTCAAATGGG + Intergenic
1056196351 9:84232559-84232581 GGAGCTGCTCCTCCACAAGTGGG + Intergenic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1057310386 9:93939262-93939284 GAGGCTGCAGCACCACAGATGGG + Intergenic
1057758656 9:97855369-97855391 GAAACTGATTCCCCACAATTTGG - Exonic
1058492921 9:105521517-105521539 ATAGCTGCTGCTTCACAAATTGG - Intronic
1058974118 9:110110261-110110283 TAAGATGCTGCCCAACAACTAGG - Intronic
1060198983 9:121640841-121640863 GAAGCTGCCTTCCCACAACTGGG - Intronic
1060282217 9:122222220-122222242 GCAGCTGCTGCCCTACAATAGGG - Intronic
1060738844 9:126084247-126084269 GAAGCTGAGGCCACACAAACAGG + Intergenic
1060845564 9:126834236-126834258 AAAGCTGCTGCCACCCAAAATGG - Exonic
1062167946 9:135117711-135117733 GCAGCTGCTGCCCCACAACCTGG + Intronic
1186000548 X:5004733-5004755 GAAGCTGCGACCCCTCAAAATGG + Intergenic
1186757790 X:12691103-12691125 AAAGCTGGTGTCCCACACATTGG + Intronic
1189687566 X:43581382-43581404 GTAGCTGCTGGTTCACAAATTGG + Intergenic
1198772875 X:140149620-140149642 GAAGGTGCTATCCCAGAAATTGG + Intergenic
1200428297 Y:3046324-3046346 CAAGATGCTGCCTCATAAATAGG - Intergenic