ID: 1001465187

View in Genome Browser
Species Human (GRCh38)
Location 5:171957859-171957881
Sequence AGGGCCCACTTGATGTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001465179_1001465187 4 Left 1001465179 5:171957832-171957854 CCAGACAGCTCACTGAAACCTTG 0: 1
1: 0
2: 2
3: 33
4: 193
Right 1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG 0: 1
1: 0
2: 0
3: 7
4: 134
1001465178_1001465187 5 Left 1001465178 5:171957831-171957853 CCCAGACAGCTCACTGAAACCTT 0: 1
1: 0
2: 5
3: 95
4: 1111
Right 1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001465187 Original CRISPR AGGGCCCACTTGATGTTCTA TGG Intronic
901752888 1:11422427-11422449 AGGGCCCACTTGCTGTCTTGGGG - Intergenic
902151002 1:14443311-14443333 AGGGGCCACTGGATCTTCAAAGG + Intergenic
905909091 1:41641526-41641548 AGGGCCCACTTGGTCTGCTGTGG + Intronic
906973908 1:50548343-50548365 AGGGAGAACTTGATGTTGTAAGG + Intronic
907928336 1:58975532-58975554 AGGGCCCACTTCCTGGTTTATGG + Intergenic
910564210 1:88625159-88625181 AGGGCCTACTTGAGGCTCAAGGG + Intergenic
911355400 1:96812026-96812048 AGGGCCAACATGATGCTCAAGGG - Intronic
913616701 1:120567041-120567063 AGGGCCCACTTTCTGGTTTATGG - Intergenic
914573574 1:148943869-148943891 AGGGCCCACTTTCTGGTTTATGG + Intronic
918386664 1:184014964-184014986 AGGGCCCACTTGAGGGTGGAGGG + Intronic
922557113 1:226540995-226541017 AGGGCCCACCTGTTGTTATTTGG + Intergenic
922631281 1:227114708-227114730 AGTGCCAACATGATGTTCAAAGG + Intronic
922761785 1:228137439-228137461 AGGGACCATTTGATGTTCAATGG - Intergenic
923068042 1:230538220-230538242 AGGGCCCATTTCATGGTTTATGG + Intergenic
923974910 1:239251491-239251513 AGGGTTCACCTGATGTTCTTAGG + Intergenic
1062904097 10:1168219-1168241 AGGGCACAATTGATATTCTCAGG + Intergenic
1063292886 10:4768752-4768774 AGGGGCCCCTTAATGTTCAAGGG + Intergenic
1064215144 10:13394110-13394132 GGGGCCCACTTGAGGTTAGAGGG + Intergenic
1071417411 10:85454168-85454190 AGGGCCCACTTGTGATTCTGAGG - Intergenic
1074322845 10:112419587-112419609 AGTGCCAACATGATGTTCCAAGG - Intronic
1075817921 10:125280052-125280074 TGGGCCCACAAGATGTACTATGG + Intergenic
1077521638 11:3039276-3039298 CGGGCCCTCTTGATGATCTGGGG + Exonic
1087265826 11:96059700-96059722 AGTGCCGACATGATGTTCAAAGG - Intronic
1088013018 11:105026059-105026081 AGCGCCCACATGATATTCAAAGG - Exonic
1088018704 11:105092287-105092309 AGCGCCCACATGATATTCAAAGG - Intronic
1088021260 11:105122467-105122489 AGTGCCCACATGATATTCAAAGG - Intergenic
1088732036 11:112692002-112692024 AGGGACCAATGGAAGTTCTAAGG - Intergenic
1090000154 11:122949423-122949445 AGGCCCCACTTGAGGATCCATGG - Intronic
1090707644 11:129353785-129353807 AGGGCCAGCATGATGTTCTGTGG - Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1099769672 12:87034798-87034820 TGGGCCAACATGATGTTCTGTGG + Intergenic
1100309820 12:93383899-93383921 AGGGGTCACTTGAGGTTCTCTGG + Intronic
1101470952 12:104996522-104996544 AGGGCCCACTTGAGGATGGAGGG - Intronic
1101976839 12:109366894-109366916 AGTGCCCACTTGATGCTCAAAGG + Intronic
1107908347 13:45082649-45082671 AGGGCCCCCTTGATCATCTCAGG + Intergenic
1114243670 14:20892677-20892699 AGGTCCCATTTGATGCTTTATGG + Intergenic
1115758127 14:36549881-36549903 AGGGCCAACTTGATGGTCATGGG + Intergenic
1117226301 14:53663857-53663879 AGGGCCCCCTTGTGGATCTAAGG - Intergenic
1118946190 14:70389678-70389700 AGGGCCAACATGACGTTCAAAGG - Intronic
1121572131 14:94954359-94954381 AGGGCCCACTGGATAATCCAGGG + Intergenic
1124461788 15:29898667-29898689 AGTGCCAACATGATGTTCAAAGG + Intronic
1130146203 15:81275398-81275420 AGGGCCCAGATGCCGTTCTAGGG + Intronic
1130260701 15:82352156-82352178 AGTGCCGACATGATGTTCGAAGG - Intergenic
1130280536 15:82516851-82516873 AGTGCCGACATGATGTTCGAAGG + Intergenic
1130471907 15:84233034-84233056 AGTGCCGACATGATGTTCGAAGG + Intergenic
1130479401 15:84347605-84347627 AGTGCCGACATGATGTTCGAAGG + Intergenic
1130492369 15:84440524-84440546 AGTGCCGACATGATGTTCGAAGG - Intergenic
1130594204 15:85237671-85237693 AGTGCCGACATGATGTTCGAAGG + Intergenic
1131154538 15:90066950-90066972 AGGGCACACTTGTTATTATAGGG - Intronic
1131283426 15:91039023-91039045 AGTGCCGACATGATGTTCGAAGG - Intergenic
1132396424 15:101478345-101478367 AGGACCCAGTTGCTATTCTAAGG + Intronic
1133673796 16:8049992-8050014 TGGTCCCACTTTATCTTCTAAGG + Intergenic
1138058080 16:53857238-53857260 AGGGCCCACTTGAGGGTGGAAGG - Intronic
1138547425 16:57728226-57728248 AGGGCCCACATGCTGGTCTCTGG - Intronic
1140143051 16:72277812-72277834 AGGGCTCACTAGATATTCAAAGG - Intergenic
1140942130 16:79731984-79732006 AGGGCCCACTTGAGGGTGGAGGG + Intergenic
1143720046 17:8803080-8803102 AGGGCCCACATGGAGGTCTACGG - Exonic
1144518870 17:15941144-15941166 AAGTCCCACTTGAGTTTCTAGGG + Intergenic
1149133944 17:53342166-53342188 AGGGCCTACTTGAGGTTGGAGGG + Intergenic
1149385800 17:56142233-56142255 AGGGCTTACTTTATGGTCTAGGG + Intronic
1151235264 17:72715306-72715328 AGACCCCACTTGAGGTTCTTTGG - Intronic
1151862537 17:76775710-76775732 AGGGCCAACATGATGCTCAAAGG + Intronic
1152710204 17:81867568-81867590 AGGGCCCCCTTGAAGTGCTGTGG - Intergenic
1156882211 18:42094185-42094207 AGTGCCGACATGATGTTCAAAGG + Intergenic
1158057023 18:53293625-53293647 AGGGCCTACTTGAAGGTATAGGG - Intronic
1159438506 18:68447916-68447938 AGGGCCCACTAGATGTGTGAAGG - Intergenic
1164834106 19:31346250-31346272 AGGGCCCTTTTAATGGTCTAGGG - Intronic
925936165 2:8763408-8763430 AGTGCCGACGTGATGTTCAAAGG - Intronic
932868137 2:75368601-75368623 AGGATCCAGTTGATGTTCTGCGG - Intergenic
942209823 2:173659257-173659279 AGGGCACATTTCTTGTTCTAGGG + Intergenic
945052173 2:205834497-205834519 GGGGACCACTTGATCTTCTTTGG + Intergenic
948965946 2:241380611-241380633 AGTGCCAACATGATGTTCAAAGG - Intronic
1170750843 20:19143329-19143351 AGGGCACACCTGGTGTTCTTCGG - Intergenic
1173302518 20:41816768-41816790 TGGGCCCACTTCATGTTCTCAGG - Intergenic
1173392038 20:42644067-42644089 AGGGCCCCCTTGGTTTTCTGCGG - Intronic
1177509250 21:22062427-22062449 ATGGCCCAGTTAATGTTTTAAGG - Intergenic
1180072506 21:45443374-45443396 AAGGCCCACTTGGTTTTCAAGGG - Intronic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1182136350 22:27907451-27907473 AGGGCCCATTTGCTGTCCTCTGG - Intronic
1182148601 22:28013015-28013037 AGTGCCCTCTGGATGTTCTCTGG - Intronic
950765081 3:15267548-15267570 AGGGCCCATTTGGTTTTCTTGGG - Intronic
950812701 3:15664844-15664866 AGGGCCCACTTGAGGGTGAAAGG + Intergenic
954795669 3:53160445-53160467 AGGGACCAGTTGGGGTTCTAGGG - Intronic
955072746 3:55585342-55585364 ATGGGCCACTTGATGTCCAAGGG - Intronic
955338295 3:58105082-58105104 AGGGCCAACTTGAACTTCAAAGG - Exonic
956460527 3:69467108-69467130 AGGTCCCACTGTATTTTCTAAGG + Intronic
962845415 3:139269945-139269967 AGGGCCATCTTGCTGCTCTAAGG + Intronic
966865315 3:184255604-184255626 AGAGGCCACTGGATCTTCTAAGG + Intronic
970536842 4:17038611-17038633 AGGGCCTACGTGCTTTTCTAAGG - Intergenic
971434939 4:26610604-26610626 AGGGCCTACTTGATGGTAGAGGG - Intronic
972460809 4:39300394-39300416 AGGGCCCATTTGATGTTGCCCGG - Exonic
972737164 4:41853949-41853971 AGGGCCCACTTGAAGATGGAGGG + Intergenic
972754795 4:42034759-42034781 AGGCCCCACTTGCTATTCTTTGG + Intronic
973617966 4:52698722-52698744 GGGGCCTACTTGATGTTGGAGGG + Intergenic
974003470 4:56533222-56533244 AGAGCCCACTTGAAGTTCAGGGG - Intronic
984623985 4:181985246-181985268 AGGGGCCATGTGATGTTCTGGGG - Intergenic
985584608 5:723780-723802 AGGACCCACCTGAAGATCTAGGG - Intronic
985598115 5:808110-808132 AGGACCCACCTGAAGATCTAGGG - Intronic
986037911 5:3958970-3958992 AGGGTGCACATGATTTTCTAGGG - Intergenic
986467379 5:8039241-8039263 AGGGGCCACTTGAGGGTATAGGG - Intergenic
986609281 5:9550861-9550883 AGGGCCCACTGGATGCTTGATGG - Intergenic
992512635 5:77454048-77454070 AGTGCCCACATGATCTACTAAGG - Intronic
993461054 5:88182466-88182488 AGTGCCCACATGATGCTCAAAGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG + Intronic
1001583523 5:172816944-172816966 ATGGCCCACTTGATGATGTCAGG + Intergenic
1003363330 6:5449786-5449808 AGGGCCCACATGATGCTCAAAGG - Intronic
1003718224 6:8670966-8670988 AGGGCCCATTTGCTGTTCACTGG + Intergenic
1014240510 6:119012804-119012826 AGGGCCAACTTGCCTTTCTAAGG + Intronic
1014495862 6:122121611-122121633 AGGACCCACCTGATGATCTCAGG + Intergenic
1014642497 6:123929877-123929899 AGTGCCCACATGATGTTCAAAGG - Intronic
1018110127 6:160528507-160528529 AGTGCCAACATGATGTTCAAAGG - Intergenic
1021144527 7:17068592-17068614 AGGGTCAACATGATGTTCAAAGG - Intergenic
1033157725 7:138971163-138971185 AGGGCCCAGTTGAAGTTGGAAGG - Intronic
1033877336 7:145838575-145838597 AGGGCCTACTTGAGGGTGTAAGG + Intergenic
1040986434 8:53298832-53298854 GGGGCCCACTTGAGGGTCGAGGG - Intergenic
1043326402 8:79057228-79057250 CGGGCCAACATGATGTTCCATGG + Intergenic
1043582434 8:81729621-81729643 AAGGTCCACATGATGTGCTAAGG - Intronic
1044522823 8:93219146-93219168 CTGGCCCACTTGACTTTCTAGGG - Intergenic
1045848318 8:106662954-106662976 AGGGCCTACATGATGCTCAAAGG + Intronic
1046096076 8:109562846-109562868 AGGGCCTACCTGATGCTCAAAGG - Intronic
1046124315 8:109885026-109885048 AGGGCTCAATTGATGATATAGGG + Intergenic
1049146680 8:141005708-141005730 AGGGCCCATTTGACTTTATACGG - Intergenic
1049149603 8:141026137-141026159 TGGGCCCACTAGATATTCTGGGG + Intergenic
1049428039 8:142545953-142545975 AGGGCACAGTTGAGGTTGTAGGG - Intergenic
1059633080 9:116145683-116145705 AGGGCCTACTTGAGGGTGTATGG + Intergenic
1185831313 X:3305540-3305562 AGTTCCCTCTGGATGTTCTAGGG + Intergenic
1186862578 X:13688429-13688451 AGGGCCCACTTGAGGGTTGAGGG - Intergenic
1189198435 X:39171039-39171061 TAGTACCACTTGATGTTCTATGG + Intergenic
1189960634 X:46321645-46321667 AAGGCCAACTTCATTTTCTATGG - Intergenic
1190991963 X:55561055-55561077 GGGGCCCACCTGATGGTGTAGGG + Intergenic
1191587472 X:62844385-62844407 GTGGCACACTTGATGTTCTAGGG + Intergenic
1192042107 X:67633289-67633311 AGGGCCTACTTGATGGTGGAGGG - Intronic
1192046388 X:67678686-67678708 AGGGCCTACTTGAGGTTGTAGGG - Intronic
1195534760 X:105998753-105998775 AGGGCCTACTTGAGGTTGCAGGG + Intergenic
1195774969 X:108392807-108392829 AGGGCCCACTTTCTGTTTCATGG - Intronic
1196018477 X:110964784-110964806 GTGGCCCATTTGGTGTTCTAAGG + Intronic
1197767931 X:130071151-130071173 TGGGTCCACTTGATGTACTTGGG + Exonic
1198269558 X:135042519-135042541 AGGGCCTACTTGAAGTTGGAGGG - Intergenic
1199845542 X:151690351-151690373 AGGGCCCACTTGAGGGTTGATGG - Intergenic
1200783060 Y:7234231-7234253 AGGGCCTACTTGAGGGTTTAGGG + Intergenic
1201713503 Y:17017795-17017817 AGGGCCTACTTGAGGTTGGAGGG + Intergenic