ID: 1001465587

View in Genome Browser
Species Human (GRCh38)
Location 5:171962341-171962363
Sequence AAATTATAACAAATGTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 649}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001465587_1001465589 18 Left 1001465587 5:171962341-171962363 CCAAGATACATTTGTTATAATTT 0: 1
1: 0
2: 1
3: 57
4: 649
Right 1001465589 5:171962382-171962404 ATGATTAATATTCTAATTTAGGG No data
1001465587_1001465588 17 Left 1001465587 5:171962341-171962363 CCAAGATACATTTGTTATAATTT 0: 1
1: 0
2: 1
3: 57
4: 649
Right 1001465588 5:171962381-171962403 AATGATTAATATTCTAATTTAGG 0: 1
1: 0
2: 5
3: 70
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001465587 Original CRISPR AAATTATAACAAATGTATCT TGG (reversed) Intronic
900036028 1:409655-409677 AAAATATAAAAAAATTATCTAGG - Intergenic
900057652 1:645407-645429 AAAATATAAAAAAATTATCTAGG - Intergenic
900921466 1:5673964-5673986 AAATGATAACAAATTAATGTGGG - Intergenic
901306109 1:8234262-8234284 AAAAAAAAAAAAATGTATCTTGG - Intergenic
901776559 1:11564123-11564145 AAATTATATCAACAGTATCAGGG + Intergenic
902338383 1:15767048-15767070 AAATTAAAAAAAATGTAGCCAGG - Intronic
903669360 1:25026321-25026343 TAATAATAATAAATGTATCGAGG + Intergenic
904781640 1:32954067-32954089 AAAATACAAAAAATGTAGCTGGG - Intronic
904866041 1:33579662-33579684 AAATTAAAAAAAAAGAATCTTGG - Intronic
905046865 1:35011128-35011150 AAATTTTAAAAAATGTTTGTGGG - Intronic
906493968 1:46290247-46290269 AAAATAGAAAAAATGTAGCTGGG + Intronic
906753413 1:48286876-48286898 AAAGTACAAAAAATTTATCTGGG + Intergenic
907034676 1:51205793-51205815 AAAATACAAAAAATTTATCTGGG + Intergenic
908198220 1:61767091-61767113 AAATTAGAACTAATGTAATTTGG + Intronic
909131160 1:71738769-71738791 ATATTTTAAAAAATGTTTCTGGG + Intronic
909733078 1:78920096-78920118 AAATTACAAATAATGTTTCTAGG + Intronic
909737807 1:78986847-78986869 AAAATAGTAAAAATGTATCTTGG + Intronic
910716694 1:90239160-90239182 TAATTATATTAAATGTATATTGG - Intergenic
911167884 1:94741045-94741067 AAATTATTTCTAATGTTTCTTGG - Intergenic
911349414 1:96734827-96734849 AAAGTATAAGAAATGTTCCTGGG - Intronic
911425252 1:97701978-97702000 AAATTATACAAATTGTAGCTGGG - Intronic
911685534 1:100772602-100772624 AAATAGTAAAAAATGTATTTGGG - Intergenic
911790441 1:102009086-102009108 AAATTATGATAAATGTTACTAGG + Intergenic
912657670 1:111502073-111502095 ATATTATAATAAATATATATAGG + Intronic
913574899 1:120162301-120162323 AAAATAAGACAAATGTATCAGGG - Intronic
914296164 1:146327143-146327165 AAAATAAGACAAATGTATCAGGG - Intergenic
914932620 1:151948540-151948562 AAATTCTCACAAATGGAGCTGGG + Intergenic
914942100 1:152032405-152032427 AAATAAGAAAAAATGCATCTTGG - Intergenic
915010800 1:152684623-152684645 AAATTACAACAAATGGATATAGG - Intergenic
915986209 1:160467561-160467583 AAAATATATCAACTCTATCTTGG + Intergenic
916344288 1:163770757-163770779 AAATGAGAACAAAAGTACCTAGG - Intergenic
916462040 1:165035136-165035158 AAAATCTAACAACTGTGTCTCGG - Intergenic
917352790 1:174095187-174095209 AAATTTTAAGAAATAAATCTTGG - Intergenic
917958347 1:180123341-180123363 AAATTAAAAAAAATGTTTTTAGG + Intergenic
918440569 1:184562294-184562316 AAATTATAACAAATGGTGTTAGG + Intronic
918486848 1:185038074-185038096 AAACCATACCAAAAGTATCTTGG + Intergenic
918820028 1:189241218-189241240 AAATAATAATAAGTGTTTCTTGG + Intergenic
918864284 1:189874475-189874497 TAATTAGGACAAATGTATCAAGG + Intergenic
918878889 1:190087655-190087677 AAATTGTAAATAATGTATTTGGG - Intergenic
918900275 1:190407766-190407788 AACCTGTAACAAATTTATCTTGG + Intronic
919530487 1:198712812-198712834 AAATTTAAAGAAATGCATCTGGG - Intronic
919637862 1:200020848-200020870 TAATAAAAAAAAATGTATCTGGG - Intergenic
920697656 1:208193725-208193747 AAAATATAAAAAATTTGTCTGGG + Intronic
921607201 1:217169568-217169590 AAAGTATAAAAAAAGTAGCTGGG + Intergenic
921732037 1:218589394-218589416 AAATTATACCAAATATAACATGG + Intergenic
921809306 1:219493627-219493649 TAATTTTAAAAAATGTATATTGG - Intergenic
921897510 1:220415700-220415722 AAAATAAAAAAAATGTAGCTGGG + Intergenic
922710985 1:227832062-227832084 ACTTTAAAACAAATGTAACTAGG - Intronic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923486966 1:234442571-234442593 AAACTATAACCAATGAATATGGG + Intronic
924289274 1:242521839-242521861 AACCTATAACAAATGTAACCTGG - Intronic
924423170 1:243928280-243928302 AAAATAAAATAAATGTTTCTAGG - Intergenic
1063055173 10:2496461-2496483 AAAGTAAAACAAATATATATTGG + Intergenic
1063345421 10:5307443-5307465 AAATTACATTAAATGTATCTTGG - Intergenic
1063549385 10:7015251-7015273 AACTTAGAAAAAGTGTATCTGGG - Intergenic
1063750124 10:8934387-8934409 AAATAAAAACAAATCTATGTAGG + Intergenic
1063846211 10:10129758-10129780 AAATTATAAGCATTGCATCTAGG + Intergenic
1064868921 10:19915584-19915606 AAATTACAACAAAAGGAACTTGG - Intronic
1065109729 10:22427787-22427809 AAACTACAACAAATCTATGTGGG + Intronic
1065481405 10:26197722-26197744 AAAATACAAAAAATTTATCTGGG - Intronic
1065731679 10:28715039-28715061 AAAATATATCAAATTTATATTGG - Intergenic
1067665741 10:48276895-48276917 AAAATATAACAAAATTATATAGG - Intergenic
1067778732 10:49182174-49182196 AAAATAAAACAAATGTACCAAGG + Intronic
1068470183 10:57451520-57451542 ATAATAGAAGAAATGTATCTGGG - Intergenic
1068566644 10:58583211-58583233 AAATTTTAAGAAATCTACCTTGG - Intronic
1068692681 10:59933103-59933125 AAAATTTAGCAAAAGTATCTTGG + Intergenic
1069106491 10:64389321-64389343 AAATCATGACAATTGTTTCTAGG + Intergenic
1069187976 10:65450682-65450704 AAATTATAAGAAATTATTCTGGG + Intergenic
1069350880 10:67525504-67525526 AAAGGAGAAAAAATGTATCTGGG - Intronic
1070260729 10:74852874-74852896 AAAGTATCACAAATGTAGCTGGG - Intronic
1070745959 10:78933984-78934006 AAATGATCACACCTGTATCTAGG + Intergenic
1070855411 10:79604580-79604602 TAATTAAAACAAAGGTTTCTTGG + Intergenic
1071389792 10:85161107-85161129 AAATTATATAAAATATATATGGG - Intergenic
1071584575 10:86807151-86807173 CACTTTCAACAAATGTATCTAGG + Intronic
1071966839 10:90860012-90860034 AAAAAATATCAAAAGTATCTTGG - Intergenic
1071968619 10:90878837-90878859 AAAGTATAACAAATGTAGGAAGG + Intronic
1072291171 10:93966361-93966383 AAATATTAACAACTGCATCTCGG - Intergenic
1074246344 10:111697565-111697587 AAATTACAAAAAATTTAGCTGGG - Intergenic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1074335318 10:112568600-112568622 AAATGATAGCAAATGGTTCTTGG + Intronic
1074598925 10:114893935-114893957 AAATTTTAAAAAATATATCTGGG + Intronic
1075029164 10:119009626-119009648 AAATAATAACAATAGTATTTTGG + Intergenic
1075176633 10:120169723-120169745 AAATTAAAAATAATATATCTAGG - Intergenic
1075247402 10:120835461-120835483 AAATTTTCAAAAATGTATCATGG - Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1075862272 10:125686944-125686966 AAATTCTAACAAATTTGTCCAGG + Intergenic
1076730131 10:132434299-132434321 AAGTTCTAACAAATGAATCTGGG + Intergenic
1078946466 11:16073541-16073563 GAAATCTAACAAATGTATTTGGG + Intronic
1079051199 11:17161621-17161643 AAATTGGAACTAATGTATTTAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079511283 11:21213828-21213850 AAATTAACTCAAATGTATCATGG + Intronic
1080480994 11:32650485-32650507 AAATTATATCATATGTTGCTTGG + Intronic
1080883516 11:36344898-36344920 AAATTTTAACAAATCAAGCTTGG - Intronic
1080978493 11:37371438-37371460 AAATAATAAAAAATGGATGTTGG + Intergenic
1081113456 11:39166810-39166832 AAATTATGCCAAATGGATTTTGG + Intergenic
1081124274 11:39303207-39303229 AAATTATAAAAAAATTAGCTGGG + Intergenic
1082204916 11:49421482-49421504 ACATTATATCAAATGTGTATAGG - Intergenic
1083229258 11:61305196-61305218 TAATTATTACAAATGATTCTTGG - Intronic
1084843848 11:71883700-71883722 AAATTGTAACAAAAGGATTTGGG + Intronic
1085189981 11:74611363-74611385 AAATTATAACATATGTTTTAAGG + Intronic
1085380028 11:76107538-76107560 ACATTATAACATATCTATTTTGG + Intronic
1085879439 11:80448499-80448521 AAATTATAACAAAATTATGATGG + Intergenic
1086319846 11:85633626-85633648 AAATTATTTTAAATGTATCTGGG + Intronic
1087334085 11:96821051-96821073 AAACTATAGCCAATGTCTCTTGG - Intergenic
1087710625 11:101545671-101545693 AAATTATAAGAAATGTATTAAGG - Intronic
1087903393 11:103668117-103668139 AAATTATAGCTAGTGTAACTGGG - Intergenic
1088098543 11:106128890-106128912 AAATTCTAACAACTCTATCTTGG - Intergenic
1088176446 11:107057970-107057992 AAATTAAAAAATATGTATCCAGG + Intergenic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1090360415 11:126168619-126168641 AAATTACAAAAAAATTATCTGGG - Intergenic
1090972261 11:131653814-131653836 CAATTATCACCAATGTATCCTGG - Intronic
1091211800 11:133866979-133867001 AAAATATACAAAAAGTATCTGGG - Intergenic
1091231316 11:133989608-133989630 GAATAATAAGAAATCTATCTTGG - Intergenic
1092181473 12:6449863-6449885 AAAAAATAAAAAATGTATCAGGG + Intronic
1092200334 12:6578234-6578256 AAATTATATGAAATGGATCCAGG - Intronic
1092631043 12:10378167-10378189 ACATTCCAACAAATGGATCTTGG - Exonic
1093076727 12:14766566-14766588 AAATAATAAAAAATAAATCTAGG + Intergenic
1093212052 12:16319562-16319584 TAATTATAATAAATGTCTATAGG + Intergenic
1094799338 12:34014053-34014075 TAATTATCACAAATGCATTTGGG - Intergenic
1095112127 12:38308328-38308350 TAATTATCACAAATGCATTTGGG - Intergenic
1096268801 12:50147101-50147123 AACTTATAAAACAGGTATCTAGG + Intronic
1096274874 12:50198051-50198073 AAAACATCACAAATGTATGTTGG - Intronic
1096582545 12:52596916-52596938 ATATTATAACAAAATTATGTGGG + Intronic
1096692773 12:53331309-53331331 AAAATATAAAAAAATTATCTGGG + Intronic
1096716869 12:53496632-53496654 AAAGTATAACAACAGTTTCTAGG + Intronic
1097490064 12:60255896-60255918 AAATTATAACAATTATATTTTGG - Intergenic
1097725371 12:63069855-63069877 AAATTATAACACATGTGATTTGG - Intergenic
1098482018 12:70974000-70974022 AACTTTTAAAAAATGTGTCTTGG - Intergenic
1099319429 12:81126562-81126584 AAATTTTAACATAAGTATCAAGG + Intronic
1099403739 12:82233523-82233545 TATTTATTACAAATGGATCTTGG - Intronic
1099816871 12:87660535-87660557 AAATAATTACAAATGTTACTTGG - Intergenic
1100228511 12:92583578-92583600 AAATTGTATCAAATCCATCTTGG + Intergenic
1101085832 12:101234865-101234887 AAATTATGACATATCTCTCTTGG - Intergenic
1101203356 12:102460184-102460206 AAATTAAAACAAATACATATTGG + Intronic
1101610952 12:106291277-106291299 AAATTATGGTACATGTATCTAGG - Intronic
1102171471 12:110845925-110845947 AAAATATAACAAATTTAGCCCGG - Intergenic
1102545640 12:113653225-113653247 ACATTATCACAAATGTCTGTAGG - Intergenic
1102602407 12:114041676-114041698 TAATTTTGACAAATGTATCATGG - Intergenic
1103266886 12:119638300-119638322 AAATTTAAAAAAATATATCTGGG + Intronic
1103720529 12:122972669-122972691 AAAATATAACAAAATTATCCAGG - Intronic
1104312025 12:127662072-127662094 AAAGTAAAACAATTGTTTCTTGG - Intergenic
1104454188 12:128896738-128896760 AAATTATCAAAACTGTAGCTGGG - Intronic
1104629551 12:130387789-130387811 AAGTTTTAACAAATGTACATGGG + Intergenic
1106346168 13:28880967-28880989 AAATGAAAACAAAAGTATCTTGG - Intronic
1106424654 13:29614642-29614664 AAATTATAACAGATCAAACTTGG + Intergenic
1106791319 13:33157507-33157529 AAAATACAAAAAATGTAGCTGGG + Intronic
1108400438 13:50036556-50036578 AAATATTAACAAATGTGTCAGGG + Intergenic
1108744231 13:53374602-53374624 AAATCTTAACAAATGTTTATTGG + Intergenic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1109298269 13:60562150-60562172 AAAATATAAAAAAATTATCTGGG + Intronic
1109395237 13:61748767-61748789 AAAATATAACAAATTTATTTTGG + Intergenic
1109602853 13:64655967-64655989 AGATCATAACAAATTTCTCTGGG - Intergenic
1109812143 13:67526910-67526932 TGATTATAACAAATGCATCATGG + Intergenic
1109817868 13:67610702-67610724 AAATTATCACAAAGTGATCTTGG + Intergenic
1109819192 13:67630069-67630091 ATATAATAACAAAGGTATTTTGG - Intergenic
1110100838 13:71599105-71599127 AAATTATAATAATTTTATCATGG - Intronic
1110108941 13:71718425-71718447 AAATTAAAACAAAATTAGCTGGG + Intronic
1110191497 13:72734560-72734582 CAATTATAACAAGTTTATCATGG - Intronic
1110433317 13:75451517-75451539 AAAATATAAAAAATGTAGCCAGG + Intronic
1110441743 13:75533760-75533782 AAATTATAAAAAATTGAGCTTGG + Intronic
1110470082 13:75849807-75849829 ACATTTTAAAAGATGTATCTTGG + Intronic
1110528525 13:76568980-76569002 AAATTATACAAAATGAAACTTGG + Intergenic
1110695458 13:78482982-78483004 AAATTAAAAAAAATGTATTTTGG - Intergenic
1110833100 13:80054044-80054066 AACCTATCACAAATGTATTTGGG + Intergenic
1111150150 13:84242451-84242473 AATTTCTAAATAATGTATCTGGG + Intergenic
1111203235 13:84967335-84967357 AAATTTTGAAAAATGTATTTTGG + Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1111497419 13:89070483-89070505 AGATTTTAACAAATGGATTTAGG - Intergenic
1111872668 13:93853016-93853038 AAATAATTACAAATATTTCTGGG + Intronic
1112372717 13:98808745-98808767 AAATTATAATACATATATTTAGG - Intronic
1112634057 13:101195345-101195367 AAAATATAAGAAATGTATAGGGG - Intronic
1112795569 13:103052996-103053018 AAATTAAAACTAATGTATGCTGG - Intronic
1112811065 13:103219434-103219456 CAATTATAAAAAATCTATTTAGG + Intergenic
1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG + Intronic
1114909532 14:27172790-27172812 AAATTTTAAAAAATGTTTGTGGG + Intergenic
1115175322 14:30555410-30555432 AAAATAAAACAAAAGTATATTGG - Intergenic
1115529632 14:34315352-34315374 AAATTTTAAAAAGTATATCTGGG - Intronic
1115952363 14:38735687-38735709 AAAATATAACAATTGTATACTGG - Intergenic
1116018821 14:39437315-39437337 AAATTGTTAAAAATGTTTCTGGG - Intergenic
1116023977 14:39494207-39494229 AAATAATAACAATAGTATTTTGG + Intergenic
1116085269 14:40229006-40229028 AAATAAAAACAAATTTCTCTTGG + Intergenic
1116379590 14:44248792-44248814 AGATTATGACAAATGTAACCAGG - Intergenic
1116551188 14:46240880-46240902 AAATTACAGAAAATGTAACTAGG + Intergenic
1116997932 14:51343394-51343416 AAAATACAAAAAATTTATCTGGG - Intergenic
1117013760 14:51497104-51497126 TAATTCTGACATATGTATCTGGG + Intronic
1117469862 14:56032373-56032395 AAATTATAACATAACTATATTGG + Intergenic
1117601814 14:57383981-57384003 TAATAATAAAAAATGCATCTGGG + Intergenic
1118020780 14:61711741-61711763 AAATGTTAACAAATGAATCGTGG - Intronic
1118168657 14:63362890-63362912 AAAAAAAAAAAAATGTATCTGGG + Intergenic
1118987619 14:70770339-70770361 AAATAAAAAAAAAAGTATCTGGG - Intronic
1119010430 14:70980766-70980788 AATTTAGAAGAAATGTTTCTGGG + Intronic
1119289646 14:73485196-73485218 AAATTATATATAATGTATATTGG + Intronic
1120061941 14:79993748-79993770 AAATTATTGCTAATGTATATGGG - Intergenic
1120266924 14:82262941-82262963 AAATTCTAACAAATAGAGCTGGG + Intergenic
1120383670 14:83816455-83816477 ATCTTATAATAAATGTTTCTTGG - Intergenic
1120628493 14:86859098-86859120 AAATTCAAACAAATGGATCATGG - Intergenic
1121281162 14:92699603-92699625 AAATTTTAAAAAATGGATGTTGG + Intergenic
1123848892 15:24333375-24333397 AAAGTACAAGAAATGTCTCTGGG - Intergenic
1123863366 15:24490828-24490850 ATATTTTAACAAATGTTGCTAGG - Intergenic
1124948646 15:34294554-34294576 AAATTAAAAAAAAGGTATTTAGG - Intronic
1125397569 15:39266400-39266422 ATATTTCAACAAATGTATGTGGG - Intergenic
1127326023 15:57896188-57896210 AAATGATTACAAAGGTCTCTTGG + Intergenic
1128780883 15:70357835-70357857 AAATGAAAACAAATGCATCCAGG - Intergenic
1128795116 15:70461071-70461093 AAATTACCACAAATGCATCAGGG + Intergenic
1129827545 15:78644273-78644295 AAATTTTAACAAATGTGTTTTGG - Intronic
1130037395 15:80374097-80374119 AAATTAAAAAAAATATATTTAGG + Exonic
1130058841 15:80555014-80555036 AAATAATTACAAATGGATCTGGG + Intronic
1130921965 15:88354784-88354806 AGATTAGAATAAATGTTTCTGGG - Intergenic
1131238977 15:90721961-90721983 ATATTTTTACAAATGTATCTTGG - Intronic
1131525806 15:93151535-93151557 AAATTATAAAAAAATTATTTGGG - Intergenic
1132179819 15:99743799-99743821 AAATTAAAAAAAATTTATCCAGG + Intergenic
1133041420 16:3062116-3062138 AGAGCATAACAAATGTATCTGGG + Intergenic
1133068807 16:3231708-3231730 AAATTATGAGAAATGCATCTAGG + Intronic
1134307367 16:13045143-13045165 AAAGTTTAAGAAATGTATTTAGG + Intronic
1135045149 16:19149293-19149315 AAATTAAAACAAAATTAGCTAGG + Intronic
1135309856 16:21396902-21396924 AAGTTTTAACATATGAATCTTGG + Intergenic
1135362749 16:21829002-21829024 AAGTTTTAACATATGAATCTTGG + Intergenic
1135621065 16:23956112-23956134 AAATTATAAAAAAAGTATATAGG - Intronic
1135838107 16:25846371-25846393 AAAAAATAAAAAATGTAGCTGGG + Intronic
1136082777 16:27863554-27863576 AAATTACAATAAATGTAACTGGG - Intronic
1136149437 16:28337224-28337246 AAGTTTTAACATATGAATCTTGG + Intergenic
1136182930 16:28566826-28566848 AAAATACAAAAAAAGTATCTGGG - Intronic
1136306601 16:29376026-29376048 AAGTTTTAACATATGAATCTTGG + Intergenic
1136472050 16:30487568-30487590 AAAATACAAAAAATTTATCTGGG - Intronic
1136700352 16:32132620-32132642 TAATGATAATAAATGAATCTTGG + Intergenic
1137938049 16:52654266-52654288 AAATTATAAGAATTGTACATTGG - Intergenic
1138040504 16:53659727-53659749 AAATTAAAACAAAATTAGCTGGG + Intronic
1138818127 16:60226387-60226409 AAATTACAAAAAAATTATCTGGG - Intergenic
1138945129 16:61840340-61840362 AAATAATAACCAATGTCTGTTGG + Intronic
1139773506 16:69298097-69298119 TAAAAATAAAAAATGTATCTGGG - Intronic
1139774776 16:69310254-69310276 AAAAAATAAAAAACGTATCTGGG - Intronic
1140105630 16:71957365-71957387 TAATTATATCAAATGTAAATAGG + Intronic
1140595894 16:76410774-76410796 AAATTTTACCAAATGTTTTTAGG - Intronic
1141365370 16:83437771-83437793 ATATTATATCAAGTGGATCTGGG - Intronic
1143522396 17:7452214-7452236 AAATTACAAAAAATTTAGCTGGG - Intronic
1143676020 17:8433651-8433673 AAGTTAGAACAAATTTATTTTGG + Intronic
1144005006 17:11091702-11091724 AAATGATAATAATTGTAGCTAGG + Intergenic
1144187208 17:12807925-12807947 ACATTGTAACCATTGTATCTGGG - Intronic
1144208397 17:12995085-12995107 AAATGATAATAAACGTTTCTTGG + Intronic
1144440895 17:15280583-15280605 ACAGTATAAAAAATGTATATTGG - Intergenic
1144443240 17:15303055-15303077 AAATTATAAATAAATTATCTTGG + Intergenic
1144804485 17:17955497-17955519 AAAATACAAAAAATTTATCTGGG - Intronic
1147001880 17:37369333-37369355 AAATTATAAACAATTTAGCTGGG + Intronic
1147404129 17:40198825-40198847 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1147892685 17:43728533-43728555 AAATTATAAATTATGTATTTAGG - Intergenic
1148070350 17:44905119-44905141 AAATGATACCAGATGTCTCTGGG + Exonic
1148121131 17:45212220-45212242 AATTTAAAAAAAATGTATATGGG - Intergenic
1149121851 17:53178342-53178364 AAACTAGAACAAATGCATGTGGG - Intergenic
1149249070 17:54747031-54747053 AAATTAAAAAAAATGTACTTTGG - Intergenic
1150032886 17:61758849-61758871 AGTTTTTAAAAAATGTATCTGGG + Intronic
1150149389 17:62796830-62796852 AAAATACAAAAAATGTAGCTGGG + Intronic
1150169103 17:62973188-62973210 AAAATATAACAAAATTAGCTGGG - Intergenic
1152812698 17:82389659-82389681 AACTTTTAAAAAATGTAGCTGGG - Intronic
1155494277 18:26427356-26427378 AAATAATAAAAAAATTATCTGGG + Intergenic
1156145901 18:34177441-34177463 AAGTTTTAACAAATTTATTTAGG - Intronic
1156413497 18:36860991-36861013 AAATTATAAAAAATTAACCTTGG + Intronic
1158065916 18:53408207-53408229 ATATTATCACAAATGTAGCAGGG + Intronic
1158102949 18:53851318-53851340 AAATTATAGAGAATATATCTTGG + Intergenic
1158365728 18:56733274-56733296 ACTTTATAAAAAATGTATGTTGG + Intronic
1158655913 18:59333548-59333570 AAGTTATAATAAATCTTTCTAGG + Intronic
1158674752 18:59508050-59508072 AAAATATAAAAAATTTAGCTGGG - Intronic
1158921690 18:62199018-62199040 AAAATATAACACATGTTTCAAGG - Intronic
1159145364 18:64447379-64447401 AAATTATAATAAATTTAACGTGG - Intergenic
1159600592 18:70425208-70425230 ACATTTTAACAACTGTATCAGGG + Intergenic
1159832249 18:73291403-73291425 AAATGATAACAAATATGTCTGGG + Intergenic
1160477013 18:79200617-79200639 AAATTATAATAAAGGTTTCTCGG + Intronic
1160670402 19:359879-359901 GAATTACAACATATGAATCTGGG + Intergenic
1161263664 19:3352449-3352471 AAATAAAAACATATGTTTCTTGG - Intergenic
1161432472 19:4241099-4241121 AAACTATAATAAATGTGTGTCGG + Intergenic
1161558745 19:4958812-4958834 AAATTAAAACAAAATTAGCTGGG + Intronic
1163092934 19:15033825-15033847 TTATTATAACAAATATATATGGG - Intergenic
1163108541 19:15142270-15142292 AAAATACAAAAAATGTAGCTGGG + Intergenic
1163150646 19:15411355-15411377 CAATTATAACAATTATTTCTGGG + Intronic
1163868407 19:19795828-19795850 AATTTTTTACAAATGTATTTTGG - Intronic
1163911359 19:20196774-20196796 AATTTTTTACAAATGTATTTTGG + Intronic
1163922346 19:20302715-20302737 AATTTTTTACAAATGTATTTTGG + Intergenic
1163946917 19:20546144-20546166 AATTTTTTACAAATGTATTTTGG - Intronic
1163961212 19:20695035-20695057 AATTTGTTACAAATGTATTTTGG + Intronic
1163971848 19:20805637-20805659 AATTTTTTACAAATGTATTTTGG + Intronic
1164020118 19:21294896-21294918 AATTTTTTACAAATGTATTTTGG - Intronic
1164104497 19:22095858-22095880 AAATTAAAACATATGTTTCCTGG - Intergenic
1164223854 19:23224505-23224527 AATTTTTCACAAATGTATTTTGG - Intronic
1164643778 19:29844181-29844203 AAATAATAAAAAATGTTGCTGGG - Intergenic
1164937831 19:32228986-32229008 AAAATAAAAAAAATGTAGCTAGG - Intergenic
1164979377 19:32602239-32602261 AAATAATTACAAATGGAGCTTGG + Intronic
1165983235 19:39744294-39744316 AAACTATAACAAGAGAATCTTGG + Intergenic
1166171746 19:41032653-41032675 AAATTAAAACATCTCTATCTGGG - Intergenic
1167451676 19:49574018-49574040 AAAATACAAAAAAAGTATCTAGG - Intronic
925091318 2:1158177-1158199 AAAATATAATAAAAGTATCCTGG + Intronic
925552229 2:5089107-5089129 ATATTGTAACAAATGTTACTAGG + Intergenic
925577913 2:5379884-5379906 AAAGTTTAAAAAATGTGTCTGGG + Intergenic
926236481 2:11049118-11049140 AAAGTACTAAAAATGTATCTGGG - Intergenic
926599183 2:14823473-14823495 AAATTACTTAAAATGTATCTAGG - Intergenic
926741876 2:16118074-16118096 TAAGTATAACAAAGTTATCTTGG - Intergenic
927071406 2:19533684-19533706 AAGTTAGAATAAATGTATTTTGG + Intergenic
927182146 2:20454293-20454315 AAAAAATAAAAAAAGTATCTGGG + Intergenic
928248311 2:29651464-29651486 AAATTATAACCAATGCATTAAGG - Intronic
928383043 2:30837320-30837342 AAATTATAGTAAATTTATATTGG + Intergenic
928541817 2:32292701-32292723 AAACTACAAAAAAAGTATCTGGG + Intronic
929179953 2:39027127-39027149 AAAATATAAAAAATGTATCCAGG - Intronic
929210981 2:39356846-39356868 AAATTATATTAAATGTTACTTGG - Intronic
929329447 2:40662926-40662948 AAATGAGAATAACTGTATCTTGG + Intergenic
930968088 2:57356804-57356826 TATTTATAACAAATGAAACTGGG - Intergenic
931014493 2:57960816-57960838 AATTTATAACAAGTGTAACAGGG + Intronic
931095547 2:58936727-58936749 AAATTATAAAAGATATATCAAGG + Intergenic
931727634 2:65127113-65127135 AAAATATAAAAACTGTTTCTGGG + Intronic
933139162 2:78772160-78772182 AAATTTTAATAACTGTATTTTGG - Intergenic
933402374 2:81814835-81814857 AAAATATCAAAAATTTATCTTGG - Intergenic
933551795 2:83787043-83787065 AACCTAAAACAAATGTAGCTTGG - Intergenic
933754137 2:85624503-85624525 AAAATTTTAAAAATGTATCTGGG - Intronic
934067962 2:88357273-88357295 AAATTATGAAAAATGTGACTTGG + Intergenic
934083480 2:88489352-88489374 ATATTACAACAAATCAATCTTGG + Intergenic
934944731 2:98531528-98531550 AAATAAAAACAAATGTACCTAGG + Intronic
935378894 2:102429921-102429943 AAATCATATCAAGTGTATTTTGG - Intronic
935678132 2:105613680-105613702 ATATTTTAAAAAATATATCTTGG - Intergenic
935689057 2:105714066-105714088 AAATATTAAGAAATGTGTCTTGG + Intergenic
935974894 2:108568671-108568693 AAAGAATAACAAATGTAGGTGGG - Intronic
936705966 2:115074170-115074192 AAATTTTAAAAAAGTTATCTGGG - Intronic
937506240 2:122540579-122540601 AAATGATGAGAACTGTATCTAGG + Intergenic
937541850 2:122965634-122965656 AAATTCTATCAAATCTATCCTGG - Intergenic
937588196 2:123582037-123582059 TTATTATATCAAATGTGTCTTGG + Intergenic
938397110 2:130959240-130959262 GAAGTTTAAGAAATGTATCTAGG - Intronic
938880021 2:135576094-135576116 AAATAATAAAAATGGTATCTTGG + Intronic
939070381 2:137533124-137533146 AAATGAAAACAAATATATTTTGG - Intronic
939231314 2:139429679-139429701 ATATTATAACCACTGTAACTTGG + Intergenic
939622911 2:144442112-144442134 AAATTAAAATGAATGTCTCTTGG + Intronic
939767926 2:146276500-146276522 ATATTATAAATAATGTATATTGG + Intergenic
939781498 2:146455903-146455925 AAAGAACAACAAATGTTTCTTGG + Intergenic
940419289 2:153460032-153460054 AAATTAAAATAAATGCATTTAGG + Intergenic
940793859 2:158056311-158056333 TAATTGTAACAAATGTACCATGG - Intronic
940942520 2:159578708-159578730 AAATTTTAACAACTGTCTCTAGG + Intronic
941230243 2:162903382-162903404 AAAGTATATCAAATCTCTCTGGG + Intergenic
941742999 2:169056017-169056039 AAAATATAATCAATGAATCTAGG + Intergenic
941839160 2:170061019-170061041 AAATTATAAAAAATTTACATTGG - Intronic
941975050 2:171394689-171394711 AATATATAACAACTGTATATAGG + Intronic
942526853 2:176861967-176861989 AAATAAGAAGAAATGTATATTGG - Intergenic
942718120 2:178918019-178918041 GAATTATCATAAATGTATCAAGG - Intronic
942891642 2:180996820-180996842 AAAATCACACAAATGTATCTTGG - Intronic
943504529 2:188737371-188737393 AAATTATAATTAATGTTTATTGG - Intronic
943981988 2:194565163-194565185 AAATTATAAAAAAATTATATGGG - Intergenic
945257851 2:207817189-207817211 AAATTATCTCAAATGTATAAAGG - Intergenic
945338755 2:208625016-208625038 AAATTATAATCAAGCTATCTTGG - Intronic
945613917 2:212043442-212043464 ACATTATATCAGATGTAACTTGG + Intronic
946124179 2:217545958-217545980 AAATAATAAAAAATGTAGCATGG + Intronic
946315381 2:218907971-218907993 AAAATACAAAAAATGTAGCTGGG + Intergenic
946550416 2:220795211-220795233 AAGTTTTAACACATGTATTTTGG - Intergenic
946628745 2:221643710-221643732 AAAATAAAACAAATATATCTTGG + Intergenic
946841855 2:223827541-223827563 AAATAAAAAAAAATGTAGCTGGG - Intronic
946888958 2:224254278-224254300 GAATTAGAAAAACTGTATCTGGG - Intergenic
948238295 2:236407236-236407258 AACTTGTGACAAATGTATTTAGG - Intronic
1169627888 20:7593171-7593193 TAATTTTAACACATTTATCTAGG - Intergenic
1169854021 20:10084086-10084108 TAATTATAGCAAATGTAGTTTGG + Intergenic
1169994234 20:11538959-11538981 AAATAATAACAAATGTTAATAGG + Intergenic
1170022938 20:11855692-11855714 AAATTATAACAAATGTGTAATGG + Intergenic
1171002781 20:21431434-21431456 ATATATTCACAAATGTATCTTGG - Intergenic
1171069435 20:22053221-22053243 AAATGATAAGAAATGGAACTTGG + Intergenic
1171468316 20:25348781-25348803 AAATTCTAACAAATAGATATTGG + Intronic
1174141166 20:48414875-48414897 AAAAGATAACAACTGTACCTGGG + Intergenic
1174600972 20:51724511-51724533 AAAAAATACTAAATGTATCTGGG + Intronic
1175455638 20:59111075-59111097 AAATTGTAATAAGTGAATCTAGG + Intergenic
1175554267 20:59836733-59836755 AAATTAAAAAAAATGTTTCTAGG - Intronic
1175673130 20:60923328-60923350 TAATTGTGACAAATGTATCATGG - Intergenic
1176142151 20:63549484-63549506 AAATAATAAAAAATTTATCTGGG - Intronic
1176989702 21:15480531-15480553 AAATTAATACAAAAGTAGCTGGG - Intergenic
1177970721 21:27786412-27786434 AAATTAGGAAAAATCTATCTAGG + Intergenic
1178326728 21:31652352-31652374 AAACTTTAACATATGTATTTGGG + Intergenic
1178349063 21:31858598-31858620 AAATTGTAAAAAATATTTCTGGG + Intergenic
1178426069 21:32479260-32479282 AAAATATAAAAAATTTAACTGGG + Intronic
1178999000 21:37436834-37436856 AAATTATAAATTCTGTATCTAGG - Intronic
1179021519 21:37645213-37645235 AAAATAAAACAAATTTAGCTGGG + Intronic
1180235472 21:46456979-46457001 AAGTAATAAAAAATGTATCCAGG + Intergenic
1180679645 22:17616185-17616207 AAAATATAAAAAATTTAGCTGGG + Intronic
1181385264 22:22540456-22540478 GAATTACAACAAATGAATTTTGG + Intergenic
1181840618 22:25656474-25656496 AAATTAAAAAAAAAGTATCTGGG - Intronic
1182178805 22:28322674-28322696 AAAATATAACTAATGTGCCTAGG - Intronic
1182390308 22:29988832-29988854 AAATGTTAACAAGTGAATCTGGG - Intronic
950817275 3:15719037-15719059 AAACTATAAAAAATGTTACTAGG + Intronic
951251337 3:20397228-20397250 GAATTATAACAAATTTACTTGGG - Intergenic
952069899 3:29622135-29622157 AAATTATAATAAATATTTGTAGG - Intronic
952547294 3:34433893-34433915 TAATTTTAACAAATGAATGTAGG + Intergenic
954344754 3:49987474-49987496 AAATTACAAAAAATTTAGCTGGG - Intronic
955013327 3:55042230-55042252 AGATTTTAACAAATCTCTCTTGG - Intronic
955080396 3:55652711-55652733 AAAATATAAAAAAAGTAGCTGGG + Intronic
955100158 3:55841123-55841145 AAGTTTTAACAAATTTATTTAGG - Intronic
955367380 3:58322517-58322539 AAAATATGACAAATATATTTTGG + Intergenic
955468610 3:59262664-59262686 TAATTATAACCATTATATCTTGG - Intergenic
955681676 3:61507786-61507808 AAATAATAAAAAATAAATCTTGG - Intergenic
956389797 3:68759301-68759323 AAATTATTCCCAGTGTATCTGGG - Intronic
957023860 3:75156750-75156772 AGATTATAGCAAATGTATTAAGG + Intergenic
957191213 3:77011933-77011955 AACTTAAAACAAATTTATGTAGG + Intronic
957633277 3:82746155-82746177 AAACCATAAAAAATGTTTCTAGG + Intergenic
958476734 3:94593455-94593477 AAATTATAAGAAATAAATTTAGG - Intergenic
959280607 3:104333585-104333607 AAGATATATCAGATGTATCTTGG + Intergenic
959307399 3:104687006-104687028 TATTTATAACAAATATATCAGGG - Intergenic
959310846 3:104735016-104735038 AAATTCTAACAAACTTAGCTGGG - Intergenic
960528068 3:118733073-118733095 AAAATAAAAAAAATGTATCTCGG - Intergenic
960923563 3:122773795-122773817 AAAGTATAAAAAAATTATCTTGG - Intronic
961957606 3:130820077-130820099 ATATTATAAAAATTGTATTTGGG + Intergenic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
962681007 3:137800403-137800425 AAATAATAATAAATATATTTTGG - Intergenic
963438963 3:145312296-145312318 GAATTATTACAAATGAATTTAGG + Intergenic
963703124 3:148651505-148651527 ACATTTTAACAAATGTCACTGGG - Intergenic
963910283 3:150811470-150811492 AAATTATAACAAAGGGAATTTGG + Intergenic
964047820 3:152352409-152352431 AAATTAAAACAATTTTATCCTGG + Intronic
964817621 3:160733382-160733404 TAATAATAACAATTGTATTTTGG - Intergenic
965142163 3:164851928-164851950 ACATTATAACAAATGTTATTTGG + Intergenic
965377020 3:167937446-167937468 AGATTATGACATTTGTATCTGGG - Intergenic
965558903 3:170043494-170043516 TAATTCTGACAAATGTCTCTAGG + Intronic
965704879 3:171496235-171496257 AAATAAAAAGAAATGTATGTTGG - Intergenic
965887223 3:173461342-173461364 AAATAAAAACAAATGGGTCTGGG - Intronic
966047367 3:175568971-175568993 ATATTGTAACAAATGTTACTGGG + Intronic
966367837 3:179209826-179209848 AAATTTTAATAAATGTATCATGG + Intronic
966461167 3:180178365-180178387 AAATTACAACATATTTATATTGG - Intergenic
967211232 3:187171318-187171340 AAAATATTACATATTTATCTTGG - Intronic
967754310 3:193151608-193151630 AAATTCTAACACATGAATTTTGG - Intergenic
968250669 3:197209076-197209098 AAATTAAAACAAATATGACTTGG + Intronic
968732371 4:2275505-2275527 AAATTATCACGAATATTTCTAGG - Intronic
969784931 4:9449654-9449676 AAATTGTAACAAAAGGATTTGGG + Intronic
970254918 4:14157327-14157349 AAACTATAAAAAATGTCTCCAGG - Intergenic
970976944 4:22052627-22052649 AAATTAAAAAAAATGGATGTTGG - Intergenic
971559163 4:28052889-28052911 AAATTATTATAAATATTTCTTGG + Intergenic
971566758 4:28153709-28153731 AAATTTTACCAAATGTATTTAGG + Intergenic
971787590 4:31124504-31124526 TAATTTTAATAATTGTATCTTGG - Intronic
971994752 4:33950944-33950966 CAATTATAATAAATGTATGTGGG + Intergenic
972102409 4:35438140-35438162 AGATTCCAACAAATGTATTTTGG + Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972326789 4:38024188-38024210 ACATTATACAAAATATATCTGGG + Intronic
972536399 4:40003328-40003350 AAATTACAAAAAAATTATCTGGG + Intergenic
972685867 4:41352238-41352260 AAATCACAACAAACGTCTCTCGG + Intergenic
973710029 4:53620724-53620746 AAATTATATTAAATGTATGAAGG + Intronic
973856362 4:55014522-55014544 AAAAGAAAACAAATGTCTCTGGG + Intergenic
974336497 4:60552877-60552899 AAATTATAACCAATGTAATTTGG - Intergenic
974365937 4:60948735-60948757 AAACATTAACAAATCTATCTTGG - Intergenic
974639803 4:64613538-64613560 AAATTATAACTATTATAACTTGG + Intergenic
975286908 4:72631948-72631970 AAATTTTAATGAATGAATCTAGG + Intergenic
975804062 4:78094393-78094415 ACATTATATTAAATGTATTTTGG + Intronic
976074878 4:81286200-81286222 AAATGATAAACAATGTAACTGGG - Intergenic
976524332 4:86069842-86069864 TAATTATAGCAAATGTAATTAGG - Intronic
976944333 4:90745848-90745870 AAATTAAAAAAAATTTAGCTGGG - Intronic
977123913 4:93140057-93140079 AAGTTACAAAAAAAGTATCTTGG + Intronic
977297953 4:95231785-95231807 AAATTATAATAAATGACCCTGGG - Intronic
977335130 4:95688199-95688221 AAATTATAACAGAAGGAACTTGG - Intergenic
977413674 4:96701068-96701090 AAATTTTAAAAAAGGTAACTGGG - Intergenic
977704810 4:100059491-100059513 AAATTATTATTAATGTATTTAGG + Intergenic
978134920 4:105245679-105245701 AAATTTTTAAAAATGTATGTAGG + Intronic
978870311 4:113567853-113567875 TAATTATAACTAATGTTTATTGG - Intronic
979029856 4:115629558-115629580 AAATTATACCAAAAGTATCATGG - Intergenic
980222353 4:129935610-129935632 AAATTAAAAAAAAATTATCTGGG - Intergenic
980427303 4:132642900-132642922 TAATTAAAATAAATTTATCTTGG + Intergenic
980819863 4:138000099-138000121 AATTGATAACAAATATATATTGG + Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
982617111 4:157652600-157652622 AAATTATAATAAAAGTGTTTTGG - Intergenic
982630085 4:157820599-157820621 AAAATAAAACAAATATACCTAGG + Intergenic
983269528 4:165544975-165544997 AAATGTTAACAATTGAATCTAGG - Intergenic
983366391 4:166795883-166795905 ATGTTATAACATATGAATCTGGG - Intronic
983807357 4:172011704-172011726 AAATTCTAACAAAGGTACCATGG - Intronic
985090049 4:186353539-186353561 AAATTATTACAAATATTTTTGGG + Intergenic
985095414 4:186408043-186408065 ACATTATAACAAACGTGTTTTGG + Intergenic
986834369 5:11618579-11618601 AAATGATAATAAATGTAATTTGG + Intronic
986839756 5:11682487-11682509 GAATTATACCAAATGTATACTGG + Intronic
986990253 5:13544002-13544024 AGATGATAACAAATGTATTAAGG + Intergenic
987026338 5:13930385-13930407 AAATTTTAACAACTGGATTTGGG - Intronic
987598315 5:20031013-20031035 AAATTAAATAAAATGTATATAGG - Intronic
987629921 5:20457002-20457024 AAAACATTACAAATGTATTTTGG - Intronic
987659305 5:20851781-20851803 AAAATATATCAAATGTGTTTTGG + Intergenic
987767936 5:22259286-22259308 AAATTATAATAAAAATAACTTGG - Intronic
988202062 5:28081642-28081664 AAATTTTAGCAAATGGTTCTTGG - Intergenic
988271231 5:29020518-29020540 CACTTATGACAAATGTGTCTGGG - Intergenic
988690398 5:33566303-33566325 AAATAATAAAAAAATTATCTAGG + Intronic
988764342 5:34353874-34353896 AAAATATATCAAATGTGTTTTGG - Intergenic
989790725 5:45397208-45397230 AAATTTGAACAAATATATATTGG + Intronic
989844422 5:46122935-46122957 AAACTAGAATAAATCTATCTGGG - Intergenic
990169955 5:53036929-53036951 ATTTTATAACAAATGTTTATTGG - Intronic
992050873 5:72939545-72939567 AAAATATAAAAAAATTATCTGGG + Intergenic
992062257 5:73064917-73064939 AAAATATAAGCAAAGTATCTGGG - Intronic
992174466 5:74135958-74135980 AATTTATAAAAAATGAATCGTGG - Intergenic
992274828 5:75104028-75104050 AAATAAAAATAAATGTATCAGGG + Intronic
992877557 5:81072574-81072596 AAATTATAACATAATTAACTAGG - Intronic
993112954 5:83681934-83681956 AAATTATAAAACCTGTAACTAGG - Intronic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993233099 5:85264922-85264944 AAATTGTAACAAGTGTATAATGG + Intergenic
993993056 5:94684396-94684418 AACTCATAAAAATTGTATCTCGG + Intronic
994453820 5:99980131-99980153 AAATTTTAACCAATCTATATAGG - Intergenic
994585017 5:101696232-101696254 AAAATGTATCAAATGTGTCTTGG - Intergenic
994610707 5:102035766-102035788 AAATTATATTAAATGTATCTTGG + Intergenic
994667229 5:102720124-102720146 AAATTCTAACATATGAATGTTGG + Intergenic
994722902 5:103401180-103401202 AAATAATAGGAAATATATCTTGG + Intergenic
994803457 5:104411498-104411520 AAAATTTAAAAAATGTATTTGGG + Intergenic
994886028 5:105563232-105563254 AAATTATAATAAATGGATTTAGG + Intergenic
995668665 5:114574696-114574718 AAATTCTAAAAAATGTTTGTAGG - Intergenic
996107315 5:119519314-119519336 ATAGTATAAGATATGTATCTGGG - Intronic
996189973 5:120527968-120527990 AAACTATAAGAAAGGAATCTGGG - Intronic
996210361 5:120801064-120801086 AAATATTAACTAATGTATGTAGG + Intergenic
996582436 5:125046904-125046926 AGATTCTACCAAATGTATCTAGG - Intergenic
996653071 5:125904966-125904988 AAATTACAAGAAATGTATTTTGG - Intergenic
996710979 5:126543528-126543550 AAACAATTATAAATGTATCTGGG - Exonic
996834506 5:127776199-127776221 AAATGCTAACAATTATATCTAGG + Intergenic
997076121 5:130679689-130679711 AAATTATAATAAACATGTCTAGG - Intergenic
998050928 5:139034438-139034460 GAATTATATAAAATGTACCTTGG - Intronic
998283718 5:140837590-140837612 AAATTATAAAATATATATATTGG - Intronic
998305641 5:141073485-141073507 AAAATAAAACAAATGTAAGTTGG + Intergenic
998449754 5:142225222-142225244 AAGTAAAAACAAATGTAACTGGG - Intergenic
998532760 5:142900806-142900828 AAAATAAAGCAAATGTGTCTTGG + Intronic
998604753 5:143622271-143622293 AAATTAAAAAAAATCAATCTAGG + Intergenic
998754945 5:145367234-145367256 AAATTAGAACAATAGTATTTTGG - Intergenic
998979956 5:147691113-147691135 AAAATAAAACTCATGTATCTGGG - Intronic
1001395487 5:171416784-171416806 CAGTTCTGACAAATGTATCTAGG - Intergenic
1001465587 5:171962341-171962363 AAATTATAACAAATGTATCTTGG - Intronic
1001830559 5:174784972-174784994 AAAATATAACAAAATTAGCTGGG - Intergenic
1002737793 5:181409209-181409231 AAAATATAAAAAAATTATCTAGG + Intergenic
1003955260 6:11157976-11157998 TAATTATAATAAATATATATTGG - Intergenic
1004448136 6:15721504-15721526 AAATTCTATTAAATGTATCAAGG + Intergenic
1005132937 6:22532777-22532799 AAATTATATTAAATGTAAATGGG - Intergenic
1005381464 6:25238802-25238824 ATATTTTGAAAAATGTATCTGGG - Intergenic
1005474212 6:26191524-26191546 AAATTATAAAAAATCTAAATTGG - Intergenic
1006573877 6:35028500-35028522 AAATTATAATACCTGAATCTAGG + Intronic
1006991627 6:38219755-38219777 AAAGTATAACAAATGTTTATTGG - Intronic
1007915698 6:45559712-45559734 AATTTATAACAAATGAAAATAGG - Intronic
1008007341 6:46424865-46424887 AAATTTAAACAAATGCATATTGG + Intronic
1008416189 6:51243559-51243581 AAATTTTAAAAAATGGATGTTGG + Intergenic
1008822866 6:55654814-55654836 ATATTATAAAAAATGAATCCTGG - Intergenic
1009350373 6:62668749-62668771 AAATTATTCAAAATGTATTTAGG + Intergenic
1010656020 6:78512412-78512434 AAAATAAAACAAATATATGTAGG - Intergenic
1010870957 6:81038156-81038178 AAGATATAAGAAATGTATCTTGG + Intergenic
1010881191 6:81174771-81174793 AAAGTATTACAAATGAATCAGGG - Intergenic
1010937204 6:81876365-81876387 AATTTTTAACAAATATTTCTTGG + Intergenic
1011035951 6:82975023-82975045 AAATTTAAACAAAAGTATTTTGG - Intronic
1012702334 6:102475601-102475623 AAACAATAAAAAATGTATCTTGG - Intergenic
1012710738 6:102600834-102600856 AAATTATAAATAATGTATGTAGG - Intergenic
1012797643 6:103783291-103783313 AAATAAAAAAAAATATATCTGGG - Intergenic
1013529796 6:111008696-111008718 AATATATAACCAATGTAGCTTGG + Intronic
1014041894 6:116837359-116837381 AAAAGATAACAAATTTACCTAGG + Intergenic
1014646303 6:123977131-123977153 AAATTAAAAGAAAATTATCTGGG - Intronic
1015619549 6:135116771-135116793 AAAATGTAACAAATGTTTCCTGG + Intergenic
1016304365 6:142668093-142668115 AAAGTTTTACAAATGTTTCTAGG - Intergenic
1016623060 6:146134768-146134790 AAAATACAAAAAATGTAGCTGGG + Intronic
1016776041 6:147905785-147905807 AATTTATAAGAAAATTATCTTGG - Intergenic
1017413012 6:154189414-154189436 AAATTCTTACATATGTATTTTGG - Intronic
1017564927 6:155673632-155673654 AAATTCTGACAAATCTATTTGGG - Intergenic
1017711764 6:157175687-157175709 AAATTATAACAAAAATGTCACGG + Intronic
1018020283 6:159756760-159756782 AAATTAAAATAAATGTAGCTGGG - Intronic
1018449042 6:163888988-163889010 AAATAATAACATATGTATTCAGG + Intergenic
1019242891 6:170684766-170684788 AAAATATAAAAAAATTATCTAGG + Intergenic
1020441136 7:8217972-8217994 AGATTAGATCAAATGAATCTGGG - Intronic
1020883117 7:13787867-13787889 AAATTTTAGCAAATGTATTTTGG - Intergenic
1020965507 7:14862428-14862450 AAATTCTAAAAAATGTACTTAGG - Intronic
1021003467 7:15362827-15362849 AAAATATAGCAAAAGTAGCTTGG - Intronic
1021264665 7:18505257-18505279 AAATTATTATTAATGTATTTTGG + Intronic
1021436481 7:20623234-20623256 CAATTTTAACAAATGTATTATGG - Intronic
1021732733 7:23612153-23612175 AAAAAAAAAAAAATGTATCTTGG + Intronic
1022655468 7:32315549-32315571 AAATTATAACCAATGTTCCTGGG - Intergenic
1022967207 7:35484873-35484895 TAATTATAAAAAATTTATCATGG - Intergenic
1023140514 7:37097421-37097443 AAATAAAAACAAAATTATCTGGG + Intronic
1023707657 7:42958805-42958827 ACATTATAACATATGTAATTGGG - Intergenic
1023759009 7:43446094-43446116 AAATAATGACAAATATATGTAGG - Intronic
1024931022 7:54667012-54667034 AAATTATAAGCAGTGTAGCTAGG - Intergenic
1025702596 7:63833783-63833805 AAATGAAAATAAAAGTATCTGGG - Intergenic
1025817365 7:64927465-64927487 AATTTTCCACAAATGTATCTTGG + Intronic
1025845273 7:65190650-65190672 ATATTATATCATTTGTATCTTGG + Intergenic
1025895548 7:65696680-65696702 ATATTATATCATTTGTATCTTGG + Intergenic
1026767438 7:73169302-73169324 AAAATATACAAAATGTAGCTGGG + Intergenic
1027043905 7:74979004-74979026 AAAATATACAAAATGTAGCTGGG + Intronic
1027079740 7:75223348-75223370 AAAATATACAAAATGTAGCTGGG - Intergenic
1027186791 7:75977009-75977031 AAAATACAAAAAATTTATCTGGG - Intronic
1027380169 7:77599448-77599470 AAACTATAAAAAATTTAGCTGGG - Intronic
1028308166 7:89292893-89292915 AAATTTAACCAAAGGTATCTAGG + Intronic
1028350113 7:89836413-89836435 AAGTTATAAAATCTGTATCTTGG + Intergenic
1028737278 7:94230967-94230989 AAAATAAAACAAATTTATCCTGG + Intergenic
1029154699 7:98507317-98507339 AAATGATAAAGAATGAATCTTGG + Intergenic
1029388955 7:100261937-100261959 AAAATATACAAAATGTAGCTGGG - Intronic
1029605485 7:101597182-101597204 AAAACATAAAAAATGTAGCTGGG - Intergenic
1029874106 7:103730600-103730622 AATTTATAACAAATGTAAAAAGG + Intronic
1030260563 7:107559862-107559884 AAATCATAGCACATGTATATTGG + Intronic
1030357905 7:108563235-108563257 AAATTATAAAAGTTCTATCTTGG + Exonic
1030717908 7:112832170-112832192 AAAATAAAAAAAATGTAGCTGGG - Intronic
1030786951 7:113674240-113674262 AAATTTTAACATATGAATTTTGG - Intergenic
1030898380 7:115090098-115090120 AAATTTTAAAATATGCATCTTGG - Intergenic
1031021538 7:116634060-116634082 AATTTATAAAAAATGAATTTTGG + Intergenic
1031707902 7:125005326-125005348 AAATCATTACACATATATCTTGG + Intergenic
1033003136 7:137529750-137529772 AAGTCATAACACATGTATGTAGG - Intronic
1033090611 7:138382240-138382262 AAAATATAATAAATGAATATTGG - Intergenic
1033359817 7:140630888-140630910 AAATTATAACAAAGGTGTGCAGG + Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1033959075 7:146890663-146890685 TAATCAAAATAAATGTATCTTGG + Intronic
1034015424 7:147579264-147579286 AAATTCTAAAAACTGTACCTGGG - Intronic
1034133651 7:148744234-148744256 TAATTATAACAAATGTTAATGGG - Intronic
1034479166 7:151306838-151306860 AAAATATAAAAAATGTATCCAGG + Intergenic
1034519001 7:151604339-151604361 AAATCATAATGAATGTGTCTAGG + Intronic
1035143427 7:156787613-156787635 AAATTATAAAAAATAAATCAGGG - Intronic
1035421701 7:158734628-158734650 AAAGTAAAACAAATTTATCTGGG + Intronic
1035505229 8:123395-123417 AAAATATAAAAAAATTATCTAGG - Intergenic
1036677326 8:10845720-10845742 AAGTTATTACAAGTGTATTTTGG + Intergenic
1036828864 8:12004387-12004409 AAATTGTAACAAAAGGATTTGGG - Intergenic
1036834095 8:12044338-12044360 AAATTGTAACAAAAGGATTTGGG - Intergenic
1036855939 8:12290903-12290925 AAATTGTAACAAAAGGATTTGGG - Intergenic
1036907846 8:12722021-12722043 AAATAATTACAAAAGTTTCTAGG + Exonic
1037024271 8:14013114-14013136 AAATTAGAACATCTGTAGCTGGG - Intergenic
1037492821 8:19411989-19412011 AAAATATAAAAAATGTAGCCGGG - Intronic
1037714494 8:21385621-21385643 CCATTAGTACAAATGTATCTGGG - Intergenic
1037868810 8:22471824-22471846 AATTTAAAACAAATTTTTCTTGG + Intronic
1038247594 8:25873457-25873479 ACATTAAAACAAATGGATGTGGG - Intronic
1038774279 8:30514069-30514091 AAATGATTACTAATGTATTTTGG - Intronic
1039492388 8:37957766-37957788 AAATTTTTAAAAATGTATCTGGG - Intergenic
1039580343 8:38660999-38661021 AAATTATAAAAATATTATCTGGG - Intergenic
1039784863 8:40825338-40825360 AAATTTTAAAAAAAGGATCTGGG + Intronic
1039986248 8:42450842-42450864 AAATTATTACAAATGTACCCTGG - Intronic
1040463452 8:47672116-47672138 AAATTTTAAAAAATTTAGCTGGG - Intronic
1040921588 8:52626523-52626545 AAATGTTAACAGATGAATCTGGG + Intronic
1041150845 8:54932173-54932195 AGATTATAACATATATATTTAGG - Intergenic
1041171380 8:55145498-55145520 AAATTATGCCAAATATTTCTGGG - Intronic
1041276478 8:56164814-56164836 AAAGTAAAACAAACCTATCTTGG - Exonic
1041546447 8:59048663-59048685 AATTAATTAAAAATGTATCTGGG - Intronic
1041735331 8:61105123-61105145 AAATTAAAACAGATGTGGCTGGG - Intronic
1041932934 8:63307266-63307288 AAATAGTCACAAATGTATTTAGG + Intergenic
1042211444 8:66385092-66385114 AATTTAGAACAAATGTATTATGG + Intergenic
1042234843 8:66601438-66601460 AAATGATAATAAATGTATGTGGG - Intronic
1042594710 8:70434726-70434748 AAATTTTAAAAAAATTATCTGGG - Intergenic
1042789119 8:72583706-72583728 GAATTATTACAAAAGTCTCTGGG - Intronic
1042862085 8:73325107-73325129 AAATTATAACAGATTTCTCTAGG - Exonic
1043313332 8:78889436-78889458 ATATTGTATAAAATGTATCTGGG + Intergenic
1044157166 8:88861994-88862016 AAATTAAGACAAATGTATTCAGG + Intergenic
1044239108 8:89867878-89867900 AAATTATCAAACATATATCTTGG - Intergenic
1044518632 8:93170456-93170478 AAATTTTAAATAATGTATTTTGG + Intergenic
1045366778 8:101484010-101484032 AAAATATACAAAATGTAGCTGGG - Intergenic
1045569991 8:103359010-103359032 TACTTATAAAAAATGTAGCTAGG + Intergenic
1045714435 8:105025248-105025270 TAATAATAACAAAGGTATCATGG - Intronic
1045916664 8:107480255-107480277 AAGTTAGTACAAATGTATTTTGG - Intronic
1046306681 8:112376947-112376969 AAATTATCACAAATGTAATTAGG - Intronic
1046610904 8:116424545-116424567 AAATTATAATACTTGTATTTTGG - Intergenic
1046766768 8:118077914-118077936 AAATTATAACAGAAGCATTTTGG - Intronic
1047068509 8:121315088-121315110 AAATTATAACAAAAGCAGCAAGG - Intergenic
1047071701 8:121352256-121352278 AAATTTTAATAATCGTATCTTGG + Intergenic
1047670397 8:127140052-127140074 ATATTATAATAAATGAATCGAGG - Intergenic
1048081836 8:131136687-131136709 AAATTAAAAGTAATGCATCTTGG + Intergenic
1048296668 8:133219835-133219857 AAAATATAAAAACTGTTTCTTGG - Intronic
1048893539 8:138968454-138968476 ACATTTTAACATATGTCTCTGGG - Intergenic
1049037753 8:140089917-140089939 AAAATATAAAAAAAGTAGCTGGG + Intronic
1051056114 9:12988663-12988685 AAAATAGAACAAATGTGTCCTGG - Intergenic
1051495642 9:17719630-17719652 AAAATAAAAAAAATTTATCTTGG + Intronic
1051811912 9:21058837-21058859 AAATTATAGCAACTGTGCCTGGG - Intergenic
1052682148 9:31707121-31707143 AAATTAAAAAAAAAGTGTCTTGG - Intergenic
1052891959 9:33709720-33709742 AAATTTTAAAATATGTATTTTGG + Intergenic
1053554451 9:39120783-39120805 AAAATATAACAAAGGATTCTTGG + Intronic
1053818546 9:41940923-41940945 AAATTATAACGAAGGATTCTTGG + Intronic
1054108811 9:61084581-61084603 AAATTATAACAAAGGATTCTTGG + Intergenic
1054612046 9:67246544-67246566 AAATTATAACAAAGGATTCTTGG - Intergenic
1055079834 9:72258150-72258172 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1058281447 9:103120848-103120870 AAATTATAAACTAAGTATCTTGG + Intergenic
1058475235 9:105326364-105326386 AAATTAAAACAACTTTAGCTGGG - Intronic
1058569731 9:106328148-106328170 AAATTATATCATATATATATAGG - Intergenic
1058803985 9:108572207-108572229 AAATAAATACAAATGTATATTGG + Intergenic
1059006714 9:110410452-110410474 AAATTATAATATATTTCTCTAGG + Intronic
1059029115 9:110670687-110670709 AAATTATAAGAAATGAAATTGGG - Intronic
1059194597 9:112358993-112359015 AAATTATAAAAATTTTAGCTAGG - Intergenic
1059777928 9:117494622-117494644 CAATTCAAACAAATGTAGCTTGG - Intergenic
1059911963 9:119054636-119054658 AAATAATCACAAACGTATCAAGG + Intergenic
1059990776 9:119863276-119863298 AAGGTATAACAAATGTAGCAAGG + Intergenic
1062082596 9:134632260-134632282 AATTTTTAACAAATGAAGCTTGG + Intergenic
1203603082 Un_KI270748v1:33990-34012 AAAATATAAAAAAATTATCTAGG + Intergenic
1186337963 X:8611845-8611867 AAATGATAACAGATGAACCTTGG + Intronic
1186474213 X:9844652-9844674 AAATTATAAAAAAATTAGCTGGG + Intronic
1186581176 X:10820421-10820443 ACATTATAACAAAAGTTCCTCGG - Intronic
1186624541 X:11278808-11278830 AGATTATAGCAAGTGTATTTAGG - Intronic
1186715482 X:12246844-12246866 AAATTATAAGAATCTTATCTTGG - Intronic
1186954514 X:14667659-14667681 AAATAATAAGCAAGGTATCTGGG - Intronic
1187073537 X:15911931-15911953 AAATTATGACATCAGTATCTAGG + Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187329097 X:18319437-18319459 AAAATACAAAAAAAGTATCTGGG + Intronic
1187873289 X:23782393-23782415 AAATTATGAAGAATGTACCTCGG + Intergenic
1188391646 X:29628251-29628273 AAATTATAACAATGATATCCAGG - Intronic
1188479297 X:30620945-30620967 AAATAAAAAAAAATGTAGCTGGG + Intergenic
1188805451 X:34582941-34582963 AAACTATAACATATGAATTTTGG + Intergenic
1188816594 X:34722546-34722568 AAATGAAAACAAATATATCAAGG + Intergenic
1191130344 X:57001545-57001567 AAATTAGAATAAATGCATCAAGG - Intergenic
1191146989 X:57177504-57177526 AAATTAAAACAAATGTGGGTCGG + Intergenic
1191182237 X:57576191-57576213 AAAATATATCAATTGTATCAAGG + Intergenic
1192001624 X:67157908-67157930 AAATTTTAACCCATGTATATTGG - Intergenic
1192375235 X:70552926-70552948 AAAATAAAACAAATAAATCTGGG + Intronic
1192419691 X:71018464-71018486 AAATTATATCAAATATAGCTAGG + Intergenic
1192948507 X:75991094-75991116 GAATTATTTCAAATGTATTTAGG + Intergenic
1192965571 X:76173379-76173401 AAAATACAAAAAATGTAGCTGGG - Intronic
1193599310 X:83489889-83489911 AAATTTTAGCAAATTTATTTAGG + Intergenic
1193887657 X:87003517-87003539 AAACAATAACAAATGTTTCCAGG - Intergenic
1194009808 X:88547663-88547685 AATTTTAAATAAATGTATCTGGG - Intergenic
1194183645 X:90744191-90744213 AAAGTATAAAAAACGTGTCTTGG + Intergenic
1194505787 X:94731946-94731968 TAATTCTAACAAATGAATTTTGG - Intergenic
1194512394 X:94812174-94812196 AAATTAAAGCAAAAGTATCTGGG - Intergenic
1194620008 X:96159491-96159513 AAATTTTCACAAATTTTTCTAGG - Intergenic
1194724614 X:97380140-97380162 ATATAATGAAAAATGTATCTAGG - Intronic
1194846161 X:98811991-98812013 AGATTATAACAAATGACACTGGG - Intergenic
1194989614 X:100532679-100532701 AAATTATACCAAATTTTTTTTGG - Intergenic
1195215248 X:102693276-102693298 AAATAGTAACAAATGAATCCAGG + Intergenic
1196258790 X:113553858-113553880 CAATTATAAAAAATGAAACTGGG - Intergenic
1196368012 X:114944745-114944767 TAATAATAATAAATGTCTCTAGG + Intergenic
1196730916 X:118940810-118940832 AAAATACAAAAAATGTAGCTGGG - Intergenic
1197023710 X:121721140-121721162 AAATTATACCAAATATAAATGGG - Intergenic
1199283473 X:146029953-146029975 AAATTTGAACAAAAGTCTCTTGG + Intergenic
1199286318 X:146058459-146058481 AAAATACAACAAATCTATTTTGG - Intergenic
1199410832 X:147520377-147520399 AAATTATACCAACACTATCTTGG + Intergenic
1199439356 X:147850800-147850822 AGATAATAACAAGTGTATGTTGG + Intergenic
1200436647 Y:3159690-3159712 ATATTATAATAATTGTATTTAGG + Intergenic
1200975205 Y:9204811-9204833 AAATTTTAAAAAATCTAACTTGG - Intergenic
1201738407 Y:17296929-17296951 AAATTATAAATAATTTATATTGG + Intergenic
1201774969 Y:17652332-17652354 AAAATATAAACAAAGTATCTGGG - Intergenic
1201826587 Y:18253657-18253679 AAAATATAAACAAAGTATCTGGG + Intergenic
1202375924 Y:24236653-24236675 AAATTAGAACAAAAGGATATTGG - Intergenic
1202494856 Y:25433465-25433487 AAATTAGAACAAAAGGATATTGG + Intergenic
1202580332 Y:26373996-26374018 AAAGAAAAACAAATGTATCATGG + Intergenic