ID: 1001466896

View in Genome Browser
Species Human (GRCh38)
Location 5:171975382-171975404
Sequence GCTGCTGGCCAGCCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 7, 3: 34, 4: 440}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001466890_1001466896 15 Left 1001466890 5:171975344-171975366 CCCCTTTTCTTCTCAATCTACCC 0: 1
1: 1
2: 11
3: 141
4: 1920
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440
1001466889_1001466896 16 Left 1001466889 5:171975343-171975365 CCCCCTTTTCTTCTCAATCTACC 0: 1
1: 0
2: 6
3: 55
4: 593
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440
1001466893_1001466896 -5 Left 1001466893 5:171975364-171975386 CCCAAATGCAGAGAATCTGCTGC 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440
1001466892_1001466896 13 Left 1001466892 5:171975346-171975368 CCTTTTCTTCTCAATCTACCCAA 0: 1
1: 0
2: 5
3: 42
4: 658
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440
1001466891_1001466896 14 Left 1001466891 5:171975345-171975367 CCCTTTTCTTCTCAATCTACCCA 0: 1
1: 0
2: 3
3: 91
4: 1029
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440
1001466894_1001466896 -6 Left 1001466894 5:171975365-171975387 CCAAATGCAGAGAATCTGCTGCT 0: 1
1: 0
2: 1
3: 18
4: 167
Right 1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG 0: 1
1: 1
2: 7
3: 34
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001466896 Original CRISPR GCTGCTGGCCAGCCACAGCC TGG Intronic
900095583 1:938843-938865 GCCCCTGTCCCGCCACAGCCAGG + Intronic
900157601 1:1209463-1209485 GCTGAGGGCCTGGCACAGCCTGG - Intergenic
900308588 1:2022783-2022805 GCTGCTGTCCATCCAGACCCAGG - Intronic
900527153 1:3134971-3134993 GCTGCCGGCCACCCGCAGGCTGG + Intronic
900537503 1:3186168-3186190 CCTGCTGGCCAGCCACAGCGCGG + Exonic
900659832 1:3776862-3776884 GCTGAGGTCCAGCCACATCCGGG - Intergenic
900920691 1:5668275-5668297 GCTGCTGACTAGCTCCAGCCTGG + Intergenic
900927394 1:5714165-5714187 GGTGCTGGCCAGCCAGGGGCAGG + Intergenic
901057490 1:6455423-6455445 GCTGCCGGCGAGCAACAGCGAGG + Intronic
901239040 1:7682298-7682320 GCAGCTGGCCAGAGACAGACGGG + Intronic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
902448942 1:16484689-16484711 GGTGCTGAGCAGCTACAGCCTGG + Intergenic
902468323 1:16631396-16631418 GGTGCTGAGCAGCTACAGCCTGG + Intergenic
902505815 1:16938595-16938617 GGTGCTGAGCAGCTACAGCCTGG - Intronic
902941011 1:19800054-19800076 GCAGCTGGCGAGTCAGAGCCTGG - Intergenic
903154803 1:21436262-21436284 GGTGCTGAGCAGCTACAGCCTGG - Intergenic
903743347 1:25571144-25571166 GCTGCTGGCGAGGCAGAGCAGGG - Intergenic
904274210 1:29369712-29369734 GCTGCTGTCCAGCCCCCTCCTGG + Intergenic
904364501 1:30001802-30001824 GCTGCTGCCCAGCCCCCTCCTGG + Intergenic
904415915 1:30361128-30361150 GCTGCTGGCCAGGAACAGTAGGG + Intergenic
904423754 1:30410377-30410399 GCTGCTGTCCAGCCCCCTCCTGG - Intergenic
905584430 1:39105647-39105669 GCAGCCGGCCAACCGCAGCCAGG + Intronic
906306773 1:44724644-44724666 GCGGCTGGCCAGCCTCACGCTGG + Exonic
906520675 1:46465215-46465237 ACTCCTGCCCAGCCATAGCCAGG - Intergenic
907865042 1:58391210-58391232 GCTGCCGGCCAGCAGCAGCCAGG + Intronic
908129252 1:61058170-61058192 GCTGCTGTTCAGCCACTGCATGG - Intronic
909592806 1:77370779-77370801 GCTGCTGGCCTGGCACTGCTTGG - Intronic
909804644 1:79858998-79859020 GCTGTTGGACAGCCAAATCCTGG - Intergenic
912140722 1:106722686-106722708 ACTGCCTGCCAGCCATAGCCTGG + Intergenic
912172042 1:107112558-107112580 GCTGCTGGCCTCCTATAGCCAGG - Intergenic
912456780 1:109803398-109803420 CCTGTGGGGCAGCCACAGCCTGG + Intergenic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
915313065 1:155014056-155014078 GCTGGAGGCCAGGCACAGACAGG - Intronic
916785299 1:168082739-168082761 GCTGCAGGCCTGCCACTGCATGG + Exonic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
919895734 1:202008651-202008673 GTTCCTGGCCACCCTCAGCCAGG - Exonic
920179342 1:204122906-204122928 GCTGCTGCACAGCCACAGTGGGG + Exonic
920373512 1:205494004-205494026 GCTGCTGTCCAGGGACAGCCAGG - Intergenic
920679130 1:208059410-208059432 GATGCCTGCCAGCCACAGCAGGG - Intronic
920696273 1:208183442-208183464 TCTGCTGACCATCCACAGCCAGG + Intronic
921945649 1:220884302-220884324 CCTGCTCGCCATCCGCAGCCGGG - Exonic
922472284 1:225883761-225883783 ACTCCTGGACAGCCACAGACTGG - Intergenic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
924385784 1:243496969-243496991 GCTGCAGGACAGCCACAGGAGGG + Intronic
924918010 1:248593744-248593766 GCGGCTGGCCAACCAGACCCTGG - Exonic
1062837615 10:646297-646319 GCTGCTGTCCAGCCTCCCCCAGG + Intronic
1062965718 10:1606332-1606354 GGAGCTTGCCAGGCACAGCCAGG - Intronic
1064143150 10:12806952-12806974 GCTGCTGGCCAAACACATCATGG + Intronic
1064357270 10:14631195-14631217 GATGCTGCCCAGGCCCAGCCAGG - Intronic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1067056636 10:43056467-43056489 GCTGCTTCCCAGAAACAGCCTGG + Intergenic
1067297594 10:44983696-44983718 GCTGCTGGCCTGGCTAAGCCTGG + Intronic
1067479879 10:46587753-46587775 GCTGCCAGCCAGCCCGAGCCAGG + Intronic
1067614858 10:47754044-47754066 GCTGCCAGCCAGCCCGAGCCAGG - Intergenic
1070373190 10:75804914-75804936 GATGCTGGCCAGCCTTAGGCAGG + Intronic
1070395856 10:76010773-76010795 GTTGAGGGCCAGCCACAGGCAGG - Intronic
1070643558 10:78185971-78185993 GCTCCTGGCCAGCTCCAGCTGGG + Intergenic
1072449895 10:95531600-95531622 GCTGCTGATAAGCCACAGCGTGG + Intronic
1072606011 10:96983266-96983288 ACAGCTGGACAGCCACTGCCTGG + Exonic
1072794601 10:98344755-98344777 GATGCTGGCCAGCCTCTTCCTGG + Intergenic
1075563562 10:123486595-123486617 GCTGCAGCCCAGGCAGAGCCAGG - Intergenic
1075967168 10:126623064-126623086 GCTGCTGGCCAGGCAGGGTCGGG - Intronic
1076326802 10:129630105-129630127 GCGGCTGGCCAGCCACAGACTGG - Intronic
1076469935 10:130711235-130711257 GGGGCTGGACAGCCACAGGCTGG + Intergenic
1076471430 10:130721339-130721361 GGTGGTGCCCAGCCACAGCCAGG + Intergenic
1076611212 10:131727001-131727023 GCTGGAGCCCAGCCACAGACGGG - Intergenic
1076656797 10:132029666-132029688 CCACCTGGCCAGCCAAAGCCAGG - Intergenic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1076804095 10:132846607-132846629 CCTGCTGGCCTGCGACTGCCGGG + Intronic
1076861365 10:133139743-133139765 GCAGCTGGGAAGCCACAGCGGGG + Intergenic
1076862415 10:133144983-133145005 CCTGCAGGCCAGCAGCAGCCAGG + Intergenic
1077049003 11:558377-558399 GAGGCTGGCCAGCCCCAGCGGGG - Intronic
1077415828 11:2423869-2423891 TCAGCTGCCCAGCCCCAGCCTGG + Intergenic
1077919509 11:6632157-6632179 GCTGGTTCTCAGCCACAGCCAGG + Exonic
1078195320 11:9132351-9132373 CCTGCTTGACAGCCACAGTCAGG + Intronic
1078284798 11:9941276-9941298 CCTGCGTGCCAGCCCCAGCCTGG + Intronic
1078442623 11:11379779-11379801 GCTCCTGGCCATCCACTTCCTGG - Intronic
1079031137 11:16987275-16987297 CCTGGTGGCCAGCCAAGGCCTGG + Intronic
1079365705 11:19807534-19807556 GCTGCAGGCCAATCCCAGCCTGG + Intronic
1081491866 11:43575583-43575605 GCAGCTGCCCAGCCCAAGCCTGG + Intronic
1081663953 11:44905649-44905671 GCTGCTTGCCAGGCACAGCCGGG - Intronic
1081775469 11:45673461-45673483 CCAGCTGGACAGCCACAACCAGG - Intergenic
1081964095 11:47159098-47159120 ACTGCATGCCACCCACAGCCTGG + Intronic
1082067207 11:47910634-47910656 GCTGCTGGCCAGCCTCTGGTTGG + Intergenic
1082761510 11:57131282-57131304 GCTCATGGTCAGCCTCAGCCTGG + Intergenic
1083334818 11:61916523-61916545 GCTACTGCCCAGCTACAGCTGGG - Intronic
1083407077 11:62464949-62464971 GCTCCTGGACAGACACAGTCGGG + Intronic
1083418399 11:62539828-62539850 CCTGCTGTCCTGGCACAGCCTGG + Intronic
1083664500 11:64267214-64267236 GCTGCTGCCCAGCCACAAGACGG - Exonic
1083871768 11:65492713-65492735 ACAGCTGGGCTGCCACAGCCAGG + Intergenic
1084089735 11:66871651-66871673 CCTGCTGTCCAGGCCCAGCCAGG + Intronic
1084224218 11:67705442-67705464 ACTGCTGCCCAGCGACAGCTTGG - Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084943778 11:72628049-72628071 GCTGCTGCCCAGCCAGTGCCAGG + Intronic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085513804 11:77100901-77100923 CCTGCTGCCATGCCACAGCCCGG + Intronic
1087012847 11:93529786-93529808 GCTGAGGGCCAGCCTCCGCCTGG + Intronic
1087095037 11:94309848-94309870 GCTGGTGGCAAGTCACAGTCAGG + Intergenic
1087803601 11:102531622-102531644 GCTGCTGCCCAGCTACAGGTAGG + Intergenic
1088625273 11:111725804-111725826 GTTGCTGGCCAGAGACTGCCTGG + Exonic
1088903063 11:114133314-114133336 GGTGCTGGTCAGCCCCAGCAGGG + Intronic
1089037563 11:115410791-115410813 GCTGTATGCCAGCCACACCCTGG - Intronic
1089706702 11:120283389-120283411 GCTGCTGGGTTGCCACATCCTGG - Intronic
1089908570 11:122071917-122071939 TGTGCTGGCCACCCACAGCAAGG + Intergenic
1090719505 11:129458906-129458928 TCTGCAGGTCAGCCACGGCCAGG + Intergenic
1091999299 12:5019434-5019456 TCTGCAGGCCAAACACAGCCTGG - Intergenic
1092488393 12:8922621-8922643 TCTCCTTGCCAGCCACAGCTGGG + Exonic
1094466123 12:30755051-30755073 GCTGGCGGCCAGCTGCAGCCGGG - Intergenic
1094473846 12:30826369-30826391 GCTGCTGGGGAGCCTCTGCCAGG - Intergenic
1096252936 12:50044929-50044951 GCTGCACTCCAGCCCCAGCCTGG - Intergenic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1096844868 12:54400917-54400939 GCTGCTGACCTTCCAGAGCCTGG + Exonic
1096870009 12:54587299-54587321 GGGGGTGGCCAGCCAGAGCCTGG + Intronic
1097087149 12:56477133-56477155 GCAGCTGGGCAGCAACACCCTGG - Exonic
1102583216 12:113905146-113905168 GCTAATGGCCAACCCCAGCCAGG + Intronic
1103332259 12:120162465-120162487 GCTGATGGCAAGACAAAGCCTGG + Intronic
1103715129 12:122940713-122940735 CCAGCTGCCCTGCCACAGCCTGG + Intronic
1103856247 12:123972896-123972918 GCCCCTGCCCCGCCACAGCCGGG - Intronic
1104053042 12:125209196-125209218 GCCTCTGGCCAGCCTGAGCCTGG + Intronic
1104868346 12:131975177-131975199 GCTGAGTGTCAGCCACAGCCGGG + Intronic
1104913502 12:132251830-132251852 GCCTCTGGGCACCCACAGCCTGG + Intronic
1105038036 12:132940677-132940699 GCCGCCGGCCAGCCTCAGACTGG + Intronic
1106125576 13:26897869-26897891 ACTGCGGGCCAGCCAGAGCTGGG + Intergenic
1106747905 13:32722842-32722864 ACTGCTCCCCAGCAACAGCCAGG - Intronic
1107135343 13:36938284-36938306 CCTGCTTCCCAGCCCCAGCCAGG - Intergenic
1108277058 13:48821489-48821511 CCTGCCTGCCAGCAACAGCCAGG - Intergenic
1109442821 13:62397630-62397652 GGCCCAGGCCAGCCACAGCCTGG - Intergenic
1110009976 13:70320354-70320376 GCCGCTGAGCAGCCACAGGCTGG - Intergenic
1112064302 13:95776050-95776072 GCAGCAGGCCAGGCACAGCCAGG - Intronic
1112284814 13:98094840-98094862 GCTGCTGAGCAGCCACCACCAGG - Intergenic
1113869020 13:113546695-113546717 TCAGCTCTCCAGCCACAGCCTGG - Intronic
1114263336 14:21055572-21055594 GCAGCTGGCCAGCCTCACTCAGG - Intronic
1114497953 14:23146906-23146928 GCTGCTGGCTAGCTACTGCTTGG + Intronic
1115534035 14:34355832-34355854 GCTGTTTCTCAGCCACAGCCTGG + Intronic
1116937590 14:50758122-50758144 GCAGCTGGCCAGCCAGCGGCTGG - Exonic
1118835279 14:69473528-69473550 AGTGCTGACCAGCCACAGCAAGG + Intergenic
1120673631 14:87393246-87393268 CCTGCCGAGCAGCCACAGCCTGG + Intergenic
1120817469 14:88878205-88878227 ACTTCTGGTCAGCCACAGCACGG + Intronic
1121406160 14:93720527-93720549 GCGCCTGGCCAGCATCAGCCTGG + Exonic
1121567335 14:94919984-94920006 GCTGCCTGCCAGCCACATCTTGG - Intergenic
1121873442 14:97430143-97430165 TCTGATGGCCAGACACAACCAGG + Intergenic
1122113236 14:99515743-99515765 TCTCCTGGGCAGCCCCAGCCTGG + Intronic
1122135311 14:99629241-99629263 GCTGCTGGACAGCCACAGGCTGG + Intergenic
1122327204 14:100889917-100889939 CCAGCTGGCCTGCCATAGCCTGG + Intergenic
1122440951 14:101731501-101731523 GGGGCTGGCCAGCCTCAGCCAGG + Intronic
1122799376 14:104222024-104222046 GCACCAGGCCAGCCACTGCCCGG - Intergenic
1123824033 15:24063182-24063204 CATGCTGGCCAGTCACAGACCGG - Intergenic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124645957 15:31437680-31437702 GCTGCTGGCCAGGGCGAGCCAGG + Intergenic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1124909971 15:33910088-33910110 GCTGCACTCCAGCCCCAGCCTGG + Intronic
1125446782 15:39766958-39766980 GCTTCTGAACAGCCAGAGCCAGG + Intronic
1125725661 15:41866970-41866992 GCTGATGGCCAGCTTCACCCAGG - Exonic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1128508996 15:68302159-68302181 CCTGCTGCCCAGCTGCAGCCAGG + Exonic
1130153774 15:81332520-81332542 CCTGCAGGTCACCCACAGCCAGG - Exonic
1130284769 15:82545845-82545867 GCTGCTGACCACACCCAGCCAGG + Intronic
1130423811 15:83775181-83775203 ACTGCTGGCCAGCCACATGGGGG + Intronic
1130650449 15:85759541-85759563 GCAGCTGGCCTGACACAGGCGGG + Exonic
1130851991 15:87803832-87803854 GCTAATGGCCAGCCAGACCCTGG + Intergenic
1130907048 15:88248048-88248070 GCTCATGGCCAGCGAGAGCCTGG - Intronic
1131058430 15:89390127-89390149 CCTACTGGCCAGCCACAAACAGG - Intergenic
1131263498 15:90902572-90902594 GCAGCTGGCCAGGCCCGGCCCGG + Intronic
1132569703 16:638702-638724 GGAGATGGCAAGCCACAGCCAGG - Intronic
1132721020 16:1315602-1315624 GCTGCTTGCCTGCCGCAGGCCGG - Intronic
1132896926 16:2233593-2233615 GCTGCGGGGCTGCCACTGCCAGG - Exonic
1133031795 16:3014533-3014555 GGGGCTGGGCAGGCACAGCCAGG + Intergenic
1133294787 16:4746399-4746421 GCTGCGGGCCTGGCCCAGCCTGG - Exonic
1134468617 16:14501557-14501579 GCTGTTGGCCAACCACATCAGGG - Intronic
1134746853 16:16595166-16595188 GCAGATGGGCACCCACAGCCAGG - Intergenic
1134998621 16:18758497-18758519 GCAGATGGGCACCCACAGCCAGG + Intergenic
1136385439 16:29923069-29923091 GGTTATGGCCAGCCAAAGCCAGG + Intronic
1136394504 16:29985819-29985841 GTTGCTGGCTCGGCACAGCCTGG + Exonic
1138290447 16:55842300-55842322 GGGGATGGCCAGCCACAGCATGG - Intergenic
1139472301 16:67184705-67184727 GCCGCAGGCCAGCCACCTCCAGG + Exonic
1139521503 16:67485231-67485253 GGTGCTGACCAGGCCCAGCCTGG - Intergenic
1139693299 16:68655200-68655222 GCTGCTGCCCACCCACACACTGG - Intronic
1140377512 16:74456529-74456551 GAGGCTGGACAGCCACAGCGAGG + Intronic
1140824205 16:78690696-78690718 GGTGCTTTCCAGTCACAGCCTGG + Intronic
1141178921 16:81739195-81739217 GCTGGTGGTCGACCACAGCCTGG + Intronic
1141195092 16:81854354-81854376 ACTGCAGCCCAGGCACAGCCTGG - Intronic
1141571830 16:84938822-84938844 GCTGTGAGCCACCCACAGCCTGG + Intergenic
1141701949 16:85646704-85646726 GCTGCAGGCCAGCCGGAGTCGGG + Intronic
1141739927 16:85884348-85884370 GCAGCAGGCTAGCCTCAGCCTGG - Intergenic
1141908895 16:87045144-87045166 GCTCCTGGAGACCCACAGCCAGG + Intergenic
1142235524 16:88920791-88920813 CCTGCTTGCCAGCCCCAGCTGGG + Intronic
1142251310 16:88993278-88993300 GCTCCTGCCCAGCTGCAGCCCGG - Intergenic
1144704989 17:17362361-17362383 CCAGCTGGGCTGCCACAGCCAGG - Intergenic
1144890014 17:18489172-18489194 TCTGCTGGGCACCCAGAGCCGGG + Intronic
1145142202 17:20455145-20455167 TCTGCTGGGCACCCAGAGCCGGG - Intronic
1145944003 17:28759490-28759512 CCTGCTGGCGGGCCAGAGCCTGG + Exonic
1145963740 17:28902618-28902640 GGTGCTGGCCTGCCGCAGCCAGG - Exonic
1146256226 17:31392597-31392619 GCAGCAGGCCAGGCAAAGCCAGG + Intronic
1146272717 17:31494967-31494989 TTGGCAGGCCAGCCACAGCCTGG - Intronic
1146520487 17:33521986-33522008 TCTGCTGGGCAGCCGCTGCCTGG + Intronic
1147288191 17:39419900-39419922 GCTGCTGACCAGGAAGAGCCTGG + Exonic
1147553878 17:41464077-41464099 GCTGCAGGCCCAGCACAGCCTGG - Exonic
1147981856 17:44279825-44279847 GCTGCTGCCCCGCCAGAGCCTGG - Intergenic
1148178420 17:45586374-45586396 GCTGCTGCCCAGCCCCGGACCGG + Intergenic
1150493587 17:65590999-65591021 GCTGCAGGGCAGCCACACCACGG + Intronic
1150918037 17:69456242-69456264 GCTCCAGACCAGCCACAGCCAGG - Intronic
1151367902 17:73629046-73629068 GCTGCTGGCCAGTCTCTGGCAGG - Intronic
1151433115 17:74078319-74078341 GCTACTGCCAAGCCACTGCCTGG + Intergenic
1151482708 17:74379780-74379802 GTGGCTGGCCAGCCCCAGCGTGG - Intergenic
1152137835 17:78515574-78515596 GGTCCTGGCCAGCAACAGCAGGG - Intronic
1152277227 17:79364908-79364930 GCTCCTGCCCAGCCACTCCCTGG - Intronic
1152331771 17:79677698-79677720 GCAGGAGGCCAGCCTCAGCCTGG + Intergenic
1152388915 17:79991674-79991696 GCTGCCCTCCAGCCACAGGCAGG + Intronic
1152539715 17:80968816-80968838 GCTGCTCCCAAGCCCCAGCCGGG + Intergenic
1152553286 17:81040429-81040451 GCAGCTGTACAGGCACAGCCAGG - Intronic
1152556900 17:81057930-81057952 GGAGCTGGCCAGCGAGAGCCAGG + Exonic
1152686552 17:81696535-81696557 GTGGCTGCCCAGCCACAGGCCGG + Intronic
1153978241 18:10287978-10288000 CCTGCTGGGCAGTCAGAGCCAGG - Intergenic
1154131180 18:11738271-11738293 GCTCCTGCCCAAGCACAGCCTGG + Intronic
1154492820 18:14934291-14934313 GGTGCTGGCCAGCGAGAGGCAGG + Intergenic
1155284189 18:24271804-24271826 GCTGCTGCCCGGCCGGAGCCAGG - Intronic
1157862591 18:51154215-51154237 GCTGCTAGACAGCCCCAGGCAGG - Intergenic
1160779392 19:871137-871159 GCTGCCAGCCAGCGACGGCCTGG - Exonic
1160803465 19:980738-980760 GCTGCGGCCCAGCCCGAGCCAGG - Intergenic
1160826266 19:1081974-1081996 GGTGGTGGCCAGGCAGAGCCTGG + Intronic
1161017543 19:1990780-1990802 GCAGCTGGCCAGCCTGTGCCTGG - Exonic
1161057344 19:2197335-2197357 GTGGCTCGCCTGCCACAGCCAGG - Intronic
1161270473 19:3386896-3386918 CCTGGAGGCCAGCCACAGCCTGG - Intronic
1161423827 19:4191144-4191166 GCAGCTTCCCAGCAACAGCCAGG - Intronic
1161711947 19:5853754-5853776 GCTCCTTGCCAGGCAGAGCCAGG + Intergenic
1161770567 19:6228683-6228705 GCTGCTAGACGGCCACTGCCTGG + Intronic
1162299265 19:9835112-9835134 GCCCCCGGCCAGCCTCAGCCTGG - Intergenic
1162384470 19:10353017-10353039 GCTGCTGGACAACGACAGGCTGG - Exonic
1163368681 19:16889958-16889980 GCTGCTGGCCGCCGTCAGCCTGG + Exonic
1163509658 19:17727196-17727218 GCTGGTGGCCACGCCCAGCCTGG + Exonic
1163625348 19:18386387-18386409 GCTGCGGGCCAACCAGAGCTGGG + Exonic
1163638626 19:18449512-18449534 CCTGCTCTCCAGCCACAGCAGGG + Intronic
1164464166 19:28473428-28473450 GCTGCAGGCGGGCCACAGCGAGG + Intergenic
1165118550 19:33544542-33544564 CCTGCAGTCCAGCCCCAGCCTGG + Intergenic
1165471398 19:36006749-36006771 CCAGCTGGTCAGCTACAGCCTGG - Exonic
1165778980 19:38421135-38421157 GGTGCTGGCCATGCACAGCTGGG - Exonic
1165945789 19:39441435-39441457 CTGGCTGGCCACCCACAGCCGGG - Intronic
1166001115 19:39877955-39877977 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166003900 19:39894214-39894236 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166269762 19:41706873-41706895 GCTGCTGACCTCCCTCAGCCGGG + Intronic
1166658122 19:44627149-44627171 GGTGCTGGGAAGCCACAGCAGGG + Intronic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1167849542 19:52190895-52190917 ACTGCTCCCCAGCCCCAGCCTGG - Intronic
1168179368 19:54650426-54650448 GTTGCTGACAAACCACAGCCTGG - Intronic
1168701169 19:58440421-58440443 GACGCTGGCCAATCACAGCCTGG + Intergenic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
925298165 2:2791936-2791958 GTGGCTGGCCAGCCTCAGCGAGG - Intergenic
925334075 2:3080338-3080360 GCTGTTGGTCAGCCCCAACCTGG + Intergenic
926314930 2:11702474-11702496 TCTGCAGGCCAGCCACACCCTGG + Intronic
926671650 2:15582320-15582342 ACTGTTGGCCAGCTGCAGCCTGG - Intergenic
927520084 2:23693276-23693298 GCTGACGGCCAGCAACTGCCTGG + Exonic
928168279 2:28986678-28986700 GTTGCTGTCCAGCCTCAGCCAGG + Intronic
928241572 2:29591383-29591405 GCATCCGGGCAGCCACAGCCAGG + Intronic
928624176 2:33122465-33122487 GCAGCTGGCCAGCCTCAGATTGG - Intronic
929578770 2:43068947-43068969 CCCCCTGGCCACCCACAGCCTGG + Intergenic
929684623 2:44023097-44023119 GCTCCTGGCCAGGCCAAGCCAGG - Intergenic
931711044 2:64989275-64989297 GGCGCTGGCCAATCACAGCCCGG - Intronic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934713337 2:96529435-96529457 GCTGCTGGCCAGTCACACAATGG + Intergenic
934983606 2:98868572-98868594 GCTCCTGCACAGCCAAAGCCAGG - Intronic
935591847 2:104852341-104852363 TCTCCTGCCCAGCCGCAGCCAGG - Intergenic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
937203603 2:120222358-120222380 GCTGCTCGGCAACCACATCCAGG + Exonic
937208654 2:120253075-120253097 GCCGCCGCCCGGCCACAGCCCGG - Intronic
938746232 2:134280997-134281019 GCTACTTGGCAGTCACAGCCTGG + Intronic
942957539 2:181791023-181791045 ATGTCTGGCCAGCCACAGCCAGG + Intergenic
944763482 2:202840955-202840977 GGAGATGGCCAACCACAGCCAGG - Intronic
945803493 2:214462349-214462371 GCTTCTAGCCAGTCCCAGCCTGG + Intronic
945891458 2:215435751-215435773 GCTGCTGGCCGTCCAGTGCCTGG - Exonic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
946328999 2:218999409-218999431 CCTGGTGTCCAGCCACGGCCTGG + Intergenic
947445522 2:230159936-230159958 GCTGCCGGCCATCCCCAGGCGGG + Intergenic
948279711 2:236737795-236737817 GCTGCTGGGCACCCCCAGGCTGG + Intergenic
948659119 2:239496192-239496214 GCTGGTGTCCACCCACAGACAGG + Intergenic
948920167 2:241062585-241062607 GCTGCTTCACAGACACAGCCAGG + Intronic
1169251549 20:4064768-4064790 GCTTCGGGCCAGCCAGGGCCTGG + Intergenic
1170140500 20:13121326-13121348 CCTGCATGCCAGCCAAAGCCAGG + Intronic
1170570017 20:17627355-17627377 GCTGCTGGTCAGCCTCCGCCTGG + Exonic
1171336803 20:24392680-24392702 CCTGCTGGCCAAGCACGGCCTGG + Intergenic
1172045898 20:32079920-32079942 GGTGGTGGCCAGCCCCAGCTGGG - Intronic
1172834001 20:37861120-37861142 GCTGCTAGCCTGTCACAGCTAGG + Intronic
1173522254 20:43709053-43709075 GCAGCTGGCCAGCCACTCCATGG - Intronic
1173572648 20:44087476-44087498 GCTGCCAGCCAGACACGGCCAGG - Intergenic
1174190744 20:48738698-48738720 GCTGCTGGCTGGAAACAGCCAGG + Intronic
1175072009 20:56342907-56342929 TCTGCTGGCCAGGGCCAGCCTGG + Intergenic
1175241347 20:57551744-57551766 TCTGCTGCCCAGGCCCAGCCAGG - Intergenic
1175819313 20:61900092-61900114 GCTACTGGCCAGCCTCAGCGGGG + Intronic
1175956092 20:62610147-62610169 GTTGCTGGCCAGCCACAGCCCGG - Intergenic
1176033169 20:63023616-63023638 GCCACTGACCAGCCTCAGCCGGG - Intergenic
1176145723 20:63564582-63564604 GCTGCCGGCCAGCCTCTGCCAGG - Exonic
1176164603 20:63666020-63666042 GGAGCTGGCCAGCCCCATCCTGG + Exonic
1178100944 21:29267886-29267908 TCTGCTTGCCAGTCACAGCTGGG + Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1178721506 21:35014734-35014756 TCTGCTTTCCAGCCACAGACGGG + Intronic
1178828962 21:36039057-36039079 ACAGCTGGCAAGACACAGCCCGG + Intronic
1178931168 21:36820353-36820375 GCTGCTGCCCAGCCACGGCCGGG + Intronic
1179435430 21:41359272-41359294 GCTTCTGGCCAGGCATCGCCCGG + Intergenic
1179534798 21:42044509-42044531 TCAGCTGGGCAGCCACAGCATGG + Intergenic
1179896149 21:44364789-44364811 CCTGCAGGCCAGGCTCAGCCTGG - Intronic
1180056955 21:45363917-45363939 GCCCCGGCCCAGCCACAGCCTGG + Intergenic
1180064868 21:45407112-45407134 GCTCCAGGCCACCCGCAGCCCGG + Intronic
1180181151 21:46119222-46119244 CCTGCTGGCAAGGCACAGCCAGG + Intronic
1180967587 22:19798633-19798655 GCTGGTGGGTAGGCACAGCCAGG - Intronic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1181864713 22:25846151-25846173 CCTCCAGGCCTGCCACAGCCCGG - Exonic
1182017318 22:27051675-27051697 TCTGCTGGCCATATACAGCCAGG - Intergenic
1182331164 22:29552573-29552595 GGTGGGGGCCAGCCCCAGCCCGG + Intronic
1183063327 22:35348363-35348385 GCTGGGTGCCAGGCACAGCCTGG + Intergenic
1183191089 22:36322479-36322501 GCTGCAGGCCAACCCCATCCTGG - Exonic
1183483277 22:38076263-38076285 TCTCCTGGCCAGCCTCGGCCTGG + Intergenic
1183544048 22:38446312-38446334 TCTGCTGCCCAGCCACTGCCGGG + Intronic
1183592565 22:38788691-38788713 GCTGCTCGCCACACACAGCAGGG + Intronic
1183617220 22:38953269-38953291 GCTCCGGGCCAGTGACAGCCGGG - Intronic
1183850901 22:40586979-40587001 GTTGCTGGCCTGGCAAAGCCTGG + Intronic
1184140028 22:42573182-42573204 GCAGCCGGCCAGCCACAGGTGGG - Intronic
1184233029 22:43168705-43168727 TCCGCCAGCCAGCCACAGCCTGG - Intronic
1184562705 22:45272669-45272691 GCCGCTGGTCAGGCACTGCCTGG + Intergenic
1184602896 22:45553938-45553960 CCTGCTGACCAGCCCCATCCAGG + Intronic
1184856912 22:47151276-47151298 GCCGCTGGCCTGCCTCACCCGGG - Intronic
1185274424 22:49944203-49944225 GCTTGTGGCCAGCCATGGCCTGG - Intergenic
1185297377 22:50061057-50061079 GCCGCTGGGCAGCCTGAGCCTGG + Exonic
949357114 3:3192761-3192783 GGTGCTGGTCAGCTACAGCCAGG - Intergenic
950566829 3:13774370-13774392 ACTGGTGGTCAGCCCCAGCCAGG - Intergenic
951075527 3:18386647-18386669 ACTGCTGGCCAGGCAAAGCAAGG - Intronic
952180331 3:30910204-30910226 GCTGCTGGCCTGCGGCAGCCTGG + Intergenic
952306408 3:32150694-32150716 TCTGTTGGCCAGCTACAGCCTGG - Intronic
953054239 3:39375027-39375049 GGTGCTTGCCAGCCAGAGCTTGG - Intergenic
953388244 3:42519250-42519272 CCTGCTGGCCAGCCACCCCTCGG + Exonic
954383935 3:50234696-50234718 GGTGCTTGCCACCAACAGCCCGG - Intronic
955003734 3:54950627-54950649 GAGGCTGCCCTGCCACAGCCTGG - Intronic
955038707 3:55293684-55293706 GCTGCTGGACAGCCAAACTCCGG + Intergenic
958158599 3:89787709-89787731 GCTGCTGCTCAGCTCCAGCCTGG + Intergenic
961723336 3:128910091-128910113 GCGGCTGGCCCGCGACAGCACGG - Exonic
962498308 3:135965297-135965319 GCTGCTGGCCAGACATTCCCTGG - Intergenic
962763936 3:138543543-138543565 GCATCTGCCCAGCCACAGCTTGG - Intronic
963087260 3:141449618-141449640 GCTACTGGCCAGCCACCGGTAGG - Exonic
963733163 3:148991768-148991790 GTTGCTGGCTGGCCGCAGCCGGG + Intronic
967894820 3:194387377-194387399 GGTGCTGGCCAGCCTCAGGTAGG + Intergenic
967925250 3:194640608-194640630 GCTGCTGGCCTGTCTCCGCCAGG - Intergenic
968593327 4:1470542-1470564 GCCACTGTCCAGCCACTGCCTGG + Intergenic
968850596 4:3075056-3075078 GCGGCTCCTCAGCCACAGCCGGG - Exonic
969538144 4:7769246-7769268 ACTGCTTCCCAGGCACAGCCGGG - Intronic
969622472 4:8285628-8285650 GCTGAATGCCAGACACAGCCTGG - Intronic
969702669 4:8776260-8776282 GCAGCTGCCCACCCAGAGCCTGG - Intergenic
969720463 4:8890659-8890681 CCTGCTGCCCGGGCACAGCCAGG - Intergenic
975617056 4:76256990-76257012 GCTGCTGTCCAGCCCTAGTCTGG - Intronic
978367543 4:107998065-107998087 CCTGAGGGCCAGCCACAGCCAGG + Intronic
978761028 4:112356683-112356705 GGAGCTGGCCAGCCCCATCCTGG + Intronic
981029746 4:140112534-140112556 GCTTCTGGCCACACACAGCTGGG + Intronic
981748637 4:148073282-148073304 GATGATGGCCACCCCCAGCCTGG + Intergenic
985273826 4:188218971-188218993 GCTGGTGGCCATCCACTGGCAGG - Intergenic
985632191 5:1019517-1019539 GCCTCTCGCCAGCCACAGCAGGG + Intronic
985635358 5:1033185-1033207 TATCCCGGCCAGCCACAGCCGGG - Intronic
985751630 5:1682002-1682024 GCTCCTTGCCAGTCCCAGCCAGG + Intergenic
986622643 5:9691667-9691689 CCACCTGGCCAGCCCCAGCCTGG - Intronic
987121227 5:14769125-14769147 GATGCTGGCCAGCTACGGGCTGG - Exonic
987253057 5:16120039-16120061 GCAGCAGGCCAGGAACAGCCCGG + Intronic
990546430 5:56826630-56826652 GCTGCTGGACCTCCACAGACAGG + Intronic
991642785 5:68771243-68771265 GGGGCTGGCAAGCAACAGCCTGG - Intergenic
994033799 5:95175792-95175814 GCTGGAGGCCAGCAACATCCTGG - Intronic
995492435 5:112707460-112707482 GTTGCTGGCTTCCCACAGCCCGG - Intergenic
996509022 5:124298397-124298419 GATGATGGCCAGCCTGAGCCTGG + Intergenic
998257833 5:140602313-140602335 ACTGCTGTCCAGTCAGAGCCAGG + Intergenic
998266718 5:140672520-140672542 GCTGCTGCCCAGCCCCGGACCGG - Exonic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1001382238 5:171312327-171312349 GGTGCCGGCCACCCGCAGCCTGG + Intergenic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1001687132 5:173602126-173602148 ACTGCTGGCCACCCAAAGTCTGG + Intergenic
1002450816 5:179317569-179317591 GCTGCTGGCCACCCATGGTCTGG - Intronic
1002898094 6:1390646-1390668 GCCGCTCGGCTGCCACAGCCAGG + Exonic
1003243152 6:4361814-4361836 GAAGCTGGCCAGCCACAGCCAGG - Intergenic
1004246857 6:13986359-13986381 GCTTCTGAGCAGGCACAGCCAGG - Intergenic
1005040205 6:21594573-21594595 GCTGCTGGCCGGCGAGAGCTCGG + Exonic
1006797062 6:36738611-36738633 GCAGAGGGCCAGCCACAGCCTGG + Intergenic
1007166054 6:39829897-39829919 GCTTCTGGCCAGCAACAACTTGG - Intronic
1007315000 6:40979948-40979970 GCTGCTGACTAGACACAGCCAGG - Intergenic
1007405036 6:41630299-41630321 CCTGCTGGCCAGCCTCAGAAAGG - Intergenic
1008476432 6:51939825-51939847 GCTCCTTGCCAGGCCCAGCCAGG + Intronic
1010752470 6:79631116-79631138 GCTGGAGGGGAGCCACAGCCCGG - Intergenic
1011149146 6:84249899-84249921 CCTGCAGTGCAGCCACAGCCTGG + Intergenic
1011213221 6:84976730-84976752 ACTGCAGCCCAGCCATAGCCTGG - Intergenic
1012228976 6:96737791-96737813 GCTGCTGGTAAGCCCCAGCTTGG - Intergenic
1015602622 6:134925435-134925457 GATGCTGGCCAGCGACGGCCAGG + Intronic
1015773524 6:136792206-136792228 CCGCCTGGCCAGCCACAGCTCGG + Exonic
1016987116 6:149904037-149904059 CCTGCTGCCCTGCCACAGCCAGG - Intergenic
1017896766 6:158686823-158686845 GATGCTGGCCAGACACAGGTCGG + Intronic
1019174443 6:170153053-170153075 CCTGCAGGGCAGCCGCAGCCTGG - Intergenic
1019281797 7:204274-204296 GCTGCTGGCCCGCCTGAGGCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019421509 7:953333-953355 GCTGCTGTCCAGCTGCAGCTTGG - Intronic
1019706856 7:2500825-2500847 GCCACAGGCCAGCCACATCCTGG - Intergenic
1019871785 7:3770628-3770650 GCAGCTGGGCAGCCACAGCAAGG - Intronic
1020794116 7:12661237-12661259 GCTCCTGGCCAGGCTGAGCCAGG + Intergenic
1021828060 7:24573788-24573810 GCTGCTGGCCGCCCCCAGCCCGG + Intronic
1022267310 7:28770016-28770038 ACTGCTGGCCCGCGACAGACAGG + Intronic
1022454637 7:30547567-30547589 GCTGCTGGCCTGCCAATGGCAGG + Intronic
1023875955 7:44286520-44286542 GCTGCTGGCCAGACTCAGACAGG + Intronic
1023980738 7:45068629-45068651 GCTCATGGCCAGCCCCACCCTGG + Intronic
1024252868 7:47519621-47519643 GGTGCTGGCCACCCACACACAGG - Intronic
1024611459 7:51068017-51068039 GCCGCTGCCTAGCCCCAGCCTGG + Intronic
1024787076 7:52920700-52920722 GCACCGAGCCAGCCACAGCCAGG + Intergenic
1025997810 7:66539170-66539192 ACTGCTGGTTAGCCGCAGCCTGG + Intergenic
1026083406 7:67242093-67242115 TCTGGTGGCCAGCCTCATCCAGG + Intergenic
1027924737 7:84446939-84446961 GCAGCTGCCCAGCCACAGCTGGG + Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029422231 7:100477633-100477655 GGAGCTGGCCAGCCTCGGCCTGG - Exonic
1029706572 7:102279665-102279687 CCAGCTGGCCACCCAGAGCCAGG - Intronic
1031052047 7:116954103-116954125 GCCGCTTGGCACCCACAGCCGGG - Exonic
1032496090 7:132363938-132363960 ACAGCCTGCCAGCCACAGCCTGG - Intronic
1034276599 7:149826551-149826573 CCTCCAGGGCAGCCACAGCCAGG - Intergenic
1034336937 7:150329944-150329966 GCTACGGCCCAGCCACAGGCTGG - Exonic
1034914151 7:155023110-155023132 GCTGCTGCCCAGCCCAGGCCTGG - Intergenic
1034990781 7:155546877-155546899 TCCACTGGGCAGCCACAGCCTGG - Intergenic
1035250569 7:157594365-157594387 CCTCCTGGCGATCCACAGCCCGG - Intronic
1035250585 7:157594413-157594435 CCTCCTGGCGATCCACAGCCCGG - Intronic
1035469437 7:159100214-159100236 ACTGGTGAGCAGCCACAGCCAGG - Intronic
1036432435 8:8702857-8702879 GGTGCAGGTCAGCTACAGCCTGG + Exonic
1036614720 8:10379450-10379472 GCTCCAGCCCAGCCTCAGCCCGG - Intronic
1036692036 8:10950177-10950199 GCTGCTGGCCTGCGACAGGGTGG - Intronic
1037142259 8:15533685-15533707 GCTTCTGGCCAGCTTCAGTCAGG + Intronic
1037566608 8:20123369-20123391 GTTGCTGGGCAGGCATAGCCAGG + Intergenic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1038911227 8:31967108-31967130 ACTGAAGGCCATCCACAGCCTGG - Intronic
1040542929 8:48376102-48376124 TCAGCTGGCCAGACAGAGCCTGG + Intergenic
1040816287 8:51511631-51511653 GCTGCAGGCCAGACTCAGGCAGG + Intronic
1042819897 8:72918768-72918790 GCAGCTGGCCAGTGGCAGCCAGG + Intronic
1042837779 8:73093157-73093179 GCGGCCGGCGAGGCACAGCCGGG + Exonic
1044461658 8:92452352-92452374 GCAGCTGCCCTGCCCCAGCCTGG + Intergenic
1044927905 8:97224707-97224729 TCTGCAGGACAGCCACAGCTGGG + Intergenic
1045242151 8:100411954-100411976 ACAGCTTCCCAGCCACAGCCTGG + Intergenic
1047521444 8:125598367-125598389 GCCCCTGCCCAGGCACAGCCTGG + Intergenic
1048967546 8:139625364-139625386 CCTGCTGGGTAGTCACAGCCTGG + Intronic
1049393369 8:142383230-142383252 GCTGCTGACCAGCCTGACCCTGG - Intronic
1049458175 8:142705518-142705540 CATCCTGGCCAGCCACTGCCTGG + Intergenic
1049726269 8:144147958-144147980 CCTTCTGGCCACCCGCAGCCTGG - Intergenic
1049839542 8:144762349-144762371 GCAGCTGGCCACACCCAGCCAGG - Intergenic
1050147271 9:2582705-2582727 GCTGCTGGCCAGCCTAAGTTGGG + Intergenic
1050206179 9:3198808-3198830 TCTGGTGACCAGCCAGAGCCTGG + Intergenic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1050682907 9:8134822-8134844 GTGGCAGGCCAGCCAGAGCCTGG + Intergenic
1051353328 9:16218484-16218506 GCAGCGGGCCGTCCACAGCCCGG - Intronic
1052613652 9:30810301-30810323 GCTGCTAGCAAGCCACACCGGGG + Intergenic
1052976050 9:34411048-34411070 GCTACAGGCCAGCCACTCCCAGG - Intronic
1053072710 9:35110650-35110672 AGTCCTTGCCAGCCACAGCCTGG - Exonic
1053419636 9:37969290-37969312 GCTGCTGACCAGCCATGGGCTGG + Intronic
1053445059 9:38146322-38146344 GCTTCAGGCCAGGGACAGCCTGG + Intergenic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1056552787 9:87664932-87664954 AGTGCTGGCCATCCACCGCCCGG + Intronic
1056558115 9:87706626-87706648 GCTGCTGGTCAACCACGGCCAGG + Exonic
1056756113 9:89382983-89383005 GCTGCAGCCCAGCCCCATCCGGG - Intronic
1057144653 9:92749697-92749719 GCTTCTGGCCAGCTGCACCCAGG + Intronic
1057912489 9:99030997-99031019 CCTGCTGGCCAGCCTCACCAGGG - Intronic
1059322796 9:113482499-113482521 GCTGTCCGCCAGCCACAGCACGG + Intronic
1060155605 9:121317962-121317984 GCTCCTGGCCAGCCAGTGCTGGG - Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061184160 9:129042378-129042400 GCTGGTGGGCAGCCAGGGCCAGG - Exonic
1061502867 9:131013783-131013805 GGGTCTGGCCAGCCACAGCGAGG + Intronic
1061767492 9:132890691-132890713 GCTGATTTCCAGACACAGCCAGG + Intergenic
1061969957 9:134039616-134039638 GGTGGTGCCCAGCCACAGCAGGG + Intronic
1062038609 9:134393818-134393840 GCTGCAGCCCAGCCACAGTGAGG - Intronic
1062267180 9:135692532-135692554 TCTGCCCGCCACCCACAGCCTGG + Intergenic
1062442676 9:136578189-136578211 GCTGCTGGCCTGGCACCTCCCGG + Intergenic
1062543272 9:137050901-137050923 GCTGCTGGCCAGCGCCCTCCAGG - Exonic
1185611207 X:1394690-1394712 ACTCCTGCCCACCCACAGCCGGG - Intergenic
1189757089 X:44282940-44282962 GCTGCTGGCCTGACCCAGGCTGG + Intronic
1190067935 X:47255197-47255219 GCTGTTTGCCAGCCCCACCCTGG - Intergenic
1191846437 X:65550909-65550931 GGTGCAGCCCAGCGACAGCCTGG - Intergenic
1191919511 X:66239440-66239462 GTGGCTGACCAGACACAGCCAGG - Intronic
1192502769 X:71664489-71664511 GCAGTGGGGCAGCCACAGCCAGG + Intergenic
1192529101 X:71870993-71871015 GCAGCGCGGCAGCCACAGCCAGG + Intergenic
1193067477 X:77275186-77275208 GCTGCTGTGCAGCAACTGCCAGG - Intergenic
1196444995 X:115841199-115841221 GCTTCTGGGCAGCCAGTGCCGGG + Intergenic
1198624195 X:138550730-138550752 GCTGGGGGACAGCCACAGCAAGG + Intergenic
1199602158 X:149547884-149547906 GCTGCTGACCAGACACTTCCTGG + Intronic
1199648229 X:149931592-149931614 GCTGCTGACCAGACACTTCCTGG - Intronic
1199881186 X:151974984-151975006 GCTCCCTGCCGGCCACAGCCTGG - Intergenic
1200134450 X:153868082-153868104 GCGCCTGGTCATCCACAGCCTGG - Exonic
1200232173 X:154449576-154449598 GCTGCTTCCCAGCCCCAGCATGG + Intronic
1200612135 Y:5337714-5337736 CCTGCCGCCCAGCCCCAGCCAGG - Intronic