ID: 1001469541

View in Genome Browser
Species Human (GRCh38)
Location 5:172001099-172001121
Sequence ATAGAGAAGAAAGATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1335
Summary {0: 1, 1: 0, 2: 6, 3: 140, 4: 1188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001469541_1001469547 11 Left 1001469541 5:172001099-172001121 CCCTCCCCATCTTTCTTCTCTAT 0: 1
1: 0
2: 6
3: 140
4: 1188
Right 1001469547 5:172001133-172001155 TTTGTCTTAAGATATTCAAAAGG No data
1001469541_1001469548 24 Left 1001469541 5:172001099-172001121 CCCTCCCCATCTTTCTTCTCTAT 0: 1
1: 0
2: 6
3: 140
4: 1188
Right 1001469548 5:172001146-172001168 ATTCAAAAGGAAATCTTAAAAGG 0: 1
1: 0
2: 3
3: 77
4: 715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001469541 Original CRISPR ATAGAGAAGAAAGATGGGGA GGG (reversed) Intronic
900204742 1:1427127-1427149 ATAGAGATGAAAGAGCGGGGCGG - Intronic
901105050 1:6748721-6748743 AGAAAGAAGAAAGAAGGAGAAGG - Intergenic
901201554 1:7470116-7470138 ACAGAGGAGAGGGATGGGGAGGG - Intronic
901774272 1:11548913-11548935 AAAGAGAAGAAAGATGTGAGAGG + Intergenic
902255479 1:15186321-15186343 ATGGACAGGAAAGACGGGGAAGG + Intronic
902589748 1:17465258-17465280 AGAGAGAAGGAAGGTGGGTAGGG + Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902959126 1:19949813-19949835 AAAGAGAAAAAAAATGGGCAGGG + Intergenic
903001680 1:20270677-20270699 TCAGAGAGGAAAGATGGAGATGG - Intergenic
903018294 1:20376049-20376071 AAAGAGAAGAAAGCAAGGGAGGG - Intergenic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903426012 1:23254823-23254845 ATGAAGTTGAAAGATGGGGAAGG - Intergenic
903445413 1:23419414-23419436 TTTGGGAGGAAAGATGGGGAAGG - Intronic
903505331 1:23830628-23830650 ATAGAACAAAAAGGTGGGGAAGG + Intronic
903704270 1:25273515-25273537 AGTGAGAAGAAAGCTGGGGTCGG - Intronic
903722969 1:25419802-25419824 AGTGAGAAGAAAGCTGGGGTCGG + Intronic
904058222 1:27686207-27686229 ACAGAGGAGGAAGAGGGGGAGGG + Intergenic
904477182 1:30772939-30772961 ACAGAGGAGAAAGCTGGGGTTGG + Intergenic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
904890509 1:33776163-33776185 CTAGAGAAGAATGAAGGGGTGGG + Intronic
904891136 1:33780471-33780493 ATAGAGGAAGGAGATGGGGAGGG - Intronic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905025657 1:34847662-34847684 ATTGAAAATAGAGATGGGGAAGG - Intronic
905027553 1:34861181-34861203 ATAGTAAAGAAAGGTGGGAAGGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905941581 1:41867481-41867503 CTAGAGAGGGAAGGTGGGGAGGG - Intronic
906289606 1:44611095-44611117 ATAGAGAACACAGCGGGGGAGGG + Intronic
906849111 1:49228777-49228799 ATTGTGAAGAAAGATGGTGGTGG + Intronic
906852953 1:49271708-49271730 ATGGAGAAGAAGGAGGGGTAGGG - Intronic
907201080 1:52726990-52727012 ATAGAGGAGAAAGAAAGGAAGGG - Intronic
907568216 1:55457412-55457434 ATAGTCAAGAAAGAAGGGGGTGG + Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908652724 1:66353591-66353613 ACAGAGGGGAAAGATGAGGAGGG + Intronic
908655875 1:66388322-66388344 ATAGGCAAGAAACATTGGGAGGG - Intergenic
909378495 1:74968605-74968627 ATAAATAGGAAAGATGGAGAAGG - Intergenic
909754315 1:79204499-79204521 AGAGAGAAGAGCGGTGGGGAGGG + Intergenic
909872587 1:80761589-80761611 ATAGAGAAGCAAGATGGCATAGG - Intergenic
910666815 1:89734501-89734523 ATAGAGAGGAAGGAGGGGAAGGG + Intronic
910791307 1:91054077-91054099 ATAGATAAGTAAGTTGGGAACGG - Intergenic
911210993 1:95137724-95137746 AAAGAGAAGGAAGAAAGGGAGGG - Intronic
911717999 1:101157290-101157312 AATGATAAGAAAGATGGGAAAGG + Intergenic
913319915 1:117580987-117581009 ATAGAGAACAGAGATGCAGAGGG + Intergenic
913978932 1:143490199-143490221 ATAGTGAAGAAAGATGACGTAGG + Intergenic
914073337 1:144315848-144315870 ATAGTGAAGAAAGATGACGTAGG + Intergenic
914105817 1:144650512-144650534 ATAGTGAAGAAAGATGACGTAGG - Intergenic
914751874 1:150540180-150540202 AAAGAAAAGAAAGAGGGAGAAGG + Intergenic
914960096 1:152197436-152197458 AGAAAGAAGAAAGAAGGAGAAGG - Intergenic
914960121 1:152197567-152197589 AGGGAGAAGAAAGGAGGGGAAGG - Intergenic
915006996 1:152647586-152647608 AAAGAGAACAAATATTGGGAGGG - Intergenic
915154611 1:153864640-153864662 AAAGAGATGAAAGAGAGGGAGGG + Intronic
915356377 1:155257391-155257413 AAAGAGGAAAAAAATGGGGAGGG + Intronic
915606429 1:156954760-156954782 GGAGAGAAGAAAGAAAGGGAGGG + Intronic
915871287 1:159562203-159562225 AAAGAGAAGAAAGAAAAGGAAGG + Intergenic
915878783 1:159643396-159643418 AAAGAAAAGAGAGAGGGGGAGGG + Intergenic
915895396 1:159807911-159807933 AGGGAGAGGAAAGAAGGGGAGGG + Intronic
916026562 1:160838305-160838327 GGAGAAAAGATAGATGGGGAAGG + Intronic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916126304 1:161574489-161574511 CTAGGTAAGAAAGATGGGGTGGG - Intergenic
916136223 1:161656329-161656351 CTAGGTAAGAAAGATGGGGTGGG - Intronic
916401541 1:164453944-164453966 AAAGAAAAGAAAGAGGGGGAAGG + Intergenic
916481824 1:165221251-165221273 AGAGTGAAGAAAGAAAGGGAAGG + Intronic
916658984 1:166903599-166903621 AAAGAGAAGAGATTTGGGGAGGG + Intergenic
916720914 1:167484261-167484283 AGAGGGAAGGAAGATGGGCAGGG - Intronic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
916979287 1:170116145-170116167 ATTCAGGAGAAAGATGGGGGTGG - Intergenic
917245255 1:172994070-172994092 AAAGAGAAAAAAGAATGGGATGG - Intergenic
917274309 1:173315035-173315057 ATAACAAAGAAAGATGAGGAAGG + Intergenic
917815540 1:178706183-178706205 TTAGAGATGGAAGATGGGGGTGG + Intergenic
918189352 1:182157424-182157446 ATAGAGATGAATGGTGGTGATGG - Intergenic
918243715 1:182641501-182641523 AGAGAAAAAAAGGATGGGGATGG - Intergenic
918394294 1:184097947-184097969 AAAGGAAAGAAAGAAGGGGAGGG + Intergenic
918695040 1:187534714-187534736 AGCGAGAAGAAAGAAAGGGAGGG + Intergenic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
918859114 1:189798827-189798849 AAAGAAAAGAAAGAAAGGGAAGG + Intergenic
918949852 1:191123385-191123407 GAAGAGAAGAAAGAAAGGGAAGG - Intergenic
919083650 1:192894788-192894810 TTAGATAGGAAAGAAGGGGATGG + Intergenic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919365869 1:196660044-196660066 AGAGAAAATAGAGATGGGGATGG + Intronic
919638256 1:200024875-200024897 AGAGAGAGAGAAGATGGGGAAGG + Intergenic
919846019 1:201642670-201642692 AAAGGGAAGAAAGAGAGGGAGGG - Intronic
920040152 1:203090282-203090304 ATAGAGGAGCAAGAAGGAGAAGG + Intergenic
920211435 1:204331741-204331763 TGAGGGAAGAAAGATGGAGAGGG + Intronic
920254643 1:204646139-204646161 ATGGTGAGAAAAGATGGGGAGGG + Intronic
920706444 1:208254299-208254321 AGAGAGAAGAAAAGTTGGGATGG - Intergenic
921143868 1:212332872-212332894 ATAAAAAAGAAAGAAGGGAAAGG - Intronic
921266462 1:213424805-213424827 GTAGGGAAGAAGGATGGGAAGGG - Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921843993 1:219859940-219859962 TTGGAGAAGAAAGGTGGGGATGG - Intronic
921892989 1:220371350-220371372 AAAGATAAGACAGATGGGGTAGG + Intergenic
922108196 1:222530814-222530836 ATAGAGAATCTAGATGTGGAAGG + Intronic
922331275 1:224578802-224578824 AAAGAGGAGAAAGACGGAGAAGG - Intronic
922895470 1:229096865-229096887 GGAAAGAAGAGAGATGGGGAGGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922944232 1:229497183-229497205 CAAAAGCAGAAAGATGGGGATGG + Intronic
923016439 1:230130197-230130219 TTACAGAAGAAAGATATGGATGG - Intronic
923182083 1:231529227-231529249 ATAGAGAAGAAAAAAAGAGAGGG - Intronic
923264549 1:232301489-232301511 ATAGAGGAGACTTATGGGGAAGG + Intergenic
923591378 1:235322794-235322816 AGACAGAAGGAAGAGGGGGAAGG + Intronic
923682988 1:236134057-236134079 ATAGAGAAGAAAGACAGATAGGG + Intergenic
924148095 1:241097946-241097968 ATAGAGAGGAAAGAGCGTGAGGG - Intronic
924220803 1:241873485-241873507 GTAGAAAAAAAAGAGGGGGAAGG - Intronic
1062985222 10:1762082-1762104 ATGGAGCTGAAAGTTGGGGAGGG - Intergenic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063510584 10:6641518-6641540 AGAGAAAAGAAAGATGGAAAAGG - Intergenic
1063972788 10:11393130-11393152 ATAGGAAACAACGATGGGGACGG + Intergenic
1064449790 10:15431524-15431546 AAAAAAAAGAGAGATGGGGAGGG - Intergenic
1064454069 10:15470383-15470405 GTAGACAAGAGAGAAGGGGAGGG - Intergenic
1065478868 10:26172121-26172143 GTAGAGAGGAAAGTTAGGGAAGG + Intronic
1065483719 10:26217227-26217249 ATAGAAAAAAAAAATGGGAAAGG + Intronic
1065659096 10:27987032-27987054 ATAGAGAAGACAGATGACAAGGG - Intronic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066467778 10:35668408-35668430 AGAAATAAGAAAGATGGGCAAGG - Intergenic
1066600084 10:37095092-37095114 CTAGAGAAGAATGGTGGTGATGG + Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1067975928 10:51025243-51025265 ATAGAGGATAAAGCTGGGGGAGG - Intronic
1068232739 10:54191948-54191970 AAAGAAAAGAAAGAAGGAGAAGG + Intronic
1068846424 10:61680867-61680889 ACAGGGAAGAAAGAAGGGGAAGG + Intronic
1069190536 10:65482474-65482496 ATTTAGAAGAAAGATAGGTAAGG - Intergenic
1069210290 10:65749578-65749600 ATTGAGAAGACAGCTGGGGGAGG + Intergenic
1069351551 10:67532701-67532723 AAGGAGAAGAAAGATGGGACAGG + Intronic
1069711939 10:70495235-70495257 CTAGATGAGAAAGATAGGGAAGG - Intronic
1069982244 10:72260784-72260806 CTAGAGAGGAGAGAGGGGGAGGG - Intergenic
1070065279 10:73027706-73027728 AGAGAGAAGAAAGAAAGGAAAGG + Intronic
1070171051 10:73932845-73932867 AAAAAGAAGAAAGTTGGGGTGGG + Intergenic
1070198501 10:74180845-74180867 ATAGAAAAGAGAAATGGGGCTGG - Intronic
1070616222 10:77971389-77971411 TTAGCAAAGAAAGAGGGGGAGGG - Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071036715 10:81256206-81256228 AGAGAAAAGAAAGAAAGGGAGGG - Intergenic
1071134422 10:82437233-82437255 ATAGAGAAAAAAGAATGGAAAGG - Intronic
1071185523 10:83039687-83039709 AGAGAGAAGAAAAAGAGGGAAGG - Intergenic
1071186924 10:83057307-83057329 TTGGAGAAGAAAGATGGGCTGGG + Intergenic
1071301326 10:84258038-84258060 ACAGAGAACAAAGATGGAGAGGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071423777 10:85528121-85528143 AAAGCAAAGAAAGAGGGGGATGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071738703 10:88331922-88331944 AGAGGGGAGAAAGATGGGAAAGG + Intronic
1071932820 10:90492501-90492523 ATAGAAAAGAAAAAAGGGCAGGG + Intergenic
1071933273 10:90497727-90497749 ACAGAGAAGAAATATGGGTATGG - Intergenic
1072050842 10:91701481-91701503 GAAGAGAAGAAAGATGGGGCAGG + Intergenic
1072188766 10:93064347-93064369 GGAGAGAAGAAAGATGGGGCAGG - Intronic
1072423603 10:95310475-95310497 ACAGAGGAGGAAGAGGGGGATGG + Intergenic
1072728172 10:97827574-97827596 AGAGGGAGGAAAGATGGGGAGGG - Intergenic
1072735014 10:97873396-97873418 ACACAGAAGAAAGAGGGAGAAGG - Intronic
1072815793 10:98507786-98507808 AAATGAAAGAAAGATGGGGAGGG - Intronic
1072996154 10:100246007-100246029 ACTGAGAAGAAAGATAGGTATGG - Intronic
1073007936 10:100339044-100339066 ATAGGGTAGGAAGATTGGGAGGG + Intergenic
1073479990 10:103780311-103780333 ATAGAGAAAAAAGTGGGGAATGG - Intronic
1074003492 10:109394923-109394945 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1074015696 10:109531477-109531499 TTAGAGAAAAAAGATGGAAAAGG + Intergenic
1074180743 10:111060371-111060393 ATAGAGAAGGAAAAGGGTGAGGG - Intergenic
1074193462 10:111158294-111158316 TGAGAGCAGAGAGATGGGGAAGG + Intergenic
1074199313 10:111220284-111220306 ATAGAGGAGAGAGAAAGGGAAGG + Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074968443 10:118515224-118515246 ATTGAGAGGAAAGATGGGTTGGG + Intergenic
1075058047 10:119234657-119234679 AAAGAAAAGAAAAAAGGGGAGGG - Intronic
1075313918 10:121437081-121437103 AGAGAGAAGAAAGAGGGGGCTGG + Intergenic
1075382302 10:122029016-122029038 ATAAAGAAGAAAGACGGGAAGGG - Intronic
1075435979 10:122442195-122442217 ATAGAGAACAAAGAAAGGAATGG - Exonic
1076137028 10:128052210-128052232 AGAGAAAAGAAAGATGGGGTTGG - Intronic
1076944100 10:133632342-133632364 AGAAACAAGAAAGATGGGGGAGG + Intergenic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077553900 11:3216835-3216857 GAAGAGAAGAGAGAAGGGGAGGG - Intergenic
1077743655 11:4876648-4876670 ATAAAGAAGACAGAGGGGCAAGG - Intronic
1077857305 11:6141558-6141580 ATAGAGATGACAGATGGAGGAGG + Intergenic
1077922206 11:6650102-6650124 AAAGAGAAGAAAGAGGGGAGAGG - Intronic
1078293495 11:10040786-10040808 AAAGAGAGGAAAGAAGGGTAGGG + Intronic
1078312665 11:10260881-10260903 AAAGAAAAGAAAGAAGGGGAGGG + Intronic
1078593351 11:12665127-12665149 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1078890984 11:15559058-15559080 AAAGAGAAGGAAGAAAGGGAGGG + Intergenic
1078966411 11:16349648-16349670 AAACAGAAGAAAGAGAGGGAGGG + Intronic
1079259733 11:18866905-18866927 ATGGAGAAGGAAGAGGGGAAGGG - Intergenic
1079321857 11:19457950-19457972 TTAGAGAAGAAAGATGGCAGGGG + Intronic
1079375553 11:19888665-19888687 CTAGAGAAGAAAGCAGGGCAGGG - Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079901440 11:26191539-26191561 ATAGTGAACAAAGATGGAAATGG - Intergenic
1079986540 11:27206171-27206193 AAAGAAAAGTAAGATGGGTAGGG - Intergenic
1080054982 11:27897609-27897631 ATAGAAAAAAAATGTGGGGAAGG + Intergenic
1080111719 11:28575506-28575528 AAAAAGAAGAGAGATGGGGAAGG - Intergenic
1080186518 11:29493840-29493862 AGACAGAAGGAAGAGGGGGAAGG - Intergenic
1080397883 11:31906608-31906630 AAAGAGAAGGGAGAGGGGGAAGG + Intronic
1080446362 11:32341405-32341427 ATAGAGGAGAACAATGGAGATGG - Intergenic
1080455071 11:32411173-32411195 ATAGGAAAGAAAGGTTGGGATGG - Intronic
1080664758 11:34326081-34326103 AGAGAGAAGAAAGACCTGGAAGG - Intronic
1080999571 11:37651524-37651546 AAAGAGAAGAAAAATTGGGCAGG - Intergenic
1081800287 11:45854161-45854183 ACAGAGAAAAATGCTGGGGATGG + Intronic
1082109905 11:48263092-48263114 CTAGAGATGAAAGGTGGTGATGG - Intergenic
1082201275 11:49371957-49371979 ATACTGGAGAAAGATGGGAAAGG - Intergenic
1082301264 11:50509297-50509319 CTAGAAAAGAAAGATCTGGAGGG - Intergenic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1083186449 11:61020567-61020589 ATGAGGAAGAAAGAGGGGGAAGG + Intergenic
1083246351 11:61430838-61430860 AAAAAGAATAAAGATAGGGATGG - Intronic
1083826897 11:65209045-65209067 ATTGGGTAGAAAGATGGGGCAGG - Intronic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084368928 11:68725006-68725028 AAAGAGTACAAAGATGGGGAAGG + Intronic
1084534428 11:69748305-69748327 ATGGAGAAGAAAGAAAGGGAGGG - Intergenic
1084563594 11:69917571-69917593 GAAGAGAAGAGAGAAGGGGAGGG - Intergenic
1084864772 11:72046558-72046580 AAAGAGAAGAAAGAAAGGGGTGG + Intronic
1084882923 11:72184819-72184841 AGAGAAAAGAAAGCTGGGCATGG + Intergenic
1084929789 11:72545832-72545854 AAAGAAAAAAAAGATGTGGAAGG - Intergenic
1085225954 11:74921355-74921377 GCAAAGATGAAAGATGGGGAAGG + Intronic
1085442311 11:76576187-76576209 ATAAAGGGCAAAGATGGGGAAGG + Intergenic
1085596100 11:77811583-77811605 CAAGGGAAGGAAGATGGGGATGG + Intronic
1085890300 11:80571782-80571804 CTAGAGAAGAGTGATGGTGATGG - Intergenic
1086249682 11:84798394-84798416 AAAGAGAGGAAAGAGGGGGAAGG - Intronic
1086607614 11:88715008-88715030 ATGAAAATGAAAGATGGGGAAGG + Intronic
1086654401 11:89334257-89334279 ATACTGGAGAAAGATGGGAAAGG + Intronic
1086799367 11:91152549-91152571 ATAGAGGAAAAATATGGGGTTGG - Intergenic
1086875241 11:92087922-92087944 AGGGAGAGGAAAGATGGAGAGGG - Intergenic
1086922237 11:92600833-92600855 TTAGAGAAGATGGTTGGGGAAGG + Intronic
1086996369 11:93360835-93360857 GGAGAGGAGAAAGATGGGGAGGG + Intronic
1087163813 11:94977630-94977652 AAAAAGAAGAAAGAGGGGAAGGG - Intronic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087307896 11:96505939-96505961 ATAGGGAATATTGATGGGGAAGG - Intronic
1087881416 11:103420080-103420102 ATAGAGAAAAAAGAATGGAAAGG + Intronic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1087998418 11:104841565-104841587 AGAGAGAATAAAGCTGGGGAGGG - Intergenic
1088177886 11:107074395-107074417 AAAGAGAAGAAGGGTGGGCACGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088460483 11:110077182-110077204 ATAGTGAAGTAATTTGGGGAAGG + Intergenic
1088648722 11:111938450-111938472 AGAGAGAAGAAAGAGAGAGATGG - Intronic
1089162958 11:116453535-116453557 ATAGATAAGAAAGAAGGAAAGGG + Intergenic
1089281040 11:117374772-117374794 ATAGAGAAGAAAAACGCTGATGG - Intronic
1089482070 11:118814143-118814165 AAAGAGAAGAGAGAAGGAGAAGG + Intergenic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090144036 11:124299914-124299936 TTAGATAAGAGAGCTGGGGAAGG - Intergenic
1090248428 11:125234458-125234480 ATAGAGAAGAATGATGGTGCAGG - Intronic
1090451471 11:126810101-126810123 AAAGTGAAGGATGATGGGGAGGG + Intronic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090510871 11:127373750-127373772 AGAGATAGGAAAGATGAGGAAGG - Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090746657 11:129710780-129710802 GTAGAGAAGGAAGAGGGGAAGGG + Intergenic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091192652 11:133707595-133707617 AAAGGGAAGAAAAAAGGGGAAGG + Intergenic
1091238265 11:134035988-134036010 ATAGAAAAGGAAGACGAGGATGG + Intergenic
1091321400 11:134654951-134654973 AAAGAGAAGAAAGGAAGGGAGGG - Intergenic
1091838486 12:3602613-3602635 AAAGAGTAGAAGGATGGGGTGGG - Intergenic
1091933450 12:4415875-4415897 ATAAAGAACAGATATGGGGAAGG + Intergenic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092195881 12:6549535-6549557 ACAGAGGAGAGAGAGGGGGAAGG + Intronic
1093165390 12:15799673-15799695 AAAGAAAAGAAAGAAAGGGAAGG - Intronic
1093204660 12:16232968-16232990 AGAAAGAAGAAAGAGAGGGAGGG + Intronic
1093621923 12:21302045-21302067 TTAGAGAAGATAGAAGGGGTTGG - Intronic
1093667132 12:21827988-21828010 AAAGAGAAGGAAGATGGTAAAGG - Intronic
1093700384 12:22213458-22213480 AGAGAGAAGAAAGTTAGGGCAGG + Intronic
1094644312 12:32306537-32306559 TTAGAAAAGAAAGCTGGGGCTGG - Intronic
1095237251 12:39812429-39812451 AAAGAGAAGAAAGAAAAGGAAGG - Intronic
1095344709 12:41136457-41136479 GTAGAGAAGAAAGAAGAGAAGGG + Intergenic
1095824736 12:46519370-46519392 ATAGAGAAGAAAGAAGAGAAAGG - Intergenic
1095934152 12:47658465-47658487 ATAGAAAAGATAGAAGGGCATGG + Intergenic
1096065858 12:48739659-48739681 AAAGAGAAGAGAGAAGGGGTGGG + Intergenic
1096088957 12:48885535-48885557 AAAGAGAAGAAAGGTTGAGAAGG + Intergenic
1096291752 12:50349482-50349504 ATAGAGTAGAAGGATGGGACAGG - Intronic
1096541902 12:52312707-52312729 GGAGAGAGGAAAGAGGGGGATGG + Intergenic
1096943644 12:55378828-55378850 ATAGAGAAAAAATATGGGTTAGG - Intergenic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097156369 12:57015138-57015160 AAAGAGAAGAAGGAAGGGGTTGG + Intronic
1097263285 12:57731700-57731722 ATAGGGAAGATAGATGAAGAAGG + Intronic
1097268012 12:57756702-57756724 AAAGAGATGAAAGATGGAAAGGG - Intronic
1097323502 12:58250452-58250474 AGGGAGGAGAAATATGGGGAGGG + Intergenic
1097890674 12:64774235-64774257 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1097926447 12:65133867-65133889 ATGGAGAAGAAAGAAAGGAAGGG + Intergenic
1098140233 12:67443535-67443557 GTAGAGAAGAAGGCTGGGAATGG + Intergenic
1098302525 12:69068849-69068871 ATAAAGAAAATAGAAGGGGAAGG + Intergenic
1098352528 12:69579094-69579116 ATAGAGAACAAAGGGTGGGAAGG - Exonic
1098385687 12:69916297-69916319 GGAGAGAAGAAAGCTGGAGACGG + Intronic
1098819023 12:75207226-75207248 AAAGAACAGAAAGTTGGGGAGGG + Intronic
1098885052 12:75952501-75952523 ATAAAGAAAAAAGAGGGGGCCGG - Intergenic
1099044355 12:77697254-77697276 AGAGAGAAGGAAGAGGGGGGTGG - Intergenic
1099616514 12:84942488-84942510 ATAGGGATGACAGATGGAGAAGG - Intergenic
1099649836 12:85411706-85411728 ATGGGGAAGAAAGACGGGAAGGG + Intergenic
1099836769 12:87916321-87916343 ATAGAAAAAAAAGATTAGGATGG + Intergenic
1100022806 12:90090319-90090341 AAAGAAAAGAAAGAAAGGGAAGG - Intergenic
1100299921 12:93297407-93297429 AGAAGGAATAAAGATGGGGAAGG + Intergenic
1100346723 12:93738799-93738821 AAAGAGAAGAGAGAGAGGGAAGG + Intronic
1100521704 12:95381572-95381594 ATAGAGAACAGAGACTGGGAGGG + Intergenic
1100749600 12:97682624-97682646 ACAGAGATCAAAGATTGGGAAGG + Intergenic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1100991357 12:100254711-100254733 AAAAAGAAGAAAGAGAGGGAAGG - Intronic
1101141641 12:101801640-101801662 ATAGAGAAGAAAGAAGGAAGGGG - Intronic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101704334 12:107207363-107207385 GTAGAGCAGAAAGATGAGGAAGG - Intergenic
1101729428 12:107414692-107414714 AAAGAAAAGAAAGGGGGGGATGG - Intronic
1101740615 12:107497162-107497184 ATTGAGGATAAAGTTGGGGATGG - Intronic
1101976125 12:109360425-109360447 ACAGAGAAGAGAGATGGGGCAGG - Intronic
1102012777 12:109628875-109628897 AAAGAAAAGAAAGAAAGGGAAGG - Intergenic
1102170364 12:110837804-110837826 ATAGAGAAGAAATAACTGGAAGG - Intergenic
1102503164 12:113366816-113366838 AAAAAGAAAAAAGAAGGGGAGGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102984281 12:117265763-117265785 AAAGAAAAAAAAGATGGGGGTGG - Intronic
1103285340 12:119796365-119796387 ATGAGGAAGAAAGATGGGTATGG + Intronic
1103652437 12:122443418-122443440 AGAAAGAAGAAAGAAAGGGAAGG - Intergenic
1103834468 12:123807910-123807932 AGAGAGGAGAGAGAAGGGGAGGG + Intronic
1103846936 12:123908306-123908328 CCAGAGAAGAAAGAGGGGGATGG - Intronic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1105220401 13:18321194-18321216 ATAGTGAAGAAAGATGACGTAGG - Intergenic
1105530904 13:21219435-21219457 AAAGAAAAGAAAGAGAGGGAGGG - Intergenic
1105678383 13:22700791-22700813 AAAGAGACAAAAGATGGGGGAGG - Intergenic
1105734209 13:23251088-23251110 AAAGAGAAGAAAGAACGGGGAGG - Intronic
1106060605 13:26287564-26287586 TTGGAGGAGAAAGGTGGGGAGGG + Intronic
1106112160 13:26786502-26786524 ATTCAGAAGAAAGCTGGGGCTGG + Intergenic
1106511619 13:30418148-30418170 GCAGAGAAGAAAGCTGGAGAAGG + Intergenic
1106546191 13:30732857-30732879 AGAGAGAAAAAAGAGGGGGCCGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1107033972 13:35881423-35881445 TTAGAGAAGAAAAAAAGGGAAGG - Intronic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1107996185 13:45863427-45863449 ATTGCAAAGAGAGATGGGGAGGG + Intergenic
1108070465 13:46623859-46623881 ATAAAAAACAGAGATGGGGAGGG - Intronic
1108167525 13:47709089-47709111 AGAGAGAAGGAAGATAGAGAAGG - Intergenic
1108723721 13:53158894-53158916 AGAGAGAAGAGAGAGAGGGAGGG - Intergenic
1108742177 13:53349632-53349654 AGAAAGAAGAAAGATAGGAAAGG + Intergenic
1108749401 13:53432144-53432166 ATAGAGAAGAAAGCAGACGATGG + Intergenic
1108835768 13:54545821-54545843 AGAGAGAAGAAAGAAAGAGAGGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111469626 13:88661425-88661447 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
1111641938 13:90980176-90980198 ATAGAGAGGAAATGTGGGGTTGG - Intergenic
1111682222 13:91458028-91458050 ATAGAGCAGAGTGAGGGGGATGG + Intronic
1111704886 13:91736138-91736160 ATAGAAAAGAAAGAGGGTGAGGG + Intronic
1111999842 13:95199892-95199914 GTAGTGGAGAGAGATGGGGAAGG - Intronic
1113288046 13:108875243-108875265 AGAGAAAAGACAGGTGGGGAAGG + Intronic
1113920840 13:113908436-113908458 AGAGAGAAGAAAGGTGGGGGAGG - Intergenic
1114360380 14:21965725-21965747 ACAGAGAAGACAGATTGGGTAGG - Intergenic
1114366462 14:22032459-22032481 AAAGAGATGAGAGAGGGGGAAGG - Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1114825773 14:26077085-26077107 ATAGAAAATGAAAATGGGGAGGG + Intergenic
1115550550 14:34501170-34501192 AAAGAGAAGAAAGAAAGGGAAGG + Intergenic
1115872266 14:37817769-37817791 ATAGAGTACAAAAATGGGGAGGG + Intronic
1116800659 14:49440031-49440053 TGAGAGAAGATACATGGGGAGGG + Intergenic
1116977553 14:51132618-51132640 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1117064244 14:51993852-51993874 AGAGAGAGGAAAGATGGGAAAGG + Intronic
1117096292 14:52301644-52301666 AAAAAGAAGAAAGATAGGGCTGG - Intergenic
1117106718 14:52404945-52404967 ATAGAGAATAAAGTTGGGAGAGG - Intergenic
1117197559 14:53355695-53355717 GTAGAGAAGAAAGGAGAGGAGGG + Intergenic
1117202992 14:53411547-53411569 CTAGAGAAGAAAAATGTTGAAGG - Intergenic
1117886756 14:60372050-60372072 ACAGAGAGGAAACATGGGGTTGG + Intergenic
1117895657 14:60483876-60483898 ATAGAGAAAAAAAATGGGTATGG + Intronic
1118286599 14:64480025-64480047 ATAGAGAAGAAAGAAGCAGCTGG + Exonic
1118508712 14:66445831-66445853 AGAAAGGAGAAAGGTGGGGATGG - Intergenic
1118574159 14:67224770-67224792 ATGGAAAAGAAAGATGGGTAAGG - Intronic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1119959082 14:78834306-78834328 ACAAAGAAGAAAGATGGAGGGGG + Intronic
1119969202 14:78950593-78950615 AAAAAGAAGAAAGAGAGGGAGGG + Intronic
1120332311 14:83109272-83109294 TTAGAAACGAAAGATGGTGAAGG + Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120483940 14:85086475-85086497 AAAGGGAAGAAAGAAAGGGAGGG - Intergenic
1120938486 14:89921642-89921664 ATGGAGGAGAACGATGGGGTAGG + Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121231379 14:92361343-92361365 GTAGAGAAGCAAGGTTGGGAAGG + Intronic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1122404310 14:101490892-101490914 AAAGAGGAGAAAAATTGGGACGG + Intergenic
1202927122 14_KI270724v1_random:36735-36757 AGAAACAAGAAAGATGAGGAAGG - Intergenic
1123474358 15:20579362-20579384 GTAGAGAAAACAGATGGGGGAGG - Intergenic
1123643654 15:22420991-22421013 GTAGAGAAAACAGATGGGGGAGG + Intergenic
1123734660 15:23174376-23174398 GTAGAGAAAACAGATGGGGGAGG - Intergenic
1124088340 15:26573382-26573404 AGAGAGAAGAAAAATGGGATTGG + Intronic
1124285163 15:28395683-28395705 GTAGAGAAAACAGATGGGGGAGG - Intergenic
1124297533 15:28515931-28515953 GTAGAGAAAACAGATGGGGGAGG + Intergenic
1124647671 15:31450432-31450454 AAAGGGAAGGAAGACGGGGAAGG + Intergenic
1124968944 15:34465496-34465518 ATCTAGAGGAAAGATGGTGAGGG - Intergenic
1125115796 15:36090057-36090079 AGAGAAAACAAAGCTGGGGAAGG - Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1126259259 15:46668749-46668771 ATATGGAAGAAAGAAAGGGAAGG - Intergenic
1126272035 15:46831321-46831343 AAAGAAAAGGAAGACGGGGAAGG + Intergenic
1126582575 15:50254862-50254884 ATAGGAATGAAAGTTGGGGAGGG - Intronic
1126663724 15:51056658-51056680 AAAGCCAAGAAAGATGGGTAGGG + Exonic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1127070215 15:55281669-55281691 AAAGACAAGAAAGAAGGGAAGGG + Intronic
1127338480 15:58014854-58014876 AGAGCCAAAAAAGATGGGGATGG + Intronic
1127391883 15:58512474-58512496 ATAGATGTGAAAAATGGGGATGG + Intronic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127775699 15:62262686-62262708 ATGGAGAACAAAGAAAGGGAGGG + Intergenic
1127896784 15:63307382-63307404 ATAGAGATAAAAGAAGAGGAGGG + Exonic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128759476 15:70206106-70206128 TCAGAGAGGAAGGATGGGGAAGG + Intergenic
1128830026 15:70760243-70760265 AACTAGAAGAAAGTTGGGGAGGG + Intronic
1129084649 15:73076057-73076079 AGAGAATAGAAATATGGGGAGGG + Intronic
1129368419 15:75071173-75071195 CTTGAGCAGCAAGATGGGGATGG + Intronic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130243644 15:82221922-82221944 GAAGAGAAGGAAGGTGGGGAAGG - Intronic
1130297518 15:82657573-82657595 ATATAGAATAAAGGTGGGTAAGG + Intergenic
1130365510 15:83234638-83234660 CTAGGGAAGAGATATGGGGATGG + Intergenic
1130456831 15:84119359-84119381 GAAGAGAAGGAAGGTGGGGAAGG + Intergenic
1130561414 15:84962413-84962435 AAAGAGAAGAAAGAAAGGGTGGG + Intergenic
1130916093 15:88305920-88305942 AGAGAGAAGAAAGGGAGGGAGGG + Intergenic
1131038190 15:89239423-89239445 CTAGAAAAGAAAGATCTGGAGGG + Intergenic
1131080053 15:89527120-89527142 AAAGAGAAGGATGGTGGGGAGGG + Intergenic
1131494525 15:92894447-92894469 ATAGCAAAGAAAAATGGGGCGGG - Intronic
1131597865 15:93816792-93816814 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1131769340 15:95718278-95718300 ATAGAGAAAGAGGATAGGGAAGG - Intergenic
1131940732 15:97562124-97562146 AGAGAGAAAGTAGATGGGGAGGG + Intergenic
1131994116 15:98118168-98118190 ATAGAAAGGAAAGATGCTGAAGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132538705 16:497135-497157 ATAGAGCAGACATCTGGGGATGG - Intronic
1132874525 16:2130437-2130459 ACAGAGATGGATGATGGGGAGGG - Intronic
1132979832 16:2731723-2731745 AAAGAGAAAAAAGATAGGGAGGG + Intergenic
1133210069 16:4258565-4258587 ATACAGAAGTTAGCTGGGGATGG - Intronic
1133456589 16:5947651-5947673 ATAGAGAAGGAAGATGGTAAGGG - Intergenic
1133902218 16:9987662-9987684 AAAGCAAAGAAAGATGGAGAAGG + Intronic
1134408137 16:13980893-13980915 AGACTGAGGAAAGATGGGGAAGG + Intergenic
1134504217 16:14792017-14792039 ACAGAGAACAGGGATGGGGAAGG + Intronic
1134553470 16:15149270-15149292 ACAGAGATGGATGATGGGGAGGG - Intergenic
1134576356 16:15336891-15336913 ACAGAGAACAGGGATGGGGAAGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134726087 16:16419610-16419632 ACAGAGAACAGGGATGGGGAAGG + Intergenic
1134805261 16:17118804-17118826 ATCCTGGAGAAAGATGGGGAGGG - Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1134904843 16:17971535-17971557 AGACAGGAGAAAGATGGAGAAGG + Intergenic
1134941346 16:18292250-18292272 ACAGAGAACAGGGATGGGGAAGG - Intergenic
1135192560 16:20366849-20366871 ATAGAGAATAAAGGTGTGGGAGG - Intronic
1135495232 16:22945679-22945701 ATAGCCAAGAAAGATGGTGTTGG - Intergenic
1135814646 16:25621439-25621461 AAAGAAAAGAAAGAAAGGGAAGG - Intergenic
1135894935 16:26391108-26391130 GAAAAGAAGAATGATGGGGAAGG + Intergenic
1136173682 16:28503541-28503563 ATAGAGATGAAAGACAGGCATGG - Intronic
1136474406 16:30503630-30503652 AAAGAGAAGAAAGAAAAGGAAGG + Intronic
1137007845 16:35295094-35295116 GTAGAAAAGAAAGATGGGTTGGG + Intergenic
1137246810 16:46712494-46712516 ATAGGGTAGTGAGATGGGGAAGG - Intronic
1137373771 16:47933092-47933114 AAAGAGAACAACCATGGGGAGGG - Intergenic
1137809486 16:51339268-51339290 AGTGAGAAGAAAGAGGGAGAGGG - Intergenic
1137833713 16:51570018-51570040 ATAGGGACAAAAGATGGAGACGG + Intergenic
1137954062 16:52810978-52811000 GTGGAGAAGAAAGATTGGTAAGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139203371 16:65002217-65002239 ATAGAAAAAAAAGAGGGGAAAGG - Intronic
1139875244 16:70140834-70140856 ATAGAAAAGAAAATGGGGGAGGG + Intronic
1140088634 16:71818889-71818911 ATTGAAAAGAAAAATGGGGCCGG + Intergenic
1140092981 16:71852422-71852444 ATGGTGAGGAGAGATGGGGAAGG - Exonic
1140347605 16:74229041-74229063 AGAGGGAAAAAATATGGGGATGG + Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140618856 16:76702519-76702541 ATAGAGAATAAAGATATTGATGG - Intergenic
1140756344 16:78070996-78071018 ATATAGTAGGAAGATGAGGATGG - Intergenic
1140798625 16:78464305-78464327 AAAGAGAGGAAAGAGGGGAAGGG + Intronic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141283444 16:82649684-82649706 AGAGAGAAAAATGATGGGGAAGG + Intronic
1141294137 16:82751047-82751069 AGAGAAAAGAAAGATCAGGAAGG - Intronic
1141382557 16:83589231-83589253 AGAGAGAAGAGGGAGGGGGATGG - Intronic
1141764332 16:86048586-86048608 AGAGAGAGGAAAGAAAGGGAAGG - Intergenic
1142281217 16:89148687-89148709 GAAGAGGAGAAAGATGGGGTTGG - Intronic
1142740733 17:1930545-1930567 AGAGAGGAGAGAGATGGGGGCGG + Intergenic
1142861224 17:2763085-2763107 ATAGGGAAGATAGTTGGAGATGG + Intergenic
1142942242 17:3390237-3390259 ATAAATAAGAAAGAGAGGGAGGG + Intergenic
1143092693 17:4458373-4458395 AGAAAGAAGAAAGAAAGGGAGGG - Intronic
1143193793 17:5059856-5059878 AGAAAGAAGAAAGAAGGAGAAGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143672315 17:8405238-8405260 GGAGAGAAGAGAGGTGGGGAAGG + Intergenic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144110997 17:12032756-12032778 ATACAGAATAAGGATGGTGAGGG - Intronic
1145747600 17:27331992-27332014 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1146136534 17:30326408-30326430 AGAAAAAAGAAAGATAGGGAAGG - Intronic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1146801216 17:35824635-35824657 ATGGAGTAGAAAGGTGGGGATGG + Intronic
1147361860 17:39935900-39935922 ATAGAGAAGATAGATAAGGAAGG - Intergenic
1147848798 17:43425319-43425341 AGAGAGAAGAAAGAGGTGAAAGG - Intergenic
1147873488 17:43604225-43604247 ATACAGAGAAAGGATGGGGAAGG + Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148334658 17:46833088-46833110 AAAGAGCAAAAAGAGGGGGAGGG + Intronic
1149783964 17:59420219-59420241 ATAGAGAATAACGGTGGTGAGGG - Intergenic
1150000698 17:61437147-61437169 AGAGAGAAGGAAGAAGGAGAGGG - Intergenic
1150072124 17:62160050-62160072 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1150176997 17:63067767-63067789 ATAGAGAGAAAAGCAGGGGATGG + Intronic
1150289558 17:63973526-63973548 AGGGAAAAGAAAGATGGGGGTGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150906789 17:69346918-69346940 AAAGAAAAGAAAGGAGGGGAGGG + Intergenic
1151078617 17:71302958-71302980 ATATAGAAAAAAGACTGGGAAGG - Intergenic
1151918394 17:77135862-77135884 ATAGAAAAGAAAGAGAAGGAAGG - Intronic
1152025782 17:77808287-77808309 ATAGATAATAAAGTTGGAGAGGG + Intergenic
1152612249 17:81321618-81321640 AGAGTGAAGAAAGCTGGGGTGGG - Intronic
1152969515 18:148189-148211 ATTGAGAAGAAAGAGGAAGAAGG + Intergenic
1153125483 18:1785494-1785516 ATAGAGAAAAAAGAATGAGAAGG + Intergenic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153299909 18:3583356-3583378 AAAGACAAGAAAGAGGGAGACGG - Intronic
1153370176 18:4306492-4306514 ATAAAGAAGAAAGGAGGGAAAGG + Intronic
1153679589 18:7487572-7487594 GAAGAGGAGAAAGAAGGGGAGGG + Intergenic
1153884132 18:9448008-9448030 AAAGAGAAGAAAGCTGGGTGTGG + Intergenic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154205802 18:12335696-12335718 ATAGAGCTGAAGGAAGGGGAAGG - Intronic
1155255874 18:23997619-23997641 AAAGAAAAGAAAGAGAGGGAGGG + Intronic
1155331733 18:24725824-24725846 AGAGAGGAGAGAGATGGGGGTGG + Intergenic
1155724285 18:29060228-29060250 ATGGAGAAGAAACTTGGAGAAGG + Intergenic
1155917778 18:31572977-31572999 AAAGAGAGGAAAGAGAGGGAAGG + Intergenic
1156042439 18:32837676-32837698 TTAGAGAGGAAAGATTGTGACGG + Intergenic
1157023148 18:43810780-43810802 AAAGACAAGAAAGAAGAGGAAGG + Intergenic
1157419254 18:47531628-47531650 AAAGAGAAGGAAGATGGGGGTGG + Intergenic
1157741481 18:50097117-50097139 TTTGAGAAGAAAGATAGGGGAGG - Intronic
1158241648 18:55385060-55385082 ATAGAGAAGTGAGACGGGGTGGG - Intronic
1158243954 18:55409557-55409579 AGACACAAAAAAGATGGGGACGG - Intronic
1158408947 18:57187336-57187358 ATATAAAAGAGAGGTGGGGAAGG - Intergenic
1158423100 18:57313423-57313445 AGGGAGGAGAAAGAAGGGGAGGG + Intergenic
1158744360 18:60181483-60181505 ACAGAGATGAAAAATGGTGAAGG - Intergenic
1158747766 18:60220890-60220912 ATAGAGACCAAAGACTGGGAAGG - Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159234226 18:65650330-65650352 ATGGAGAAGAAAGATAGTGGAGG + Intergenic
1159555753 18:69942877-69942899 AGAGAGAAGACAGAGAGGGAAGG - Intronic
1159825299 18:73201671-73201693 AAAAAGAAGAAAGCTGGGAAAGG - Intronic
1160035477 18:75297746-75297768 ACAGAGAAGATAGAAGAGGAAGG + Intergenic
1160137563 18:76285576-76285598 AAAGAGAAGAAAGCTAGAGATGG + Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676569 19:394325-394347 ATGGAGAAGGATGATGGGAAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160825666 19:1079509-1079531 AAAAAAAAAAAAGATGGGGAGGG + Intronic
1161535119 19:4814385-4814407 ATAAATAAGAAAGATGCGGCTGG + Intergenic
1161779938 19:6285246-6285268 ATCGAAAAGAATAATGGGGAAGG + Intergenic
1161784710 19:6316958-6316980 AAAAAAAAAAAAGATGGGGAGGG - Intronic
1161829088 19:6589918-6589940 AGAGAGAAGACAGAGAGGGAGGG - Intronic
1161834797 19:6638560-6638582 ATGGAGAAGAAAGCGTGGGAGGG + Intergenic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162024225 19:7884593-7884615 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024245 19:7884638-7884660 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024264 19:7884683-7884705 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1162581624 19:11534808-11534830 AGAAAGAAGAAAGAAGGAGAAGG + Intergenic
1162829218 19:13274142-13274164 AGAGAGGAGAAAGAGGAGGAAGG + Intronic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1162938474 19:13993896-13993918 CTTGGGAAGAAAGACGGGGATGG + Intronic
1163001482 19:14370590-14370612 GTAAAGAAAAAAAATGGGGAAGG + Intergenic
1163174161 19:15552510-15552532 ATATAGCAGAGGGATGGGGATGG + Intergenic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164232819 19:23306096-23306118 ATACAGAACAAAGATGTAGAAGG + Intronic
1164260868 19:23567883-23567905 AGACAGAAGAAAGAGGGAGAGGG - Intronic
1164324770 19:24181446-24181468 ACAGAGGAGAAAAAGGGGGAGGG + Intergenic
1164462702 19:28462579-28462601 AGAGAGATGAAAGATGGGGTGGG + Intergenic
1164521024 19:28979934-28979956 ATAGATAAGAAAGGAGAGGAAGG - Intergenic
1164576919 19:29410584-29410606 AGAGTGTGGAAAGATGGGGAGGG + Intergenic
1164942900 19:32265421-32265443 AGAGAGAGGAAAGAGGGAGAAGG + Intergenic
1165220115 19:34309434-34309456 AAAAAGAAAAAAGATGGGGAAGG + Intronic
1165455672 19:35909238-35909260 ACAAAGATGAAAGATGGGGAAGG + Intergenic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166380267 19:42351910-42351932 ATGGAGAAAAAAGAGCGGGAGGG - Intronic
1166642894 19:44509772-44509794 ATGGAAAAGAAAGAAGGGAATGG + Intronic
1166707739 19:44917607-44917629 AGAGAAAAGAAAGACAGGGAGGG + Intronic
1167078116 19:47261225-47261247 AAAGGGAGGAGAGATGGGGACGG - Intronic
1167138770 19:47634722-47634744 AGAGAGAAGAGAGTTGAGGATGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167331184 19:48857363-48857385 ATAGAGAAGAAAGGAAGGGAGGG + Intronic
1167381378 19:49140139-49140161 ACAAAGAAGAAAGAAAGGGAGGG - Intronic
1167853318 19:52218222-52218244 ATAAAAAAGAAAGAAGGGGATGG - Intronic
1168169387 19:54575782-54575804 AGAGAGAAGAAGGATGGGTGAGG - Intronic
1168184268 19:54688145-54688167 ATGGAAAAGAAACATGGGGCAGG + Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
925182818 2:1827832-1827854 CTAGAGAGGACAGCTGGGGAGGG + Intronic
925204178 2:1992445-1992467 ATAGACAGGAAAGCAGGGGAGGG - Intronic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
926377016 2:12240697-12240719 AAAGAGAAGGAACATGGAGAAGG - Intergenic
926510413 2:13770064-13770086 AGAAAGAAGAAAGAAGGGGAAGG - Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
926965188 2:18402055-18402077 ATAGAAGAGACAGATGGGAAGGG - Intergenic
927369747 2:22340746-22340768 AAGGAGAAGAAAGTTGGGTAAGG - Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928081314 2:28315029-28315051 AGAGAGAAGAAAGAAAGGGAAGG + Intronic
928194603 2:29206190-29206212 AGAGAGAAGAAAGGGAGGGAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928371826 2:30745436-30745458 ATAGAGAAGATTGATGGAGATGG - Intronic
928413825 2:31074673-31074695 ATAGAGAAAAAAGAGAGAGAGGG + Intronic
928592796 2:32834631-32834653 GGAGAAAAGACAGATGGGGAGGG - Intergenic
928597757 2:32872336-32872358 TTAGAGGGGAGAGATGGGGAGGG + Intergenic
928633635 2:33219706-33219728 AAAAATAAGACAGATGGGGAAGG - Intronic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
929297055 2:40260159-40260181 AGAGAGAAAAAAGGAGGGGAGGG - Intronic
929465621 2:42141283-42141305 AAAGAAAAGAGAGATGGGAATGG + Intergenic
930029768 2:47051249-47051271 ATAAAAAAGAAATATGGGCATGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930707817 2:54521692-54521714 ATAGTGAAGAAGGGTTGGGAGGG + Intronic
930719771 2:54627809-54627831 ATAGAAGAAAAAGATGGTGAGGG - Intronic
930872264 2:56182395-56182417 ATAGGGAAGAGAGAGAGGGAGGG + Intergenic
931039843 2:58285144-58285166 ATAAATAAGAAATATGGGGGTGG - Intergenic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
932924317 2:75954305-75954327 GTAGAGAAGAGGGAAGGGGAGGG - Intergenic
933001773 2:76933903-76933925 ATATTGAAGTAAAATGGGGAAGG - Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933569374 2:83991595-83991617 AAAGAGAAAAAAGAGGGGGCTGG - Intergenic
933735555 2:85491169-85491191 ATTGAGAAGGAAGATTGAGAAGG - Intergenic
933764395 2:85697109-85697131 ATAGAGAAGACTGGTGGGGTGGG - Intronic
933769571 2:85734454-85734476 GGAGAGAAGAGAGAAGGGGAAGG + Intergenic
933885744 2:86718661-86718683 AGAGGGAAGAAAAATGGGGTGGG + Intronic
933924434 2:87078044-87078066 AGAGGGAAGAAAAATGGGGTGGG - Intergenic
934183654 2:89651280-89651302 ATAGTGAAGAAAGATGACGTAGG + Intergenic
934293941 2:91725451-91725473 ATAGTGAAGAAAGATGACGTAGG + Intergenic
934552764 2:95272268-95272290 ATTGAGAAGAGAGAGGGGGTGGG + Intergenic
934667363 2:96182227-96182249 AAAAAGAAGAAAGATTGGGCTGG + Intergenic
934881611 2:97986352-97986374 AGAGGGAAGAGAGATGAGGAAGG + Intronic
934927443 2:98391428-98391450 AAACAGCAGAAAGATGGAGAAGG + Intronic
934982283 2:98852937-98852959 AGAGAGAAGAAGGAAGGAGAGGG + Intronic
935096194 2:99946496-99946518 AAAAAAAAAAAAGATGGGGATGG + Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935674771 2:105585240-105585262 ATAGAAAATAAAGATGTGGTAGG + Intergenic
935732030 2:106072476-106072498 ATAGAGATGAAAGTTGGGAGAGG - Intronic
935871881 2:107459612-107459634 AGAGAAAAGGAAGATGGGTATGG + Intergenic
936037731 2:109126270-109126292 AGAGAGAAGAAAGCTGGGAAAGG + Intergenic
936488668 2:112949975-112949997 AAAAAGAAGATAGATGGGCATGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936998313 2:118438153-118438175 ATAGACAAGAAAGTGGGGAATGG - Intergenic
937360098 2:121223729-121223751 GTAGAGAAGAAAGAGGTAGAAGG + Exonic
937412309 2:121687214-121687236 AAAGAAAAGAAAGGTGAGGAGGG - Intergenic
937471577 2:122178351-122178373 ACTGAAAAGAAAGATGGTGAAGG - Intergenic
937704930 2:124909637-124909659 AGAAAGAAGAAAGAAAGGGAGGG - Intronic
937745664 2:125410196-125410218 AAAGTGAAGAAAGCTGGGGCGGG + Intergenic
937868203 2:126769570-126769592 ACAGAAAAGAAGGATGGGGCAGG - Intergenic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
939462302 2:142512882-142512904 ATGGAGAAGGAAGAAGGGTAGGG + Intergenic
939638626 2:144612551-144612573 GTAGAGAAGAGACTTGGGGATGG + Intergenic
939649796 2:144746306-144746328 AAAGAGAAGAAAGAGAGAGAAGG - Intergenic
940615123 2:156039738-156039760 ATAGAGAAAAAAGAAGGAAATGG + Intergenic
941048139 2:160699466-160699488 TTTGAAAAAAAAGATGGGGATGG + Intergenic
941180117 2:162249382-162249404 ATAGAGGTTAAAAATGGGGAAGG - Intergenic
941202095 2:162524719-162524741 AGAGAGAAGAAAAATGTGGTGGG + Intronic
941642031 2:167999091-167999113 ATTGGGAATAAGGATGGGGAGGG - Intronic
941681022 2:168399756-168399778 ATAGAGTGGCAAGATGGAGAAGG - Intergenic
942017763 2:171833708-171833730 GGAGAGAAGAAAGAAAGGGAAGG - Intronic
942052171 2:172149921-172149943 AGAGAGGAGAAAGAGAGGGATGG + Intergenic
942269726 2:174262151-174262173 AAAGAGAAGACAGCTGGGCATGG + Intergenic
942369149 2:175262797-175262819 ACAGAGAACAGAGATGGGGAAGG + Intergenic
942398292 2:175575297-175575319 AGAGAGAAAAAAGAGAGGGAGGG - Intergenic
943150513 2:184106852-184106874 ACAAAGAAGAAAGGTTGGGAAGG + Intergenic
943393210 2:187296829-187296851 ATCAAGCTGAAAGATGGGGATGG + Intergenic
943665281 2:190602621-190602643 GTAGAGTGGAAAGATGGGGAGGG - Intergenic
943757332 2:191570105-191570127 AAAGAGAAAAAAGAAAGGGAAGG - Intergenic
943943476 2:194028907-194028929 ATAGTGTAGGCAGATGGGGAGGG + Intergenic
944209068 2:197187690-197187712 AGAGAGAAGAAAGAGAGAGAGGG - Intronic
944634897 2:201666185-201666207 CTACAGAAGATAGATGGGGGTGG + Intronic
945282416 2:208048197-208048219 AAAAAGAAGAAAGAAGGGCAGGG - Intergenic
945431444 2:209770914-209770936 AGAAAGAAGAAAGAAGGAGAAGG + Intergenic
945657295 2:212640856-212640878 ATAGAGAAGATATATGGCAATGG + Intergenic
945791870 2:214315488-214315510 ATAAATAAAAAAGATGGGGCTGG - Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946001342 2:216485170-216485192 TAAGAGAAGAAAGAGTGGGAAGG + Intergenic
946316600 2:218919436-218919458 AAAGAAAAGAAGGAAGGGGAGGG - Intergenic
946764784 2:223030437-223030459 AGAGAGAGGAGAGATGGAGAGGG + Intergenic
946784128 2:223224654-223224676 ATAGATAAGAAAGAGGGGAGTGG + Intergenic
946806441 2:223475394-223475416 AAAGAAAAGAAAAATGGAGAAGG - Intergenic
947006068 2:225512794-225512816 AAAGAAAAGAAAGAGAGGGAGGG - Intronic
947060882 2:226163712-226163734 CTAGAGAGGAGAGATTGGGAGGG - Intergenic
947199341 2:227600512-227600534 ATAAATAAGAAAGTTGGGGCTGG + Intergenic
947224476 2:227826617-227826639 AGAGAGAAGAAAGGGAGGGAGGG - Intergenic
947292106 2:228587140-228587162 ATGGAGATGAAATATGGAGAAGG - Intergenic
947439999 2:230111172-230111194 ATAGATAACAGAGATTGGGAAGG + Intergenic
947586751 2:231361238-231361260 GTAGGGCAGAAAGATGGAGAAGG + Intronic
947770706 2:232668091-232668113 ACTGTGAAGAAAGAGGGGGAGGG - Intronic
948176023 2:235943669-235943691 ATCGAGAAGAAAGAAAGGCATGG + Intronic
948587005 2:239025956-239025978 AAAAAGAAAACAGATGGGGATGG - Intergenic
948761128 2:240191698-240191720 AGAAAGAAGGAAGAAGGGGAAGG - Intergenic
949069033 2:242012394-242012416 ATAAAAAAGAAAGATGGAAATGG - Intergenic
1168806743 20:676167-676189 AGAGAGAAGAAAGACAGAGATGG + Exonic
1168934672 20:1653941-1653963 AAAAAGAACAAAGATGGGGCCGG + Intronic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169089085 20:2846954-2846976 GTGGAGCAGAAAGATGGGGCTGG + Intronic
1169276238 20:4235444-4235466 AAAGAGGAGAAAGAAGGGGGAGG - Intronic
1170120970 20:12911337-12911359 ATGGGCCAGAAAGATGGGGAGGG - Intergenic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170249240 20:14262035-14262057 ATAGAGATGCAAGAAAGGGAAGG + Intronic
1170366175 20:15600495-15600517 ATAGAGAAAGAAGAAGGGGAGGG - Intronic
1170589790 20:17763167-17763189 ACAGAGATGAAAGACCGGGAAGG - Intergenic
1170712911 20:18808215-18808237 ATGGAGAAGTGAGATGGAGAAGG - Intergenic
1170957411 20:20993851-20993873 GGAGGGAAGAAGGATGGGGAGGG + Intergenic
1171088471 20:22261855-22261877 CTAGAGCAGAGAGAGGGGGAGGG - Intergenic
1171151857 20:22834654-22834676 AGAGAGAAGAAAGGGAGGGAAGG - Intergenic
1171781455 20:29422456-29422478 AGAAACAAGAAAGATGAGGAAGG + Intergenic
1171848077 20:30289955-30289977 ATAGAGAAGACAGTGGGGGGAGG + Intergenic
1171901819 20:30865462-30865484 AGAGAGGTGAAAGGTGGGGACGG + Intergenic
1172050074 20:32110320-32110342 CTAGGGATGAAAGATGGGGGTGG - Intronic
1172068674 20:32239990-32240012 ATAAAGAAGAAAGAGGAGAAAGG + Intergenic
1172228769 20:33323148-33323170 GAAGAGAAGAAAGAAGGGGCAGG + Intergenic
1172522765 20:35579025-35579047 GTAGAGGAGATAGATGGTGAAGG - Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173579263 20:44135440-44135462 AAAGAACCGAAAGATGGGGATGG - Intronic
1173647476 20:44642464-44642486 AGGGAGAAGAAAGAAGGAGAGGG + Intronic
1174333279 20:49838184-49838206 AGAGAGAACGAAGATGGGGGTGG + Intronic
1175379206 20:58551115-58551137 ATAGAGAAAAAAGAAAAGGAAGG - Intergenic
1175486937 20:59353506-59353528 AGATAGGAAAAAGATGGGGACGG + Intergenic
1175533805 20:59693280-59693302 GAAGAGAAGGGAGATGGGGACGG - Intronic
1175681627 20:60993555-60993577 TCAGAGAAGAAAGAAGGAGAAGG - Intergenic
1175921336 20:62451808-62451830 ATGGAGAAGAGAGAGGGAGAGGG + Intergenic
1175923245 20:62459611-62459633 AGAGAGGAGAGAGGTGGGGAGGG - Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177549776 21:22605519-22605541 GTAGAGAAAAGAGACGGGGAGGG + Intergenic
1177714446 21:24821175-24821197 AAAGAGAAGAAAAATGGATATGG - Intergenic
1177781845 21:25630356-25630378 ATAGAAAAGAAAGAGGGAGGAGG + Intergenic
1177879270 21:26672813-26672835 GTACAGAAGAGAGATGGGAATGG - Intergenic
1178047260 21:28709601-28709623 ATAGGGCAGAAGGATGGGAAAGG - Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178634721 21:34292112-34292134 ATAGAGCAAAAGGAAGGGGAAGG + Intergenic
1178818464 21:35952978-35953000 ATAGAAAAGAAAGATTGTGGAGG + Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179247030 21:39642894-39642916 AAAGAAAAGAAAGCTGGGCATGG + Intronic
1179886983 21:44318466-44318488 ACAGAGCAGCAAGATGGGCATGG + Exonic
1179944251 21:44660170-44660192 AAAGAGAAGAAAGAGAGGGCAGG + Intronic
1180374052 22:12074185-12074207 CCAGAGAAGAAAGATCTGGAGGG - Intergenic
1180763663 22:18228998-18229020 AAAGAGAACAATGAAGGGGAAGG + Intergenic
1180771981 22:18395545-18395567 AAAGAGAACAATGAAGGGGAAGG - Intergenic
1180803359 22:18645158-18645180 AAAGAGAACAATGAAGGGGAAGG - Intergenic
1180807460 22:18724799-18724821 AAAGAGAACAACGAAGGGGAAGG + Intergenic
1180865123 22:19114114-19114136 ATGGAGAGGAAAGGTGGGAATGG - Intronic
1181146867 22:20854750-20854772 AGAGGGAAGAGAGAAGGGGAGGG + Intronic
1181218357 22:21350104-21350126 AAAGAGAACAATGAAGGGGAAGG + Intergenic
1181710800 22:24686822-24686844 TTTGAAAAGAAAGATGGAGAGGG + Intergenic
1181741236 22:24923494-24923516 AGAGGGAGGAAAGATGGAGAAGG - Intronic
1181772486 22:25136140-25136162 TTAGAGGAGAAAGACAGGGAGGG + Intronic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1181927344 22:26370571-26370593 CTGGAGAAGAAAGAAAGGGATGG - Intronic
1181976863 22:26736557-26736579 ACAGGGAAGAAATAAGGGGAAGG - Intergenic
1182070757 22:27462141-27462163 ATAGAGGGGACAGATGGAGAGGG + Intergenic
1182119332 22:27776599-27776621 AGAGAGGAGAAAGAGGGAGAGGG - Intronic
1182234504 22:28864834-28864856 AGAAAGAAGAAAGATAGTGATGG + Intergenic
1182329777 22:29543039-29543061 AAAGGGAATAAAGAAGGGGATGG + Intronic
1182366254 22:29781372-29781394 AGAGAGTAGAAAGCTGGGCAGGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182647501 22:31822301-31822323 ATAGATAAGGGATATGGGGAGGG + Intronic
1182677786 22:32053367-32053389 AAAGAGAAGGAAGAAAGGGAAGG - Intronic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1182985447 22:34712073-34712095 ATTGGGAAGAAAGATGGACATGG - Intergenic
1183689731 22:39381939-39381961 AGAGAGGGGACAGATGGGGAGGG - Exonic
1183750785 22:39719246-39719268 ATAGGGAAGAGAGATGGAGTTGG - Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184605333 22:45570032-45570054 ACATAGAAGAAAAATGGGGCCGG + Intronic
1185071162 22:48657143-48657165 ATAGAGAAGAAGGAAAGTGAAGG + Intronic
1185102828 22:48850653-48850675 AAAGAGAAGAAAGAACGGGATGG - Intronic
1203233819 22_KI270731v1_random:136535-136557 AAAGAGAACAACGAAGGGGAAGG - Intergenic
949121385 3:388764-388786 TTATAGAAGAAAAATGGAGAAGG + Intronic
949148724 3:737880-737902 ATGGTGAAGAAAGGTGGGGCAGG + Intergenic
949577126 3:5349284-5349306 GTGGAGAAATAAGATGGGGATGG - Intergenic
949641684 3:6042872-6042894 TGAGGGGAGAAAGATGGGGAAGG - Intergenic
949646797 3:6105159-6105181 AAAGAAAAGAAAGAAAGGGAGGG - Intergenic
949858342 3:8482774-8482796 AGAGAGAGGAAAGAGAGGGATGG + Intergenic
949948721 3:9211646-9211668 AAAGAAAAGAAAGATGGGTCAGG - Intronic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950727240 3:14924347-14924369 AGAGAAAAGAAAGAGGAGGAGGG - Intronic
950750112 3:15121781-15121803 AAAAAGAAGGAAGGTGGGGAGGG + Intergenic
950962825 3:17123416-17123438 AGAGAGAGGACAGCTGGGGAGGG + Intergenic
950971408 3:17192218-17192240 ATAGAGAAGAAAAAAGTGAAAGG + Intronic
951055036 3:18137662-18137684 ATGCAGAAAAAATATGGGGAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951732155 3:25822259-25822281 GAAGAGAAGAAAGAAAGGGAGGG - Intergenic
951786595 3:26426812-26426834 AAAGAGTAGAAAGAGGGCGAAGG + Intergenic
951902258 3:27668384-27668406 TTAGAGAAGTAAGACAGGGAAGG + Intergenic
952132754 3:30384126-30384148 AAAGAGAGGAAAGAGTGGGAAGG - Intergenic
952256719 3:31701962-31701984 ATAGAGGGAAAAGATGGGGAAGG - Intronic
952273300 3:31853236-31853258 AGAGGGAAGAAAGATTGTGAAGG + Intronic
952720331 3:36525569-36525591 ATAGGGAATAAAGCTGGGGGAGG - Intronic
952904928 3:38133540-38133562 ATAGGGCAGAACCATGGGGAAGG - Intronic
953174988 3:40542760-40542782 ATAGAGAAGAAAGAAAAAGAAGG + Intronic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953625446 3:44567182-44567204 AGAGAAAAGAAAGAGAGGGAGGG + Intronic
954106872 3:48414254-48414276 CTGGAGAAGAAAGATAGGAAAGG - Intronic
954491389 3:50909916-50909938 ATAGAGAAGAAAGAATGAAAAGG - Intronic
955011004 3:55014217-55014239 ATAGTGAAGATTGATGGTGAAGG + Intronic
955038207 3:55289534-55289556 ATAGAGAAGAAAGTGGTTGAGGG - Intergenic
955613743 3:60784098-60784120 AGGATGAAGAAAGATGGGGAGGG - Intronic
955786057 3:62540215-62540237 ATAAAGCAGAGAGATAGGGAAGG - Intronic
956095207 3:65708803-65708825 AAAAAGAAGAAAGAAGGGAAGGG - Intronic
956251994 3:67244228-67244250 TTGGAGAAGAAAGATGTGCAAGG + Intergenic
956846519 3:73188762-73188784 AAAGAGAAGAAAAAAGGGGGAGG - Intergenic
956943228 3:74189023-74189045 AGAGAGGAGAGGGATGGGGAAGG - Intergenic
957157417 3:76562918-76562940 AAAGAAAAGAAAGAAAGGGAGGG - Intronic
957581898 3:82084960-82084982 AAAGGGGAGAAAGATGGGGCTGG - Intergenic
957794177 3:84981611-84981633 AAAGGAAAGAAAGATAGGGAAGG - Intronic
957794193 3:84981683-84981705 TTAAAGAAGAAAGAATGGGAAGG - Intronic
958717947 3:97809652-97809674 AAAGAAAAGAAAGAAGGGGAAGG + Intergenic
958731612 3:97966119-97966141 TTAGACAAGAAAGAAAGGGAAGG + Intronic
958825014 3:99019871-99019893 ATACAGAAGAAATATGGGAAAGG + Intergenic
958862544 3:99462475-99462497 ATAGAGAATAAATAGGAGGATGG + Intergenic
958907299 3:99956222-99956244 ACAAAGAAGAAAGGTGAGGAAGG - Intronic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959418222 3:106103237-106103259 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
959460551 3:106620748-106620770 ATAGAGAAGAAAGAGAAGGAAGG + Intergenic
959503776 3:107135934-107135956 TAAGAGAAAAAAGAAGGGGAGGG + Intergenic
959925420 3:111915845-111915867 ATAGGGAAGAAAGTAGGGGCAGG + Intronic
960121083 3:113948650-113948672 AATGAGAAGAGAGAGGGGGAGGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960803727 3:121563187-121563209 ATAGAGGAGAAAGGGAGGGAAGG + Intergenic
961065206 3:123869530-123869552 TCAGAGCTGAAAGATGGGGAGGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961345316 3:126260210-126260232 GTAGAGAGGGAAGAGGGGGAGGG - Intergenic
961345446 3:126260655-126260677 GTGGAGAGGAAAGAGGGGGAGGG - Intergenic
961663863 3:128484461-128484483 TTAGAGCAGAAAGACGGGGTGGG - Intronic
963275600 3:143326635-143326657 TTAGAGAAGGTAGTTGGGGAAGG - Intronic
963326178 3:143865875-143865897 ACAGGGAAGAAAGATGAGAATGG - Intergenic
963423756 3:145096437-145096459 ATAGAGAGAAAAGAATGGGAGGG - Intergenic
963603846 3:147397897-147397919 ATAGAGGAAAGAGAGGGGGAGGG - Intronic
963627418 3:147690692-147690714 AGAGAGAAGAAAGAAAGGGAAGG - Intergenic
963956276 3:151257920-151257942 CTAGAGAGGGAAGGTGGGGAAGG - Intronic
964159584 3:153630878-153630900 ATAGAGAAGGATGATTGGGGTGG + Intergenic
964280233 3:155056038-155056060 ACAGAGAAGAAAAATTGGGTGGG - Intronic
965374141 3:167900942-167900964 AGAGAGAAGAAAGAGAGAGAGGG + Intergenic
965380679 3:167983603-167983625 AAGGAGAAGAAAGAGTGGGAAGG + Intergenic
965631805 3:170740823-170740845 ATACAAAGGAAAGAAGGGGAAGG + Intronic
965647565 3:170899825-170899847 ATAGAGTTGGAAGGTGGGGATGG + Intronic
966336324 3:178872180-178872202 AAAGAAAAGAAAGCTGGGCATGG + Intergenic
967165742 3:186778140-186778162 ATAAAGATGAAAGATGAGGCCGG + Intergenic
967274056 3:187756601-187756623 GGAGAGAAGAGAGAAGGGGAGGG + Intergenic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967334328 3:188325495-188325517 TGACAGAAGAATGATGGGGAGGG - Intronic
967356486 3:188577818-188577840 AGAAAGAAGAAGGAAGGGGAGGG - Intronic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967421004 3:189272771-189272793 GTAGAAAAGAAAGAGAGGGAAGG - Intronic
967511998 3:190322878-190322900 AGAGAGAGGAAAGAAGGGGGAGG - Intronic
969345929 4:6570007-6570029 AGAGAGACGAAAGAAAGGGAGGG + Intergenic
969367674 4:6708156-6708178 AAAGAGAAGACAGTTGGAGATGG - Exonic
969836045 4:9842630-9842652 AAAGAACAGAAAGATGGGGAAGG + Intronic
970310990 4:14782343-14782365 ATAGATAAGATAGATAAGGATGG + Intergenic
970656901 4:18241354-18241376 AGAGAGAAGAAAGCTGGCAAGGG - Intergenic
970676938 4:18461932-18461954 AGAGAGAAGAAAAATGGAGGAGG + Intergenic
971072461 4:23110534-23110556 GTGGAGAAGAAATATGGGTAGGG - Intergenic
971174271 4:24265858-24265880 AGAGAGAAGGAAGAAAGGGAGGG + Intergenic
971234549 4:24829422-24829444 ATGGAGAAAAAAGATGGAGTGGG + Intronic
971435117 4:26613128-26613150 ATAAAAAAGAAAGATAAGGAAGG - Intronic
971497311 4:27280574-27280596 TTTGAGAAGAAAGATAGGTAGGG - Intergenic
972378059 4:38491800-38491822 AAAGAGAATAAAGTTAGGGAGGG + Intergenic
972418182 4:38862973-38862995 ATAGAGGAGCAAGGAGGGGAAGG - Intergenic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
972873896 4:43334164-43334186 ATACAGAAGAAAGCTAGTGAAGG - Intergenic
973153601 4:46919661-46919683 CAAGAGAAGAAAGAAGGGAATGG + Exonic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
973968361 4:56186509-56186531 AAATAGCAGAGAGATGGGGATGG + Intronic
974385671 4:61200606-61200628 AAAGAGAAGAAAGAAAGGGGAGG - Intergenic
974741327 4:66012101-66012123 ATAGAGAAAAAAGAAGGAAAAGG - Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974778168 4:66515416-66515438 AAAGAGAAGAGAGAGGGAGAGGG + Intergenic
975277928 4:72524215-72524237 AAAGAGAAGAATTATGGGAAGGG + Intronic
975599012 4:76079790-76079812 GGAGAGAAGAGAGATGGGAAAGG + Intronic
975698702 4:77040952-77040974 ATAGTGTAGAATGAAGGGGATGG - Intergenic
975851883 4:78580954-78580976 ATATGGAAGAAAGATGGAGGTGG + Intronic
976222650 4:82770338-82770360 AAAGAGAAGGGAGATGGGAAAGG - Intronic
976336634 4:83895454-83895476 ATGAAAAAGAAAGATGGGGGAGG - Intergenic
976777192 4:88719621-88719643 AAGGAGAAGAAAGAAGGAGAAGG - Intergenic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
977739918 4:100466997-100467019 ATAGCTAAGAAAGATGTGGAGGG + Intronic
977789711 4:101085177-101085199 AAAAAGAAAAAAGATAGGGAAGG - Intronic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
978013673 4:103719090-103719112 ACAGAGAGGAAAGAGGGAGAAGG - Intronic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978575080 4:110181705-110181727 TGAGAGAAGAAAGATGGAGAAGG - Intronic
978839198 4:113189714-113189736 ATTGAGAAGAAAGAGGTGGCAGG - Intronic
978852708 4:113357412-113357434 CTAGAGAAAAAAGATTGGGAAGG - Exonic
979293791 4:119007114-119007136 AGAGAGAAGAGAGAAAGGGAAGG - Intronic
979491470 4:121332869-121332891 ATAAAGAAAAGAGTTGGGGATGG - Exonic
979628378 4:122872318-122872340 CTAGAGAAGAAAGAATGTGAAGG + Intronic
980038690 4:127914290-127914312 AGAGAGATAAAATATGGGGAGGG - Intergenic
980086470 4:128395629-128395651 AAAGAGAAGAGAGATGGGGGTGG - Intergenic
980196495 4:129596035-129596057 ATAAAGAAGGAAGAAAGGGAGGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980753242 4:137120286-137120308 GGAGAGTAGAAGGATGGGGAGGG + Intergenic
981042945 4:140239687-140239709 CTAGAGAAGGAATATGGAGAAGG + Intergenic
981092130 4:140742845-140742867 AGAGAGAAGAAAGAAGGTGCAGG + Intronic
981318557 4:143365346-143365368 ATAGGGAAGAAAGATACTGAAGG - Intronic
981903458 4:149892881-149892903 TGAGAAAAGAAAGATTGGGATGG - Intergenic
982208623 4:153017376-153017398 ACAGAGAACAAAGAAGGAGAGGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
983311699 4:166072383-166072405 AAAGAAAAGAAAGAAGAGGAAGG - Intronic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983397842 4:167224959-167224981 ATAGAAAAGAAAGTTTTGGATGG - Intronic
984233144 4:177124245-177124267 ATGGAGAGGAAAGAGAGGGAGGG - Intergenic
984708368 4:182864121-182864143 ATAGAGAAGACTGTTGTGGAAGG - Intergenic
985117251 4:186604703-186604725 GAAGAGAAGAAAGGTGGAGACGG + Intronic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985447457 4:190032799-190032821 AGAAACAAGAAAGATGGGGGAGG + Intergenic
985505530 5:278081-278103 AAAGAGGACAAAGGTGGGGAAGG - Intronic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
986068742 5:4261734-4261756 ATAGAGTAGAAAGAGGGAGCTGG + Intergenic
986558070 5:9031676-9031698 ATGGAGAAGGAAGTTGGGGCAGG - Intergenic
986773798 5:10995964-10995986 AGAGAGAAGAGAGAAAGGGAAGG + Intronic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987454016 5:18120648-18120670 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
987760880 5:22161706-22161728 AGAAGGAAAAAAGATGGGGAAGG + Intronic
988089625 5:26519781-26519803 GTAGAGAAGAAAGAAGGAGAAGG + Intergenic
988224990 5:28402215-28402237 AGAGAGAGAAAAGATGGGGCAGG - Intergenic
988359555 5:30218166-30218188 ATATAAAAGTAAGAAGGGGATGG - Intergenic
988464949 5:31480859-31480881 GGAGAGAAGGAAGATGGGAAAGG + Intronic
989113715 5:37931396-37931418 TTAGGGAAGAGAGAAGGGGAGGG - Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989306545 5:39964083-39964105 ATAGAAGAGAGAGATGTGGATGG + Intergenic
989502135 5:42179870-42179892 GTAGAGAGGAAAGAGGGGCATGG + Intergenic
989604991 5:43235835-43235857 AAAAAAAAAAAAGATGGGGAGGG - Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990109996 5:52310824-52310846 ATAGAGAGGAGAGAGAGGGAGGG - Intergenic
990153236 5:52844524-52844546 AAGGAGAAGAAAGCTTGGGAAGG - Intronic
990231944 5:53722160-53722182 ATAAAACAGACAGATGGGGAGGG + Intergenic
990563775 5:57008784-57008806 ATAGAGAAGTTAGCTGGGCATGG + Intergenic
990611605 5:57462705-57462727 AGAGGGAACAGAGATGGGGAAGG + Intergenic
991364433 5:65853627-65853649 ACAGAGAAGAAAGAGAGAGAAGG - Intronic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
991895658 5:71395168-71395190 AGAAGGAAAAAAGATGGGGAAGG + Intergenic
992380324 5:76229781-76229803 AGAAAGAAGAGTGATGGGGAGGG + Intronic
992507375 5:77400511-77400533 AAAGAAAAACAAGATGGGGAGGG - Intronic
992507861 5:77405890-77405912 ATAGAAAAGAGAGATGAGGCTGG + Intronic
992537390 5:77721749-77721771 TTAGACAAGAAAGATTTGGAGGG - Intronic
992705467 5:79387006-79387028 AGAAAGAAGGAAGAGGGGGAAGG - Intronic
993094385 5:83464739-83464761 AAAGACAAGAAGGATGGGAAGGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993942561 5:94077722-94077744 ATAGAGAATAAAGCGGTGGAAGG + Intronic
994790401 5:104218425-104218447 AGAGAGGGGAAAGAAGGGGAGGG - Intergenic
994930466 5:106176480-106176502 AAAGAGAAGCAAGATTGGCACGG - Intergenic
995076038 5:107983887-107983909 AGTGAGAACAAAGGTGGGGAGGG + Intronic
995119061 5:108516613-108516635 AGAAAGAAAAGAGATGGGGATGG - Intergenic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
995407336 5:111813708-111813730 ATAGAAAACAGAGAAGGGGAAGG + Intronic
995941737 5:117594044-117594066 AGAGAGAAGAGAGAAGGAGATGG + Intergenic
996017666 5:118558349-118558371 GTAAAGAAGAAAGAGGGGAAAGG + Intergenic
996261371 5:121473749-121473771 GTAGAGAAGAAAGCTGGTCATGG + Intergenic
996314549 5:122147266-122147288 ATAAACAAGAAAGATGGAGTTGG - Intronic
996437050 5:123445978-123446000 AGAGAAAAGAAAAAAGGGGAGGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997478543 5:134164435-134164457 ATGGAGAATAAAGAAGGGAATGG - Intronic
997995003 5:138578218-138578240 AGAGAAAAGAAAGATGCGGCCGG + Intergenic
998495818 5:142588463-142588485 AGAGAGAAGAGGGAGGGGGAGGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
999014377 5:148083920-148083942 ATAAAGAATAAAGATGGGATAGG - Intronic
999149502 5:149417363-149417385 AGGAGGAAGAAAGATGGGGAGGG - Intergenic
999286046 5:150394992-150395014 ATGGAGAGGGAAGCTGGGGAGGG - Intronic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
999784352 5:154878206-154878228 AAAGAAAAGAAAGGAGGGGAGGG - Intergenic
999917405 5:156278011-156278033 ATATAAAAGAAAAAAGGGGAGGG + Intronic
1000126958 5:158254845-158254867 AGAGAGAAGAAAGATGGAGAAGG + Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000892901 5:166820043-166820065 AGAGAGAAGAATGATAGGGAAGG - Intergenic
1001098267 5:168793236-168793258 AAAGAAAAGAAAAAAGGGGAGGG - Intronic
1001108406 5:168875303-168875325 AGAAAGAAGAAAGAGGAGGAAGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001446745 5:171791029-171791051 AGAGAGCACAAAGGTGGGGAGGG + Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001730329 5:173949324-173949346 AGAGAGAAGAAAGAGGGTGAAGG + Intronic
1001826018 5:174745664-174745686 AAAGAGAAGAGAGCAGGGGAGGG - Intergenic
1002342136 5:178524209-178524231 ACAGAGCTGACAGATGGGGAAGG - Intronic
1002430724 5:179202418-179202440 ATGGAGAAGGAAGAAGGGTAGGG - Intronic
1002482709 5:179513897-179513919 AGAGAGTAAAAAGATGGGGCCGG - Intergenic
1002560399 5:180077960-180077982 AAAAATAAGAAAGAGGGGGAGGG - Intergenic
1002583169 5:180222804-180222826 ATAGAAGCGAAATATGGGGAAGG + Intergenic
1002711569 5:181198173-181198195 AAAGAGGAGAAAGGTAGGGATGG - Exonic
1002791010 6:437520-437542 CTAGAGAAGGATGATGGTGATGG - Intergenic
1002899507 6:1399256-1399278 ACGGAGAAGAAAGAGAGGGAGGG + Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003491750 6:6628292-6628314 GGAGAGAAGGAAGAAGGGGAGGG - Intronic
1003861522 6:10326597-10326619 ATAGAAAAGTCAGATGGGGCCGG + Intergenic
1003984645 6:11423652-11423674 CTTGTGAAGAAAGAGGGGGAGGG + Intergenic
1004183465 6:13400780-13400802 CTAGAGAGTAAAGATGGTGAGGG + Intronic
1004627175 6:17387960-17387982 ATTGAGAAGAAATATGGTAATGG - Intergenic
1004761429 6:18670869-18670891 GAAGAGAAGAGAGAAGGGGAGGG - Intergenic
1005211221 6:23466376-23466398 TTATAGATGAAAGATAGGGAAGG - Intergenic
1005228491 6:23671555-23671577 ATTGAGAAGAAAAGTGGGGTTGG - Intergenic
1005319847 6:24642242-24642264 AAAGAAAAGAAAGAAAGGGAAGG + Intronic
1005325048 6:24691984-24692006 ATTGAGACTAAACATGGGGATGG + Intronic
1005358421 6:25007678-25007700 ACCGAGAAGGAAGATGGGGAGGG - Intronic
1005401458 6:25438667-25438689 ATGAAGAACAAAGATGGGAAGGG + Intronic
1005413107 6:25571859-25571881 ATGAAAAAGAAAGGTGGGGATGG + Intronic
1005580086 6:27225570-27225592 AGAGAGAAGAAAGAGAAGGAAGG - Intergenic
1005673333 6:28129054-28129076 CTGGAGAACAGAGATGGGGAGGG - Intronic
1005845435 6:29773340-29773362 ATAGAAAAGAAAGAGAGGGAGGG - Intergenic
1005850768 6:29819058-29819080 ATAGAGAAGAAAGAGAGGGAGGG - Intergenic
1005857649 6:29874783-29874805 ATAGAGAAGAAAGAGAGAGAGGG - Intergenic
1005865807 6:29935139-29935161 ATAGAGAAGAAAGAGATGGAGGG - Intergenic
1005904080 6:30245510-30245532 AAAGAAAAGAAAGAGGGGGGCGG - Intergenic
1006277587 6:33018046-33018068 GTAAAGAAGAAAGATGAGGGTGG - Intergenic
1006290092 6:33128204-33128226 CTATAGAAGAAAAATGGGGTCGG - Intergenic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006949322 6:37808582-37808604 ACAGAGAACACAGCTGGGGATGG - Intergenic
1007274147 6:40661212-40661234 GTGGAGGAGACAGATGGGGACGG - Intergenic
1007315124 6:40981609-40981631 AAAGAAAAGAAAGAGGGGAATGG + Intergenic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007568664 6:42873182-42873204 ATAGACAAGAAAGCTGGGGTAGG - Intergenic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007821484 6:44563633-44563655 AGAGGAAAGAAAGAAGGGGAGGG - Intergenic
1007873563 6:45068470-45068492 ATAAAAAAAAAAGATAGGGATGG + Intronic
1007995592 6:46304604-46304626 TAAGAGAGGAAAGATGTGGAGGG + Intronic
1008093930 6:47319500-47319522 TTAGAGAAGAAACATTGGGTTGG + Intergenic
1008931516 6:56945347-56945369 AAAGAGAAGACAGATGGGACAGG + Intronic
1008979902 6:57471243-57471265 ATAGAGGAGAGAGATGGCTAAGG + Intronic
1009168006 6:60364165-60364187 ATAGAGGAGAGAGATGGCTAAGG + Intergenic
1009309834 6:62135884-62135906 ACAGAGTAGAAAGGTGGGGTGGG + Intronic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1009869561 6:69436393-69436415 ATAGAGTAGACAAATGGAGAGGG - Intergenic
1010343273 6:74781858-74781880 AAGGAGAAGAAAGAATGGGAAGG + Intergenic
1010526749 6:76909396-76909418 ATGCAGAAGAAAGCTGGGTAGGG + Intergenic
1010599399 6:77804598-77804620 AAAGAAAAAAGAGATGGGGAGGG - Intronic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1010917084 6:81633333-81633355 ATAGAAAAGAAAGAAAAGGAAGG + Intronic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011152502 6:84289948-84289970 GTAGAAAGGAAATATGGGGAGGG - Intergenic
1011231293 6:85165033-85165055 CGAGAAAAGAAAGGTGGGGAAGG + Intergenic
1011414921 6:87108280-87108302 ATAGAGAAGAAAGGGGGTAAAGG + Intergenic
1011417443 6:87137322-87137344 AAAGAGGAGAAAGAGGGGGAAGG - Intergenic
1011781878 6:90798696-90798718 AAAGAGAAGAAAGAATGAGAGGG - Intergenic
1011994162 6:93564477-93564499 AAAGAAAAGAAAAATTGGGAGGG + Intergenic
1012000501 6:93648324-93648346 GTTGAGAAGAAAGAGGTGGAAGG - Intergenic
1012232523 6:96777209-96777231 AAGGAGAAGAAAGAGGGAGAGGG - Intergenic
1013235379 6:108193961-108193983 AAAGAAAAGAAAGATGGGAAGGG + Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013360852 6:109392665-109392687 ACAGGAAAGGAAGATGGGGAGGG + Intronic
1013415730 6:109922740-109922762 TGAGAGAAGAATGGTGGGGAGGG + Intergenic
1013431333 6:110057898-110057920 AAAGAGTGTAAAGATGGGGAGGG - Intergenic
1013851456 6:114520946-114520968 ATAGAGAATATTGATAGGGATGG - Intergenic
1013993000 6:116276477-116276499 AAAGAGAAGAAAGCAGGGCACGG - Intronic
1014186895 6:118445244-118445266 AAAGGGAAGAAAGAGTGGGAAGG - Intergenic
1014552835 6:122808664-122808686 ATAAATAAGAAAGAAGGAGAGGG - Intronic
1014692483 6:124578494-124578516 AAAGAGAGGAAAGAGTGGGAAGG + Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1014875729 6:126656288-126656310 ATAGAGAACAGAGACTGGGAAGG + Intergenic
1014949306 6:127536721-127536743 AGAGAGAAGACAGACAGGGAGGG + Intronic
1015184777 6:130402929-130402951 ATAAAGAAAAGAGATGGAGATGG - Intronic
1015246991 6:131086031-131086053 ATAGAGAAAAAAGAATGAGAAGG + Intergenic
1015569803 6:134609188-134609210 ATTGAGAAGAATGGTGGTGAAGG - Intergenic
1015659504 6:135559394-135559416 CTAGAGATGGAAGATGGTGATGG + Intergenic
1015861803 6:137689264-137689286 AGAGAGAATCAAGATGGAGAAGG - Intergenic
1015931062 6:138360198-138360220 AGAGAAAAGAGAGATTGGGAGGG + Intergenic
1015973550 6:138767045-138767067 AAGGAGAAGAAAGAGAGGGAAGG - Intronic
1016161325 6:140884013-140884035 AAAGAGGAGAGAGAAGGGGAAGG - Intergenic
1016229853 6:141789341-141789363 AAAGGGAAGATAGATTGGGAAGG + Intergenic
1016825806 6:148387482-148387504 AGAGAGAAGAGAGAAGGGAAGGG - Intronic
1016914449 6:149232111-149232133 AAAGAGAAGAATGATTGGGGAGG + Intronic
1016954611 6:149614387-149614409 AAAGAGAAAAATGAAGGGGATGG - Intronic
1017863563 6:158422583-158422605 ATAGACAAGAAGGAAGCGGAAGG + Intronic
1017930013 6:158943836-158943858 AGAGGGAAGAAAGAAAGGGAAGG - Intergenic
1017944861 6:159087735-159087757 AGAGAGAACAGAGATGGGAAGGG + Intergenic
1018000786 6:159576774-159576796 AGAAAGAAGAGAGATGGGAAAGG + Intergenic
1018627632 6:165795211-165795233 GTAGAGAAGAGAGAAAGGGAAGG - Intronic
1018702489 6:166437894-166437916 AGAGACAAGAAAGACAGGGAAGG - Intronic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1019449693 7:1090999-1091021 ATGGAGAAGTAAGATAGGAAGGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019551887 7:1607138-1607160 AGAGAGAGGAAAGATGGGGTGGG - Intergenic
1019702650 7:2481445-2481467 GTAAAGAACCAAGATGGGGATGG + Intergenic
1019964129 7:4484906-4484928 ATAGACAGGAGAGAGGGGGAAGG + Intergenic
1020181966 7:5929627-5929649 CTAGACAAGAAAGATAGAGAGGG - Intronic
1020300968 7:6795309-6795331 CTAGACAAGAAAGATAGAGAGGG + Intronic
1020380667 7:7542051-7542073 ATAAAGAAAGAAGATGGGGCTGG + Intergenic
1020477300 7:8612138-8612160 AGAGAAAGGAAAGAAGGGGAAGG - Intronic
1020561292 7:9730767-9730789 AATGAGAAGAAAGCTGGAGATGG + Intergenic
1020673163 7:11145012-11145034 ATGGAGATGAATGATGGTGATGG + Intronic
1021191947 7:17631039-17631061 AGAGAGATGAAAGATGTTGAAGG - Intergenic
1021353000 7:19617878-19617900 AGAGAGAAGAAAGGGAGGGAAGG - Intergenic
1021468145 7:20969166-20969188 ACAAAGAAGAAAGAAAGGGAGGG + Intergenic
1021723511 7:23528587-23528609 AAATAGAAGAAATAGGGGGAGGG - Intronic
1022278727 7:28883279-28883301 AGGGAGAAGAAAGAAAGGGAGGG - Intergenic
1023085062 7:36562229-36562251 AAAGACAATAGAGATGGGGAAGG - Intronic
1023328413 7:39085767-39085789 AGAGAGAAGAGAGAGGGAGAGGG + Intronic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1023640457 7:42251591-42251613 AGAGAGAAGAAAGAGGGAGAGGG + Intergenic
1023708067 7:42963357-42963379 ATCAAGAAGAAAGCTGGGAATGG - Intergenic
1023784208 7:43689998-43690020 ATAGAAAACAAAGATGAAGATGG + Intronic
1023936185 7:44741386-44741408 ATAGAGAACAAAAAGGGGGTGGG + Intergenic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG + Intergenic
1024867172 7:53917008-53917030 GTAGAGAAGAATAATGGTGATGG + Intergenic
1024891015 7:54203729-54203751 ACTGTGAATAAAGATGGGGAGGG - Intergenic
1025039128 7:55624346-55624368 ATAAAGAAGCAAGATGTGGCTGG - Intergenic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026063650 7:67049221-67049243 ATAGAGAAGAAATATGTTGAAGG - Intronic
1026101275 7:67386445-67386467 ATAGAAAGGAAACAAGGGGAGGG + Intergenic
1026385261 7:69840654-69840676 ATAGTGATGAGAGATGGGGTGGG + Intronic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026598430 7:71753294-71753316 AAAGAGAAAGAAGCTGGGGATGG - Intergenic
1026674573 7:72418111-72418133 CTAGAGAGGGAAGAGGGGGAGGG - Intronic
1026680388 7:72462338-72462360 ATAGAGAAATAAGCTGGGCATGG - Intergenic
1026714696 7:72778238-72778260 ACAGAGAAGAAATATGTTGAAGG + Intronic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1027234202 7:76288111-76288133 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027534589 7:79381250-79381272 ATAGAGAAGAAAGATTATAAAGG - Intronic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027591478 7:80124639-80124661 AAAGAGAAGAGAGATCTGGAGGG + Intergenic
1027893876 7:84015334-84015356 AAAGAAAAGAAAAATGGTGAGGG + Intronic
1028055823 7:86241321-86241343 AGAGAGAAAAAAGAAGGAGAAGG + Intergenic
1028193695 7:87880200-87880222 AGATAGAAGAAAGAAGGTGACGG - Intronic
1028219137 7:88174794-88174816 AGAGAGAAAAGAAATGGGGAAGG - Intronic
1028342054 7:89733963-89733985 TTAGAGAAGAATGAAGGGAAAGG - Intergenic
1028377736 7:90164321-90164343 AAAGAGTAGAAAGATGTGAATGG + Intronic
1028414310 7:90563966-90563988 CCACAGAAGAATGATGGGGAAGG - Intronic
1028417326 7:90595189-90595211 AGAGAGAAGGAAGGTGGGGGAGG - Intronic
1028898425 7:96067954-96067976 TTAGAGCAGAAAGGTGGGGTGGG - Intronic
1028975706 7:96911235-96911257 CTTAAGAAGAAAGATGGTGAGGG - Intergenic
1028977677 7:96932311-96932333 AGAGACAAGAAAGATGGGCCAGG + Intergenic
1029189541 7:98761944-98761966 AAAAAAAAAAAAGATGGGGAGGG + Intergenic
1029276710 7:99409390-99409412 ATCGAGAAGAAAGATGTGCCGGG - Intronic
1029625795 7:101719363-101719385 AGAGGGAGGACAGATGGGGAGGG + Intergenic
1030380259 7:108803248-108803270 TAAGGGAAGAAAGAAGGGGAAGG - Intergenic
1030952706 7:115811782-115811804 ATAAATAATCAAGATGGGGAGGG + Intergenic
1031102818 7:117503277-117503299 AGAGAAAAGAAAGATGCTGAGGG + Intronic
1031134855 7:117873406-117873428 CTAGAGCAGGAAGATGGCGACGG - Exonic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1032003549 7:128282316-128282338 ATAGAGAAGGGAGAGAGGGAGGG + Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032275833 7:130454445-130454467 AGAGAGAAGGAAGATGGGGTTGG + Intergenic
1032655230 7:133921257-133921279 ATAGAACAGAAAGGTGGAGATGG - Intronic
1032799041 7:135303395-135303417 ACAAAGAAGGAAGAGGGGGAAGG + Intergenic
1033200212 7:139361610-139361632 GTAGAGAGGAAAGATTGGGAAGG + Intronic
1033253834 7:139781984-139782006 AGATAGTAGAAGGATGGGGAGGG + Intronic
1033784364 7:144712913-144712935 GTAGGGAAGAAAGGGGGGGATGG + Intronic
1033937696 7:146607776-146607798 TTTAAGAAGAAAGATGGTGAAGG - Intronic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034031591 7:147772658-147772680 ATGGAGAAGAAAGAAGGCAATGG - Intronic
1034080129 7:148268953-148268975 ACAGAGAGGAAAGATTGGGCAGG + Intronic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1034621662 7:152461849-152461871 AGAGAGAAGAGGGAAGGGGAGGG + Intergenic
1034961188 7:155365599-155365621 ATAGATAAGAGAGAGGCGGAAGG - Intronic
1035332593 7:158106008-158106030 AAACAGAAGAGAGATGGGGATGG - Intronic
1035333042 7:158108529-158108551 ATGGACAGGAAAGATGTGGAGGG - Intronic
1035380798 7:158439480-158439502 AGAGAGAAGAAAGGAGGAGAAGG + Intronic
1035560162 8:598295-598317 ATAAAGAAAGAAGATGGGGGTGG + Intergenic
1035797858 8:2375931-2375953 ATAGAGAGGTCAGAGGGGGATGG + Intergenic
1035856365 8:2980451-2980473 AAAGAGAAGGAAGAGAGGGATGG - Intronic
1035856926 8:2985899-2985921 ATCGAAAAGAAAGAAGGGAAGGG + Intronic
1036441918 8:8789251-8789273 ATAGGGAAGAAAGCAGAGGAAGG + Intronic
1036725742 8:11219082-11219104 GTAGAGATGAAAGATGGGTAGGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037656199 8:20886189-20886211 AAAGGGAGGAAAGAAGGGGAAGG + Intergenic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1037868601 8:22469314-22469336 ATAGATAAGAGAGACTGGGAAGG + Intronic
1037911887 8:22748555-22748577 GTACAGAAGAATGCTGGGGAGGG - Intronic
1038497412 8:28013361-28013383 ATGGGGAAGAGAGAGGGGGAGGG + Intergenic
1038567001 8:28627994-28628016 CTAGAGAAGGATGATGGTGATGG + Intronic
1038854189 8:31313502-31313524 ATTTAAGAGAAAGATGGGGATGG + Intergenic
1038945554 8:32355634-32355656 ATAAAGAAAAAAGACAGGGATGG + Intronic
1039174826 8:34791957-34791979 ATAAAAAATAAAGATGGGGAAGG + Intergenic
1039231176 8:35449953-35449975 ATAAAGAAGATAAATGGGAATGG - Intronic
1039435031 8:37554078-37554100 ACAGAGAAGAAAGAGGATGATGG - Intergenic
1039560422 8:38508027-38508049 AAAGAAAAGAAAGAAAGGGAAGG - Intergenic
1039712194 8:40067248-40067270 ATGAAGAAGAGAGAAGGGGAAGG - Intergenic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040065002 8:43138557-43138579 AAAGAAAAGAAACAAGGGGAGGG - Intergenic
1040540461 8:48348899-48348921 ATAGAGAAAAAAGAATGGAAAGG + Intergenic
1040549807 8:48429233-48429255 GGAAGGAAGAAAGATGGGGAGGG + Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1040918545 8:52589811-52589833 AGAGAGAAGAGAGATGGAGAAGG - Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041242915 8:55863645-55863667 AAAGAGAAGAGGGAAGGGGAGGG + Intergenic
1041354779 8:56988913-56988935 GTAGAGAAGATAGATGTAGAAGG - Intronic
1041392412 8:57358781-57358803 CCAGAGAAGAAAGAGAGGGAAGG - Intergenic
1041456253 8:58064042-58064064 AGGAAGAAGAGAGATGGGGAAGG + Intronic
1041541736 8:58992505-58992527 ATACAGAAGAAAGAAGGAGTTGG - Intronic
1041623797 8:60001947-60001969 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1041740494 8:61152006-61152028 ATAGAAAAGAAAGCTGGGGGCGG - Intronic
1041907911 8:63053817-63053839 ATAGAGAAGAAAGAAATGGTAGG + Intronic
1042356706 8:67836465-67836487 AGAGAGAAAAAAGGAGGGGAGGG - Intergenic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042460544 8:69060388-69060410 AGAGAGAGGAAAGAGGGAGAAGG - Intergenic
1042528002 8:69785008-69785030 AAAGAAAAGAAAGAAAGGGAAGG + Intronic
1042658694 8:71130499-71130521 AGAGATAAAAGAGATGGGGAGGG + Intergenic
1042681599 8:71391896-71391918 AGAAAGGAGAAAGTTGGGGAAGG - Intergenic
1042778675 8:72465890-72465912 ATACAGAAGAGAGCAGGGGAAGG - Intergenic
1042932225 8:74024980-74025002 ATATAAAAGAAAGATGGGTGTGG - Intronic
1043509039 8:80931735-80931757 ATAGGGAAGGAAGATTGGGAAGG - Intergenic
1043702176 8:83302448-83302470 AGAGAGAAGAAAGGTGGGAGTGG - Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043919675 8:85966611-85966633 AGAGATAAGAAGGATTGGGATGG + Intergenic
1044299996 8:90572785-90572807 ATAGAGAAGGAAGGAAGGGAGGG + Intergenic
1044379123 8:91512562-91512584 ATAAAGGAGAGAGATGGGGGTGG - Intergenic
1044458690 8:92419055-92419077 ATGGAGAAGAAAGAAAGGGAAGG + Intergenic
1044751091 8:95416030-95416052 AAAGAGAAGAAAGAAGGGGGTGG - Intergenic
1044845077 8:96372447-96372469 AGAGAGAAGAATTATGGGCAGGG - Intergenic
1044846757 8:96389450-96389472 GTAGAGCAGAAAGATGGGAAAGG + Intergenic
1044888348 8:96804313-96804335 AGAGTGAGGAAAGAAGGGGAGGG + Intronic
1045077220 8:98583884-98583906 AGAGAGAAGAAAGAGAGAGAAGG + Intronic
1045939245 8:107718640-107718662 ATAGAGAAGAAGGAACTGGAAGG + Intergenic
1046032279 8:108797544-108797566 ATAGTGGGGAAGGATGGGGAGGG - Intergenic
1046039453 8:108884669-108884691 TCAGAGAAGAAAGAAAGGGATGG - Intergenic
1046092961 8:109524863-109524885 ACAGAGAGGACAGAGGGGGAGGG - Intronic
1046828359 8:118716780-118716802 AAAGAGGAGAAATATGGAGATGG - Intergenic
1046888245 8:119392869-119392891 AGAAAGAAGAAAGAGGAGGAAGG - Intergenic
1047253743 8:123200333-123200355 GTAGAAAAGGAAGAAGGGGAAGG + Intronic
1047413037 8:124639758-124639780 ATAGAAAAGAAATCTGGGGCTGG - Intronic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1047692971 8:127375218-127375240 AAAGAGAAGGAAGATGTGAAGGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048010274 8:130449964-130449986 ATAGAGAAGTATGATGGTGAAGG + Intergenic
1048035372 8:130672798-130672820 GGCGAGAAGAAAGAAGGGGAAGG + Intergenic
1048224470 8:132571467-132571489 ATAGAGGAGAAGGAGTGGGATGG + Intergenic
1048586698 8:135780658-135780680 AAAGACAAGAAAGGTGAGGAAGG - Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1048946640 8:139454779-139454801 ATACAGAAAAAAAATGGGTAAGG + Intergenic
1049132174 8:140855835-140855857 ACAGAGAAGGATGGTGGGGATGG + Intronic
1049304465 8:141893576-141893598 ATAGAGAAGCCAGATGGTGAGGG - Intergenic
1049561390 8:143313252-143313274 AGAAAGAAGAAAGATGTGGCCGG + Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050065565 9:1755923-1755945 ATAGAAATGAAAGATGTGGCAGG - Intergenic
1050132652 9:2428723-2428745 ATGGAGAGGAGAGAAGGGGAAGG + Intergenic
1050301288 9:4261338-4261360 AAAGAGAAGAGAAATAGGGATGG + Intronic
1050722949 9:8611757-8611779 AAAGAAAAGAAAGGAGGGGAGGG + Intronic
1050968526 9:11839235-11839257 ATAGAGATGAAAAAATGGGAGGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051216420 9:14803009-14803031 AGAAAGAAGAAAGAAAGGGAGGG - Intronic
1051489518 9:17646070-17646092 ATAGAGAAAAAAGAAGGAAAAGG - Intronic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1051603653 9:18898463-18898485 ATAGAGAAAAAAGAATGGAAAGG + Intronic
1051711106 9:19932256-19932278 GTAGAGATGAAAGCTTGGGAAGG + Intergenic
1051794284 9:20847214-20847236 AGAGAGATGAAGGATTGGGAAGG - Intronic
1051859661 9:21609956-21609978 ACAGATAAGGAAGATGAGGAAGG + Intergenic
1052145997 9:25050141-25050163 AGAGAGGAGAATGAAGGGGAGGG + Intergenic
1052173475 9:25429000-25429022 ATAGAGAAAAAAGAAGGAAAAGG + Intergenic
1052340120 9:27356784-27356806 ACAGAGAGGAAAGATGGACAAGG - Intronic
1052624269 9:30954875-30954897 ATAGAATAGAAAGATGGGAATGG + Intergenic
1052629304 9:31017050-31017072 CTAGAGGAGAAAGAGGGAGAGGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054822609 9:69538536-69538558 ATAGGAAAGGAAGTTGGGGATGG - Intronic
1054879914 9:70134323-70134345 ATGGAGAAGGAAGTGGGGGATGG - Intronic
1055186044 9:73455341-73455363 AGAGAAAAGAAAGAAAGGGAAGG - Intergenic
1055621028 9:78125394-78125416 ATAGACAAGAAAGATGGTTGGGG - Intergenic
1055713086 9:79086877-79086899 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1055933370 9:81582131-81582153 ATAGGGAAGTAAGGCGGGGAGGG + Intergenic
1056039194 9:82643823-82643845 ATAGATAACAAAGACTGGGAAGG + Intergenic
1056040770 9:82664154-82664176 AAAGAAAAGAAAGAAAGGGAGGG + Intergenic
1056137728 9:83646533-83646555 AAAGAAAAGAAAGAAGGGAAGGG + Intergenic
1056808418 9:89745915-89745937 ATAGAGAGGAGAGAATGGGAGGG + Intergenic
1056831204 9:89918809-89918831 ATGGAAAAGAAAGACGGGGGAGG - Intergenic
1056953785 9:91066381-91066403 ATAGAGAAGACAGCTGGAGACGG + Intergenic
1056984500 9:91349704-91349726 AGAGAGAAGAGAGAGGGAGAGGG + Intronic
1057184759 9:93050921-93050943 ATAGAGAAGAAAAAAGCGCAGGG + Intergenic
1057810486 9:98253444-98253466 ATAGAGAAGAAACTAGGGGAAGG - Intronic
1058144973 9:101400433-101400455 ATTGAGACAAAGGATGGGGAAGG - Intronic
1058568632 9:106315062-106315084 ATAGAAAAGGAATTTGGGGAGGG - Intergenic
1058786816 9:108396144-108396166 AGAGAGAAGGAAGAGAGGGAAGG + Intergenic
1058879561 9:109274634-109274656 ATATAGAAGGAAGAAAGGGAAGG - Intronic
1058946982 9:109866512-109866534 ATAGAGAAGAAAAATATGAAGGG + Intronic
1059227096 9:112682208-112682230 AAAGCGAAGACAGATGGGGCTGG + Intergenic
1059462981 9:114446905-114446927 ACAGAGAGGAGAGTTGGGGAGGG - Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1059840734 9:118212686-118212708 ATAGAGATGAGGGTTGGGGAAGG + Intergenic
1060018060 9:120104421-120104443 ATGGAGGAGAAGGATTGGGATGG + Intergenic
1060122891 9:121011947-121011969 ATAGAGTAGAAGGCTGGGAAGGG + Intronic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061305667 9:129731696-129731718 AAAGAAAAGAGAGACGGGGAGGG + Intergenic
1061571229 9:131478589-131478611 AGAGAGAAGAAAGAAGGAGCAGG + Exonic
1062638438 9:137503684-137503706 GGAGGGAAGAAAGAAGGGGAAGG + Intronic
1062647343 9:137555435-137555457 AGAGAGGATAACGATGGGGAGGG - Exonic
1185504946 X:625093-625115 AGAAAGAAGAAAGAAAGGGAAGG - Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186200912 X:7153914-7153936 AGAGAGAAGAAAGAAAGGAAGGG - Intergenic
1186253439 X:7694077-7694099 ATAGAAAAGAAAGAGGGAAAGGG + Intergenic
1186521233 X:10208598-10208620 AAAGGGAAGGAAGATGGGGTGGG + Intronic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187397380 X:18930482-18930504 AGAGAGGAGAAAGCAGGGGAGGG + Intronic
1187549537 X:20288139-20288161 ATAGAGAACAATGGAGGGGAAGG - Intergenic
1187552351 X:20318572-20318594 ATAGGAAAGAAAGATTGAGAGGG - Intergenic
1187562460 X:20415441-20415463 CTAAAGAAGAAAGGTAGGGATGG + Intergenic
1187571485 X:20508247-20508269 ATGGGGAAGTAAGATTGGGAAGG - Intergenic
1187766559 X:22648995-22649017 AGGCAGAAGAAAGATGGGCAAGG + Intergenic
1188002973 X:24999318-24999340 AGAGAGAAGAAAGAGGGGGCGGG - Intergenic
1188179997 X:27043680-27043702 AAAGAGAAAAAAGATTGGCAGGG - Intergenic
1188344631 X:29048619-29048641 ATAGAGAGGAAAATTAGGGAAGG + Intronic
1188361062 X:29254454-29254476 AGAGAGAGCAAAGAGGGGGAGGG + Intronic
1188396286 X:29687496-29687518 AGAGGGTAGGAAGATGGGGAGGG + Intronic
1188436231 X:30161730-30161752 ATAAAGAAGAAAGATAGGAATGG + Intergenic
1188759573 X:34010491-34010513 AGAGAGGGGAGAGATGGGGATGG - Intergenic
1188776450 X:34225990-34226012 AAAGAAAAAAAAGATGGAGAAGG - Intergenic
1189326882 X:40118005-40118027 AGAGAGAAGACAGATAGGGAGGG - Intronic
1189423902 X:40881264-40881286 AGAAAGAAGGAAGCTGGGGAGGG + Intergenic
1189772436 X:44439712-44439734 AAAGAGAAGTAAGATTGGGTAGG + Intergenic
1189855102 X:45215825-45215847 ATAGAGAAGAAATATTGAAAAGG + Intergenic
1190047537 X:47124735-47124757 AGAAAGAAGAAAGAGAGGGAGGG + Intergenic
1190523904 X:51309546-51309568 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
1191058449 X:56268696-56268718 ATAGAGAAGAAACTTGGGGGTGG - Intronic
1191591458 X:62889541-62889563 TTAGAGAAGAAAGATTGAAAAGG + Intergenic
1191641784 X:63434341-63434363 ACAGAGAGGAAAGAGGGGGAAGG + Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1193016350 X:76738323-76738345 GAAGAGAAGAAAGAGTGGGAAGG + Intergenic
1193706635 X:84828493-84828515 AGAGAGAAGAAAGAAAGAGAAGG - Intergenic
1194242711 X:91471237-91471259 TTAGAGAAAAAAGATTGGAAAGG + Intergenic
1194275533 X:91876214-91876236 AAAGAGAAGGAAGGTGGCGAGGG + Intronic
1194431369 X:93811090-93811112 ATAGAGGAAAAAGATTGGTATGG + Intergenic
1194443624 X:93961731-93961753 TTGGGGAAGAAATATGGGGATGG + Intergenic
1194721627 X:97346982-97347004 ACAGAGAAGGAAGAAGGTGATGG - Intronic
1194946371 X:100073393-100073415 ATAGAGCAGAACATTGGGGAAGG + Intergenic
1195575057 X:106439995-106440017 ATATGGAAAAAAGTTGGGGAGGG + Intergenic
1195642685 X:107194060-107194082 ATAAATAAGAAAGATGGAAAAGG + Intronic
1196061265 X:111410612-111410634 ATAGAGAAGAAGGAGGGGCTGGG + Intronic
1196329515 X:114454264-114454286 ATAGAGAAGCAAGATAGGGCAGG + Intergenic
1196345627 X:114653658-114653680 ATAAAGAAGAAAGATGAACAAGG - Intronic
1196583468 X:117402396-117402418 ATGGAGAAGGAAGATGGCAAAGG - Intergenic
1196731106 X:118942317-118942339 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1196820606 X:119697431-119697453 AAAGAGAAGAAAGTTGGAGGAGG + Intergenic
1197209441 X:123816798-123816820 AAAAAGAAGGAAGTTGGGGAAGG + Intergenic
1197273058 X:124447160-124447182 AGAGAGAAGAAAGCTGAGCAGGG - Intronic
1197532497 X:127646898-127646920 AGAGAGAAGAGAGAGGGAGAGGG + Intergenic
1197604848 X:128573627-128573649 AAAAAGAAGAAAGAAAGGGAAGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197841480 X:130752200-130752222 ATAGAGGAAACAGATGGGGAGGG - Intronic
1198082417 X:133252350-133252372 AAAGAAAAGAAAGAAGGGGAGGG + Intergenic
1198094460 X:133365310-133365332 AAAGAAAAGAAAGTTGGTGAAGG - Intronic
1198160584 X:134003867-134003889 AAAGAAAAGAAAGGGGGGGAGGG + Intergenic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1198455409 X:136812783-136812805 TAAGAAAAGAAAGAGGGGGAAGG + Intergenic
1198603442 X:138310461-138310483 ATGGAGATGGAAGTTGGGGATGG - Intergenic
1199274586 X:145926242-145926264 AGAGAGAAGAAAGACTGGGGAGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199780780 X:151057338-151057360 ATAGGAAAGAAAGAGGGAGAAGG - Intergenic
1200592780 Y:5097649-5097671 AAAGAGAAGGAAGGTGGTGAGGG + Intronic
1200820674 Y:7579641-7579663 ATAGTCAAGAAAAATGGGGCTGG + Intergenic
1201058015 Y:10015291-10015313 ATAGAGAAGAAAGAAAAGGAAGG + Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic
1201470278 Y:14325707-14325729 ATAGAAAAGAAAGAGGGAAAGGG + Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201741071 Y:17325296-17325318 AGAAAGAAGAAAGAGAGGGAGGG + Intergenic
1202239631 Y:22753101-22753123 ATAGTCAAGAAAAATGGGGCTGG - Intergenic
1202392618 Y:24386863-24386885 ATAGTCAAGAAAAATGGGGCTGG - Intergenic
1202478166 Y:25283254-25283276 ATAGTCAAGAAAAATGGGGCTGG + Intergenic