ID: 1001473144

View in Genome Browser
Species Human (GRCh38)
Location 5:172029891-172029913
Sequence TGGACCTGCTGCACAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001473144_1001473149 27 Left 1001473144 5:172029891-172029913 CCACCTCTTGTGCAGCAGGTCCA No data
Right 1001473149 5:172029941-172029963 CCAATGTAATGTTACATTGAGGG No data
1001473144_1001473147 26 Left 1001473144 5:172029891-172029913 CCACCTCTTGTGCAGCAGGTCCA No data
Right 1001473147 5:172029940-172029962 ACCAATGTAATGTTACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001473144 Original CRISPR TGGACCTGCTGCACAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr