ID: 1001475630

View in Genome Browser
Species Human (GRCh38)
Location 5:172048757-172048779
Sequence GTTCTGAGCAGAGGACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001475630_1001475638 27 Left 1001475630 5:172048757-172048779 CCACCTTGTCCTCTGCTCAGAAC 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1001475638 5:172048807-172048829 GTAAAAGCCAGACTTTACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001475630 Original CRISPR GTTCTGAGCAGAGGACAAGG TGG (reversed) Intronic
900682160 1:3923026-3923048 GGTCAGGGCAGAGGTCAAGGCGG + Intergenic
901012598 1:6210012-6210034 GCTCTGAGCTGAGGCCATGGAGG - Intronic
901740072 1:11335870-11335892 GTGCTCAGCAGAGGAAATGGAGG + Intergenic
902503855 1:16926977-16926999 GTTCTGAGCACTGGAGAAGGGGG + Intronic
902514028 1:16980427-16980449 CTTCAGAGCGGAGGCCAAGGGGG - Intronic
904286612 1:29456789-29456811 GTCCTGGGGAGAGGATAAGGGGG + Intergenic
904930875 1:34086687-34086709 GTTCAGGGCAGAGAAGAAGGAGG - Intronic
905108125 1:35576152-35576174 GTTCTCAGGGGAGGCCAAGGTGG + Intronic
905257473 1:36694293-36694315 CTTTTGTGCAGAGGATAAGGAGG + Intergenic
906149561 1:43579654-43579676 GTTCTCAGGAAAGGGCAAGGTGG - Intronic
906905440 1:49885653-49885675 GTTCTGGGCACAAGACAGGGTGG - Intronic
907074908 1:51569269-51569291 GTTCTCAGAAGAGGAGAAGGAGG - Intergenic
908243447 1:62208104-62208126 ATTATGGGCAGAGGGCAAGGGGG + Intronic
908474067 1:64471075-64471097 GGTCTGTGCAGAGGACAGAGGGG - Intronic
911738035 1:101358909-101358931 GTTATGAAGAGAGGACAAGCAGG + Intergenic
912208386 1:107532942-107532964 CTTCTGAGCGGAGGACTGGGGGG + Intergenic
913709247 1:121464968-121464990 TTTCTGAGAACAGAACAAGGTGG + Intergenic
915148272 1:153808555-153808577 GTTCTCAGCAGAGAAGAATGAGG - Exonic
915470526 1:156123249-156123271 GTTCTGGGCAGTTGAGAAGGAGG + Intronic
915915686 1:159939201-159939223 GTTCATAGCAGAGGTCAAGGTGG - Intronic
918404844 1:184201503-184201525 GAGCAGAGAAGAGGACAAGGTGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920821170 1:209382840-209382862 ATTCTGAGCAGAGGGGCAGGAGG - Intergenic
920936496 1:210440037-210440059 GTTTTTAGCAGAGGCCAAGAAGG + Intronic
922235335 1:223718168-223718190 ACTCTGGGCAGAGGACTAGGTGG + Intronic
922812493 1:228425345-228425367 GGTCTGGGCAGAGGACACCGCGG - Intergenic
922902278 1:229146477-229146499 GACCTGAGCAGAGGACCAGTGGG - Intergenic
923121391 1:230995150-230995172 GTTCTGACCATAGGACACAGTGG + Intronic
923456050 1:234166605-234166627 ATTCTGAAGAGAGGACCAGGTGG + Intronic
924722583 1:246637349-246637371 GTTATGTTGAGAGGACAAGGAGG + Intronic
1062806382 10:422879-422901 GCTCTGCGTAGAGGACGAGGAGG + Exonic
1063231374 10:4068797-4068819 GTTCAGAGCTGAGGATAATGGGG - Intergenic
1063338328 10:5238405-5238427 ATTCTGAGCAGTGGAGAAAGAGG + Intergenic
1063529762 10:6819695-6819717 GGGCTGAGGAGAGGAGAAGGAGG + Intergenic
1066218893 10:33316120-33316142 CTTCTGAGCAGAGGGCAAGAAGG + Intronic
1066650567 10:37651246-37651268 GATCTGAGCATAGGACAGGAAGG + Intergenic
1067441848 10:46312932-46312954 GTTCTGAGCAGAGGTCCTGAAGG - Intronic
1069677581 10:70259691-70259713 GTGCTGGGGAGAGAACAAGGAGG + Intronic
1071735965 10:88301342-88301364 GTTATGTGCTGATGACAAGGAGG + Intronic
1072639592 10:97201897-97201919 CTTCTGAGCAGCAGGCAAGGAGG - Intronic
1073612688 10:104959902-104959924 GTACTGAGGAAAGGACAAGAGGG - Intronic
1074004894 10:109411469-109411491 GTTCTGGGCAGAGGAAAACTTGG - Intergenic
1074851308 10:117441702-117441724 TTCCAGAGGAGAGGACAAGGTGG - Intergenic
1074985853 10:118658902-118658924 TTTCTAAGCAGAGGGCAAGATGG + Intergenic
1075556099 10:123433825-123433847 GTTCTGGACAGAGAACAAGGAGG + Intergenic
1076358866 10:129872754-129872776 GTGCTGTGCAGAGCACAAAGTGG + Intronic
1076361031 10:129889123-129889145 GTTCTTTGCAAAGGACATGGTGG + Intronic
1077922962 11:6655445-6655467 GTTCTGAGCCGGAGACAATGGGG - Intronic
1078088323 11:8247996-8248018 GTTCTGTGCAGGGGGCAGGGAGG + Intronic
1078404346 11:11056480-11056502 GTTCTGAGCCAAGGATAAAGTGG - Intergenic
1080069126 11:28058065-28058087 GTTCTGAGAAGAGTTGAAGGTGG + Intronic
1080905887 11:36544263-36544285 GTTCTTATCAGAGAAGAAGGGGG + Intronic
1081615982 11:44591467-44591489 GCTCTGCTCAGAGGGCAAGGAGG - Intronic
1082635281 11:55586309-55586331 GTTATGTTGAGAGGACAAGGAGG - Intergenic
1083339548 11:61950217-61950239 CTTCTGAGCAGATTACAAGAAGG + Intronic
1083381704 11:62274568-62274590 GTTATGTTGAGAGGACAAGGAGG + Intergenic
1083636324 11:64122817-64122839 GGCCTGAGCAGAGGACAGGCTGG + Intronic
1083862283 11:65427749-65427771 GTTCTGAAAAGAAGAGAAGGCGG - Intergenic
1084702805 11:70798535-70798557 GTTCTGAGCATCGGTGAAGGGGG - Intronic
1084801636 11:71547977-71547999 GTTCTCAGCAGTGGGGAAGGAGG - Intronic
1084981250 11:72829942-72829964 GCTCTGAGGAGAGGGCAGGGAGG + Intronic
1087066411 11:94031884-94031906 GTACTGAGGAGAGGAGAAAGTGG + Intronic
1087104688 11:94397920-94397942 TTTCTTTGCAGAGGACAGGGAGG + Intronic
1087349771 11:97017086-97017108 GTTCAGAGCATAAGAAAAGGAGG + Intergenic
1087658467 11:100956018-100956040 GGTCTGAGAAGAGGACAAGATGG - Intronic
1089369082 11:117941407-117941429 GTGCTGAGCAGAGGATCAGGTGG - Intergenic
1089982074 11:122780757-122780779 GGTGTGAGCAGAGGACAGTGGGG + Intronic
1091856869 12:3747488-3747510 GTTATGTGCAGCGGACAATGTGG + Intronic
1092050480 12:5466162-5466184 GCTCTGATGAGATGACAAGGTGG - Intronic
1093131016 12:15391736-15391758 GTTTTGACCAGAAGACAAAGTGG - Intronic
1093187979 12:16043370-16043392 GTTTGAAGAAGAGGACAAGGTGG - Intergenic
1096890563 12:54766563-54766585 GTAGTGGGCAGAGGCCAAGGAGG + Intergenic
1096981327 12:55729337-55729359 GTTCAGAGAAGCGGACGAGGTGG + Exonic
1097237520 12:57550181-57550203 GCTCTCAGCAGAGGCCGAGGCGG - Exonic
1098744237 12:74215449-74215471 GGTCTGAGAAGAGGAAAAGAGGG + Intergenic
1099861990 12:88232972-88232994 GTTATGTTGAGAGGACAAGGAGG - Intergenic
1101037423 12:100718724-100718746 GTTCTGAGCACGGGGGAAGGGGG - Intronic
1102247785 12:111366131-111366153 GAGCTGAGCAGAGGGCAGGGAGG - Exonic
1103070243 12:117935396-117935418 GTTTTGAGCAGAGGAAGAGTGGG - Intronic
1103556634 12:121770589-121770611 GTGCTGGGGAGAGGACCAGGTGG + Intronic
1103798698 12:123523162-123523184 GTGCTGTGCAGAGGAGAAAGGGG - Intronic
1104656275 12:130575966-130575988 ATTCAGAGCAGAGGAGAATGAGG + Intronic
1104667063 12:130655159-130655181 GTGCTGGACAGAGGACAAAGAGG + Intronic
1105532034 13:21229167-21229189 ATGCTGAGCAGAGGCCCAGGGGG - Intergenic
1105585214 13:21737253-21737275 TTTCAGAGAAGAGGAAAAGGAGG + Intergenic
1106194607 13:27482505-27482527 CTTATAAACAGAGGACAAGGAGG - Intergenic
1107243200 13:38262365-38262387 CTGCTGAGCAGAGGAGAAAGAGG - Intergenic
1108492494 13:50995107-50995129 CTTCTGAGCAGCAGACACGGAGG + Intergenic
1109308374 13:60664160-60664182 GTTATGAGCAGAGGAAGAGGGGG - Intergenic
1110298829 13:73901421-73901443 GTTTAGTGCTGAGGACAAGGTGG - Intronic
1113066720 13:106380265-106380287 GGTCTGAGGAGAGGATGAGGTGG - Intergenic
1113561434 13:111284758-111284780 GGTGTGAGAAGAGGACATGGAGG + Intronic
1114052397 14:18931616-18931638 TTTCTGAGGAGAGGGGAAGGAGG - Intergenic
1114110161 14:19470309-19470331 TTTCTGAGGAGAGGGGAAGGAGG + Intergenic
1114654489 14:24307951-24307973 GATCTCAGCCCAGGACAAGGTGG + Exonic
1116740158 14:48744537-48744559 TTCCTGAGCAGATGACAAAGTGG - Intergenic
1116994293 14:51306294-51306316 GCTGTGAGTACAGGACAAGGAGG - Intergenic
1117791830 14:59349876-59349898 ATTCTGAACAGGGGACAAGTGGG + Intronic
1118942429 14:70349866-70349888 GTTATGTTGAGAGGACAAGGCGG - Intronic
1119710277 14:76817203-76817225 GTTGGGAGAAGAGGAAAAGGTGG - Intronic
1121415374 14:93775664-93775686 GTTCTGGGCTGAGCTCAAGGAGG + Intronic
1121744578 14:96278338-96278360 GTTCTGGGCAGAGGGCAAGGTGG - Intergenic
1122349859 14:101082837-101082859 CTTATGAGCAGAGGACAGAGGGG + Intergenic
1122719090 14:103712248-103712270 TTTCTGAGCAAGGGACAGGGAGG + Intronic
1122780221 14:104140328-104140350 GTCCAGAGCAGAGGACAGGGCGG - Intronic
1123061274 14:105595667-105595689 GGTCGCAGCAGAGGACAGGGCGG + Intergenic
1123085728 14:105716578-105716600 GGTCGCAGCAGAGGACAGGGCGG + Intergenic
1124190802 15:27574638-27574660 CTCCTGAGCAGAGACCAAGGAGG - Intergenic
1125918995 15:43513525-43513547 GTTAGGAGCAGTGGAAAAGGAGG - Intronic
1126204967 15:46035144-46035166 GTTCTCACCAGAAGCCAAGGAGG + Intergenic
1126217877 15:46177381-46177403 GTTCTAAGCAGAGGAAAGGAAGG - Intergenic
1126888015 15:53173314-53173336 ATTATGAGCCGAGGAAAAGGAGG - Intergenic
1128608806 15:69057961-69057983 GCCCTGGGCAGAGGACAGGGTGG + Intronic
1128976033 15:72154270-72154292 TTTCTCAGTAGAGTACAAGGTGG - Intergenic
1129098542 15:73236016-73236038 GTTATGGGCAAGGGACAAGGAGG - Intronic
1129196387 15:73969725-73969747 GTTCTAAGCAGAGGAACATGAGG - Intergenic
1129239194 15:74241600-74241622 GTTCTGAGCAGAGGAGAGAGAGG + Intronic
1129789603 15:78331872-78331894 ATTCTGAGCAGAGGAAACAGCGG - Intergenic
1131398330 15:92104553-92104575 GTTCTGAGCAGAGGCAGATGAGG - Intronic
1131806895 15:96131907-96131929 GTTCTCACCAAAGGACAAGAAGG + Intergenic
1133306308 16:4811863-4811885 GGTCTGAGCAGAGGTGAGGGTGG - Intronic
1133403440 16:5505208-5505230 GTTTTAAGTAGAGGAGAAGGGGG - Intergenic
1134819317 16:17233350-17233372 GTGCTGAGCAAAGCAAAAGGAGG + Intronic
1135090846 16:19515202-19515224 GTCCTGAGAGGAGGATAAGGAGG - Intronic
1138495590 16:57407171-57407193 GTTGTCAGCAGAGGGAAAGGGGG + Intronic
1139383971 16:66552292-66552314 GTTGGGAGCAGAGGAGAGGGAGG - Intronic
1139471353 16:67179672-67179694 GTTCTGAGCAGAGGTGATGAAGG - Intronic
1140299730 16:73745337-73745359 CTTAAGAGCAGAGGACAAGGAGG + Intergenic
1140837821 16:78811669-78811691 CTTATAAGAAGAGGACAAGGGGG - Intronic
1140959675 16:79899910-79899932 GTCCTGAGCAAAGGCCAAGTTGG + Intergenic
1142165332 16:88583852-88583874 GTAGGAAGCAGAGGACAAGGAGG - Intronic
1143014446 17:3884159-3884181 GTTCTTGACAGTGGACAAGGAGG - Intronic
1144320286 17:14110689-14110711 GTTCAGAGCAGAGAACTAGGAGG - Intronic
1144886226 17:18464354-18464376 GATGTGGGCAGAAGACAAGGAGG - Intergenic
1145145982 17:20480015-20480037 GATGTGGGCAGAAGACAAGGAGG + Intergenic
1146361862 17:32183251-32183273 GTACTGCCCAGAGGAGAAGGAGG + Exonic
1147781492 17:42946053-42946075 GTTCTCAACAGAGGGCAAGTAGG - Intergenic
1148148882 17:45384430-45384452 GAGCTGAGCAGAGGAGAGGGCGG + Intergenic
1148866483 17:50631405-50631427 CTTCAGGGGAGAGGACAAGGGGG + Intergenic
1151479182 17:74360341-74360363 GGTGTGAGCAGAGGGCAAGGTGG + Intronic
1151930479 17:77228790-77228812 AGTCTGTGCAGGGGACAAGGGGG - Intergenic
1152000743 17:77643967-77643989 GATCTGGGCACTGGACAAGGTGG - Intergenic
1152149237 17:78588759-78588781 GTTCCCAGCAGAGGAACAGGAGG + Intergenic
1152271579 17:79328084-79328106 CTGCTGAGCAGTGGAAAAGGTGG + Intronic
1152605937 17:81290093-81290115 GGTGTGTGCAGAGAACAAGGGGG - Intronic
1153501689 18:5756206-5756228 GTTCTAGGCACAGGAGAAGGAGG - Intergenic
1153548755 18:6238701-6238723 GTTCTTTGAAAAGGACAAGGAGG - Intronic
1153987852 18:10368918-10368940 GATGTGTGCAGAGAACAAGGGGG - Intergenic
1155283635 18:24266377-24266399 GTTCTGAGAAGAAGGAAAGGGGG + Intronic
1155657637 18:28210228-28210250 GTTATGTTGAGAGGACAAGGAGG + Intergenic
1157502726 18:48202605-48202627 GATCTGAGCAGAGCACAGTGGGG - Intronic
1157920496 18:51708776-51708798 GTTATGTTGAGAGGACAAGGAGG - Intergenic
1159102897 18:63974819-63974841 GACCTGAGCAGAGGCCAAGGGGG + Intronic
1160040627 18:75342140-75342162 GCTCAGAGCAGAGGGCAAGCTGG - Intergenic
1162460912 19:10813480-10813502 GTTCTGAACACAGGAAAATGAGG - Intronic
1163738603 19:18996969-18996991 GGTCTGAGCAGGGGACAGGTGGG + Intronic
1163767063 19:19169634-19169656 GTTGTTAGCACATGACAAGGTGG - Intronic
1163938915 19:20475341-20475363 GTTATGTTGAGAGGACAAGGAGG + Intergenic
1164237456 19:23349575-23349597 GTTATGTTGAGAGGACAAGGAGG - Intronic
1165837996 19:38771010-38771032 CTTCTGAGCAGAAGCCCAGGCGG - Exonic
1165841569 19:38791687-38791709 CTTCTGAGCAGAAGCCCAGGCGG + Exonic
1165861248 19:38910712-38910734 GTTCCAGGCAGAGGAGAAGGGGG - Exonic
1166310911 19:41962172-41962194 GTTCTGAGCAGAGAACATAGAGG + Intergenic
1168135297 19:54347036-54347058 GTTTGGAGAAGAGGACCAGGAGG + Intergenic
925142980 2:1562633-1562655 GTGCTGGGCTGAGGACATGGAGG - Intergenic
926326198 2:11786477-11786499 GATCAGAGCAAAGGAGAAGGTGG - Intronic
926710072 2:15872184-15872206 GTTCTGTGCTGAGGACACAGTGG + Intergenic
927186603 2:20486712-20486734 GGGCTGAGCAGAGGAGCAGGAGG - Intergenic
927642712 2:24855518-24855540 GTTCTGCACAGAGAAGAAGGAGG + Intronic
928090344 2:28369972-28369994 GAGCTGAGGAGAGGACAGGGTGG + Intergenic
928727313 2:34189804-34189826 GATCTCTGCAGAGGACATGGAGG + Intergenic
931750388 2:65324940-65324962 GGTAGGGGCAGAGGACAAGGAGG + Intronic
934887962 2:98041108-98041130 GTTCTGATCAGAGGCAAGGGTGG - Intergenic
937037729 2:118795687-118795709 GTTCTGAGCAGTGCCCCAGGAGG - Intergenic
937592024 2:123625877-123625899 ATGCTGAGCAAAGGACAAAGAGG + Intergenic
937907765 2:127060728-127060750 CTTCTGCTCAGAGGACAAAGGGG + Intronic
938305404 2:130251138-130251160 GATCAGAGCAGAGGCCAGGGTGG + Intergenic
938472453 2:131577370-131577392 TTTCTGAGGAGAGGGGAAGGAGG - Intergenic
938734435 2:134173494-134173516 GTGCAGAGCTGAGAACAAGGGGG - Intronic
939254134 2:139720751-139720773 GTTCTTTGCAGAGGATAAGTGGG + Intergenic
939496247 2:142931451-142931473 GTTATGTTGAGAGGACAAGGAGG + Intronic
940051663 2:149471445-149471467 GTTCTGTGCAGAAGACAAAAAGG + Exonic
941219156 2:162753480-162753502 ATTCTGAGCAGATGGCAAAGAGG + Intronic
944534660 2:200697018-200697040 GCTCAGAGGAGAGGTCAAGGTGG + Intergenic
944537266 2:200723399-200723421 CTGCTGAGCAGAGGATAATGAGG + Intergenic
945137507 2:206644173-206644195 TTACTGAGCAGAGCACAAGCGGG + Intergenic
945412828 2:209532734-209532756 TTTCTGTGCAGAGGAACAGGAGG - Intronic
946099111 2:217303582-217303604 GGGCTGAGAAGAGGAAAAGGTGG - Intronic
946147897 2:217744588-217744610 GGACTGTGCAGAGGACAAGATGG - Intronic
947442815 2:230138017-230138039 GTTGTGAGCAGAAGACACAGAGG - Intergenic
948835177 2:240622904-240622926 GTTCTCCGCAGAGGGCCAGGTGG + Intronic
949061508 2:241961240-241961262 GTTCCGGGGAGAGGACAAAGTGG - Intergenic
1169919950 20:10724628-10724650 TTTCTGAGCAGAAAACAAGGAGG + Intergenic
1172917114 20:38451338-38451360 GTTTTGAGCAGAGGAGAGAGTGG + Intergenic
1173981426 20:47226992-47227014 GTTCTGAACAGAGGAAAGGGGGG + Intronic
1174165501 20:48581018-48581040 GTTATGAACAGAGGAGAAAGTGG - Intergenic
1174501641 20:50989302-50989324 GTACTGAGCAGGGCACAAGGTGG + Intergenic
1175307532 20:57987232-57987254 GTTCTGTGAGGTGGACAAGGTGG + Intergenic
1175377445 20:58538490-58538512 GTGCTGAGCACATGGCAAGGCGG + Intergenic
1175738913 20:61406785-61406807 GGTCTGGGCAGAGCACACGGTGG - Intronic
1175841534 20:62030903-62030925 GTACTGAGAAGAGGTGAAGGAGG - Intronic
1178407953 21:32339931-32339953 GTTCTGAGTAGAGGAGAGTGAGG - Intronic
1179664112 21:42898095-42898117 GTTCTGTGCACAGACCAAGGAGG - Intronic
1180470871 22:15653991-15654013 TTTCTGAGGAGAGGGGAAGGAGG - Intergenic
1181865147 22:25848798-25848820 GCTCTCTGCAGAGGACAGGGTGG + Intronic
1182097892 22:27638288-27638310 GTTCTCAGCAGAGGAAACTGAGG - Intergenic
1182574903 22:31266512-31266534 GTTCTCAGCAGAAGAGGAGGAGG - Intronic
1184101944 22:42345317-42345339 TTCCTGAGCAGAGGACAAGGGGG + Intergenic
1184537159 22:45094927-45094949 GTTCTGGACAGAGAGCAAGGTGG - Intergenic
949110390 3:254035-254057 GGTCTGAGCAGAGAACCAGGAGG - Intronic
950420721 3:12897553-12897575 GTGCTGAGCACAGGACAAGAGGG - Exonic
953746246 3:45576146-45576168 GTGATGAGCAGAGGAGAAAGTGG + Intronic
953901527 3:46846502-46846524 GCTGAGGGCAGAGGACAAGGAGG + Intergenic
954557800 3:51532023-51532045 GTTATGTTGAGAGGACAAGGAGG + Intergenic
956967077 3:74474412-74474434 GTTCAGGGCAGAGGTCAAGCTGG + Intronic
957275077 3:78080639-78080661 GTACTTAGAAGAGGACAAAGTGG - Intergenic
957889330 3:86335308-86335330 GTGCTGAGCAGAGAACTTGGTGG + Intergenic
959877486 3:111402150-111402172 ATTCTAAGTAGAGAACAAGGTGG - Intronic
960696911 3:120405486-120405508 GCACTGAGAACAGGACAAGGAGG - Intronic
962684452 3:137833600-137833622 GTCCTGAGGGGAGGAAAAGGTGG - Intergenic
964305100 3:155331430-155331452 GCTATGAGCAGATGACAAGAAGG - Intergenic
965872753 3:173280517-173280539 GTTATGTTGAGAGGACAAGGAGG - Intergenic
966377054 3:179307103-179307125 GTTATGGGCAGGGGACAATGTGG - Intergenic
966508563 3:180735003-180735025 CTTCTGAGCAAAGGACAGGAGGG - Intronic
970794298 4:19892953-19892975 GTTATGTTGAGAGGACAAGGAGG - Intergenic
973052558 4:45612697-45612719 GTTATGTTGAGAGGACAAGGAGG - Intergenic
975558595 4:75688667-75688689 CTTCAGAGTAAAGGACAAGGAGG - Intronic
975709216 4:77142527-77142549 GTTCTGAGAAGTGAACAAAGTGG - Intergenic
976299578 4:83505491-83505513 GTTATGTTGAGAGGACAAGGCGG + Intronic
977284230 4:95082382-95082404 CTACTGAGCAGCAGACAAGGTGG - Intronic
977771867 4:100869782-100869804 GTTCTGTGTAGAGAAGAAGGAGG + Intronic
984280199 4:177661665-177661687 GTTGTGACCAGGGGAAAAGGGGG - Intergenic
985563595 5:604141-604163 GTTCAGCGCAAAGGAGAAGGGGG + Intergenic
986459909 5:7959679-7959701 GTGCTGGGCAGAGGCCAAGAGGG + Intergenic
988903989 5:35765675-35765697 GTTCTTGGCAGATGACAAGATGG - Intronic
989108963 5:37888986-37889008 GTTCTGAAAAGTGGAAAAGGAGG + Intergenic
990240275 5:53810142-53810164 GCTCTGAGCAGGGGATCAGGAGG - Intergenic
990331340 5:54729203-54729225 GTTCTGAGGAGAGAGCAAGAAGG + Intergenic
990516521 5:56535664-56535686 GGGCTGAGCAGAGGTGAAGGAGG - Intronic
991358206 5:65791759-65791781 CTTCTGAGCAAAAGAAAAGGGGG + Intronic
991400354 5:66245220-66245242 GGTCTGCACAGGGGACAAGGGGG + Intergenic
992886850 5:81167966-81167988 GATCTGAGAAGAGGGGAAGGCGG - Intronic
993247418 5:85468301-85468323 TATCTGTGCAGAGGACAAGAAGG + Intergenic
993620268 5:90160126-90160148 GCTCTTAGGAGAGGACATGGAGG + Intergenic
996256954 5:121415979-121416001 TGTCTAAGCAGTGGACAAGGAGG - Intergenic
997891813 5:137683588-137683610 CTTCTGAGAAGAGGTCAAGGTGG - Intronic
999342265 5:150782385-150782407 GTTCTTAGAAGAGGTCAGGGAGG - Intronic
1000203022 5:159030571-159030593 GATCTGAGCGGAGGGCCAGGTGG + Intronic
1001181284 5:169522932-169522954 GTTCTGAGGAGAGAGCAAGCAGG - Intergenic
1001264252 5:170261007-170261029 GTTCTGGGCCAAGGCCAAGGTGG + Intronic
1001475630 5:172048757-172048779 GTTCTGAGCAGAGGACAAGGTGG - Intronic
1002703421 5:181143345-181143367 GTCCTGAGAAGTGGCCAAGGTGG - Intergenic
1003127055 6:3363771-3363793 TGGCTGAGCAGAGGCCAAGGAGG - Intronic
1004231064 6:13833812-13833834 GTTCAGAGCTGGGGAGAAGGAGG + Intergenic
1006592185 6:35166520-35166542 TTTCTGAGCAGAGGAAAACCAGG - Intergenic
1007341784 6:41195225-41195247 GTCCAGAGATGAGGACAAGGAGG + Intronic
1007505811 6:42334604-42334626 GTTCTGAGCAGGGAACAGGGTGG + Intronic
1007721332 6:43887129-43887151 GTGCTGACCAGAGGGCAGGGAGG - Intergenic
1008991428 6:57606836-57606858 TTTCTGAGCAGATGATAATGTGG + Intronic
1010404014 6:75482063-75482085 GCTCAGAGAAGAGGACAAGGGGG - Intronic
1012610342 6:101210915-101210937 GGGTGGAGCAGAGGACAAGGAGG - Intergenic
1013812807 6:114063793-114063815 GGACTGAGCAGAGGACATGGAGG - Intronic
1016838998 6:148507160-148507182 CTTCTGAGCAGAAGACAGAGTGG + Intronic
1017112687 6:150947748-150947770 CTTCTGAGCAGCGTACATGGTGG + Intronic
1017928702 6:158933660-158933682 GTTTTTAGCAGAGGGCAAGTCGG - Intergenic
1018021126 6:159762750-159762772 GGTCTGAGCAAAGGTCAAGGTGG - Intronic
1018415868 6:163601702-163601724 GGTGGGAGCAGAGGACAGGGAGG - Intergenic
1019642926 7:2114322-2114344 GGTCTGAGCAGGGAACCAGGGGG + Intronic
1019752049 7:2736971-2736993 ATTAGGAGCAGAGGACAAGAGGG - Intronic
1023176310 7:37438971-37438993 AGTCTGAGCAGAGGTAAAGGAGG - Intronic
1026180304 7:68033662-68033684 GGTTTAAGCAGATGACAAGGAGG + Intergenic
1027190582 7:75993811-75993833 GTTCTGTCCAGAGGCCAGGGAGG - Intronic
1027245705 7:76365879-76365901 TTCCTGAGCAGATGCCAAGGAGG - Intergenic
1029413254 7:100428610-100428632 GTGCTGGGCCGAGGACAGGGCGG - Exonic
1029709010 7:102289459-102289481 GCTCTGTGCAGAGGACAGGCAGG + Intronic
1033049749 7:137993395-137993417 GTTTTGATTAGAGAACAAGGTGG - Intronic
1033303290 7:140205462-140205484 GCTGTGAGCAGGGCACAAGGAGG - Intergenic
1034230378 7:149521145-149521167 GTGCTGACCAGAGGCCAGGGAGG + Intergenic
1036087202 8:5625350-5625372 GTGCTGAGCAGAGAAAAATGCGG - Intergenic
1036632383 8:10524773-10524795 GTCCTGAGCAGAGAACTAAGCGG + Intergenic
1037911900 8:22748599-22748621 GGTCTGAGGGGAGAACAAGGAGG + Intronic
1039370207 8:36976717-36976739 TTTCTGAGCTAAGGACATGGAGG + Intergenic
1039377103 8:37045478-37045500 GTTCTGTGCAGAGGACATCAAGG - Intergenic
1042114228 8:65413956-65413978 GTTCAGAGCTGAGGGCAATGTGG + Intergenic
1042158547 8:65869058-65869080 GTTATGTTGAGAGGACAAGGAGG - Intergenic
1044448063 8:92301421-92301443 GTTCTCAACTGAGGTCAAGGAGG + Intergenic
1044904865 8:96990117-96990139 GTGCTGAGCAGAGGAGTTGGAGG - Intronic
1045414416 8:101952166-101952188 CTTAGGAACAGAGGACAAGGAGG - Intronic
1045930693 8:107622982-107623004 GTTGTGAGCAGATGGCAATGAGG - Intergenic
1046348040 8:112962815-112962837 TTTCTGGGCAGAGAACAAGGAGG - Intronic
1047209586 8:122830646-122830668 GTTATGTTGAGAGGACAAGGAGG + Intronic
1048717787 8:137287190-137287212 GTTATGTTGAGAGGACAAGGAGG - Intergenic
1049311583 8:141936498-141936520 GGTCTGAGCAGAGAGCAAGGTGG + Intergenic
1049469856 8:142770487-142770509 GATCTGTGCAGAGGAGTAGGGGG + Intronic
1049676151 8:143890142-143890164 AGTCTGAGCAGAGGACACTGAGG + Intergenic
1051112835 9:13659278-13659300 GTTTTGAGCAGAGGATAAGAGGG + Intergenic
1052629519 9:31019348-31019370 GTTCTGAGCAGGAGAGAAAGTGG + Intergenic
1054822209 9:69534177-69534199 TTTCTGAGGAGAGGGCAAGGAGG + Intronic
1056286465 9:85092268-85092290 GTGCAGAGCAGAGGAGAAGCTGG - Intergenic
1057052682 9:91937520-91937542 GCTCTGACCAGAGGAGAAGGTGG - Intronic
1057180957 9:93030031-93030053 TGTCAGAGCAGAGGACAGGGTGG - Intronic
1057949284 9:99356897-99356919 GTTGTGGGCAGAGGAGAGGGAGG + Intergenic
1058628652 9:106962446-106962468 GGTCTGACCTGAGGCCAAGGAGG - Intronic
1059490267 9:114660796-114660818 GTGATGAGGAGAGGACATGGAGG - Intergenic
1059545138 9:115168303-115168325 GTTCTGACCAGGGAAGAAGGAGG + Intronic
1059796715 9:117705468-117705490 ATACAGAGAAGAGGACAAGGAGG - Intronic
1060028056 9:120189874-120189896 GGTCTGGGTAGAGAACAAGGAGG + Intergenic
1062255278 9:135617868-135617890 GTTCTCCGCAGAGGAGGAGGAGG + Intergenic
1062352599 9:136146407-136146429 TTTCTGAGCAGAGCCCAAAGAGG + Intergenic
1189008386 X:37018963-37018985 GGGGTGAGGAGAGGACAAGGAGG - Intergenic
1189040341 X:37536047-37536069 GGGGTGAGGAGAGGACAAGGAGG + Intronic
1192282120 X:69698430-69698452 GTTATGTTGAGAGGACAAGGAGG + Intronic
1193540049 X:82759986-82760008 GTTCAGAGCAGAGAACAATGTGG - Intergenic
1193832296 X:86304286-86304308 CTTCTGAGCAGTGGGCAAGCAGG - Intronic
1195924655 X:110013368-110013390 GTTCTGGGCAGAGCACAAAAAGG + Intronic
1197947224 X:131852285-131852307 GTTATGTTGAGAGGACAAGGAGG + Intergenic
1198112157 X:133511148-133511170 GTTAGCAGCAGATGACAAGGAGG - Intergenic
1198399644 X:136256548-136256570 CTTCTGAGGAGAGGAAAAAGAGG + Intergenic
1200955258 Y:8938214-8938236 GGTCAGAGCAGAGGCCAAGGTGG - Intergenic
1202052833 Y:20798474-20798496 GGTCTGAGCAGAGGCCAACTCGG - Intergenic