ID: 1001476609

View in Genome Browser
Species Human (GRCh38)
Location 5:172055075-172055097
Sequence GTGTGGACAGAGGTAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1223
Summary {0: 1, 1: 0, 2: 3, 3: 82, 4: 1137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001476609_1001476617 27 Left 1001476609 5:172055075-172055097 CCAAGCTCTACCTCTGTCCACAC 0: 1
1: 0
2: 3
3: 82
4: 1137
Right 1001476617 5:172055125-172055147 TGAAGCTTCCAGGGCACGCATGG No data
1001476609_1001476613 0 Left 1001476609 5:172055075-172055097 CCAAGCTCTACCTCTGTCCACAC 0: 1
1: 0
2: 3
3: 82
4: 1137
Right 1001476613 5:172055098-172055120 ACAGAGGTGAATTCACCATGAGG No data
1001476609_1001476615 17 Left 1001476609 5:172055075-172055097 CCAAGCTCTACCTCTGTCCACAC 0: 1
1: 0
2: 3
3: 82
4: 1137
Right 1001476615 5:172055115-172055137 ATGAGGCTGATGAAGCTTCCAGG No data
1001476609_1001476616 18 Left 1001476609 5:172055075-172055097 CCAAGCTCTACCTCTGTCCACAC 0: 1
1: 0
2: 3
3: 82
4: 1137
Right 1001476616 5:172055116-172055138 TGAGGCTGATGAAGCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001476609 Original CRISPR GTGTGGACAGAGGTAGAGCT TGG (reversed) Intronic
900338498 1:2176637-2176659 TGGAGGACAGAGCTAGAGCTGGG - Intronic
900347336 1:2215995-2216017 GTGGGGACAGAGCGAGAGCCAGG - Intergenic
900415672 1:2533432-2533454 ATGGGGACAGAGGTTCAGCTTGG - Intergenic
900548747 1:3243136-3243158 GTGTGGACAGAGGCCGAGACAGG - Intronic
900953768 1:5874534-5874556 GTGGGGGCGCAGGTAGAGCTGGG + Exonic
901030484 1:6304781-6304803 GTGTAGAAAGAGGTAGACATGGG - Intronic
901100305 1:6714894-6714916 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
901223869 1:7600869-7600891 GTGTAGAAAGAGGTAGACATGGG - Intronic
901271222 1:7953488-7953510 GTGTGGATAGAAGTAGACATGGG + Intergenic
901341963 1:8502695-8502717 GTGTGGATAGAAGTAGATATGGG + Intronic
901726891 1:11249805-11249827 GTGTAGAAAGAGGTAGACATGGG - Intronic
901827634 1:11872750-11872772 GTGAGGACAGAGTCAGAGATGGG - Intergenic
901937080 1:12634334-12634356 GTGAGGACAGAGGCAGAGACTGG + Intergenic
902019157 1:13329684-13329706 GTGTGGATAGAAGTAGACATGGG + Intergenic
902093031 1:13919227-13919249 GTCAGGACAGAGGTCGTGCTTGG - Intergenic
902674012 1:17995816-17995838 GTGATGACAGAGGCAGAGATTGG - Intergenic
902704400 1:18194550-18194572 GTGACCACAGAGGCAGAGCTTGG - Intronic
902754764 1:18541618-18541640 GTGACGACAGAGGTAGGGATTGG - Intergenic
903103673 1:21054077-21054099 GTGTAGAAAGAGGTAGACATGGG + Intronic
903458490 1:23504578-23504600 GTGTAGAAAGAGGTAGACATGGG + Intergenic
903637423 1:24832665-24832687 GTGTGGATAGAAGTAGACATGGG - Intronic
903748659 1:25604554-25604576 GTGTAGAAAGAGGTAGACATGGG + Intergenic
903962485 1:27065152-27065174 GTGTGGATAGAAGTAGACATGGG + Intergenic
904377040 1:30088183-30088205 GTGAGGACACAGGTGGTGCTGGG + Intergenic
904378812 1:30097548-30097570 GTGTGGGGAGAGGGAGAGTTGGG + Intergenic
904410889 1:30324243-30324265 CGGTGGTCAGAGGAAGAGCTGGG - Intergenic
904532334 1:31177270-31177292 GTGTGGAAAGAAGTAGACATGGG + Intergenic
904760896 1:32804125-32804147 GTGTGGAAAGAGGTAGACATGGG - Intronic
904784290 1:32973858-32973880 GTGTGGATAGAAGTAGACATGGG - Intergenic
904891891 1:33785439-33785461 GTGTGGAAAGTAGCAGAGCTGGG - Intronic
905099755 1:35509488-35509510 GTGATGACAGAGGCAGAGATTGG + Intronic
905427732 1:37897341-37897363 GTGTAGAAAGAGGTAGACATGGG + Intronic
905686511 1:39912862-39912884 GTGTAGAAAGAGGTAGACATGGG - Intergenic
906036169 1:42751176-42751198 GTGTGGATAGAAGTAGACATGGG + Intronic
906356870 1:45115030-45115052 GTGTGGAAAGAGGTGGACATGGG - Intronic
906370429 1:45248481-45248503 GTGTGGAAAGAAGTAGACATGGG + Intronic
906427567 1:45725696-45725718 GTGTGGATAGAAGTAGACATGGG + Intronic
906429063 1:45740209-45740231 GTGTAGAAAGAGGTAGACATGGG - Intronic
906518842 1:46455662-46455684 CTGTGGCCAGAGGCAGGGCTCGG + Intergenic
906740230 1:48174714-48174736 GTGTGGAAAGAGGTGGAAATGGG + Intergenic
906761311 1:48382092-48382114 GTGTGGATAGAAGTAGACATGGG - Intronic
907089455 1:51711093-51711115 GTGTGGAAAGAAGTAGACATGGG - Intronic
907216502 1:52869631-52869653 GTGTAGAAAGAGGTAGACATGGG - Intronic
907525394 1:55050982-55051004 GTGGAGACAGAGGTGGAGATTGG + Intronic
907573132 1:55502185-55502207 GTGAAGACAGAGGCAGAGGTTGG - Intergenic
908446385 1:64201878-64201900 GTGTGGATAGAAGTAGACATGGG + Intergenic
908806618 1:67938786-67938808 GTGAAGACAGAGGCAGAGGTTGG + Intergenic
909478747 1:76111825-76111847 GTGTAGAAAGAGGTAGACATGGG - Intronic
909563937 1:77034278-77034300 GTGATGACAGAGGCAGAGATTGG - Intronic
909640759 1:77869329-77869351 GTGTGGATAGAAGTAGACATGGG - Intronic
910310962 1:85824193-85824215 GTGAAGACAGAGGCAGAGATTGG + Intronic
910406727 1:86899172-86899194 GTGTGGAAAGAAGTAGACATGGG - Intronic
910739882 1:90503600-90503622 GTGGGGACAGAGCCAGTGCTGGG - Intergenic
911351534 1:96762116-96762138 GTGTAGAAAGAGGTAGACATGGG - Intronic
911882149 1:103253502-103253524 GTGAAGACAGAGGCAGAGATTGG + Intergenic
912266079 1:108159852-108159874 GTGTAGAAAGAGGTAGACATGGG - Intronic
912302876 1:108535863-108535885 GTGTAGAAAGAGGTAGACATGGG - Intergenic
912371385 1:109176992-109177014 GTGTAGAAAGAGGTAGACATGGG - Intronic
912660905 1:111529755-111529777 GTGTAGAAAGAGGTAGACATGGG - Intronic
912668817 1:111607398-111607420 GTGTAGAAAGAGGTAGACATGGG - Intronic
912752226 1:112294633-112294655 GTGTGGATAGAAGTAGACATGGG + Intergenic
912948037 1:114100905-114100927 GTATGGAAATAGGTAGAGCAGGG - Intronic
912968919 1:114262007-114262029 GTGGGTGCAGAGGTAGAGGTAGG - Intergenic
913021038 1:114790348-114790370 GTGTAGAAAGAGGTAGACATGGG - Intergenic
913549831 1:119906703-119906725 CTGTGGGAAGAGGCAGAGCTGGG + Intergenic
913994330 1:143639204-143639226 GTGTGGATAGAAGTAGACATGGG + Intergenic
914002468 1:143703746-143703768 GTGTAGAAAGAGGTAGACATGGG + Intergenic
914231228 1:145766381-145766403 GTGTAGAAAGAGGTAGACATGGG - Intronic
914467933 1:147949147-147949169 GTGTGGAAAGAGGTAGACCCGGG - Intronic
914888379 1:151601330-151601352 GTGTGGATAGAAGTAGACATGGG + Intergenic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915070246 1:153260675-153260697 CAGTGGTCAGAGGCAGAGCTGGG + Intronic
915120356 1:153626661-153626683 GAGAGGACAGGGGTTGAGCTTGG + Intronic
915208492 1:154288019-154288041 GTGTAGAAAGAGGTAGACATGGG + Intergenic
915322288 1:155062486-155062508 GAGAGGTCAGAGGTAGAGCGAGG - Exonic
915539886 1:156558730-156558752 GTGTGGATAGAAGTAGACATGGG + Intronic
916049001 1:161021713-161021735 GGGTGGACAGAGGAACAGTTTGG - Intronic
916105113 1:161423907-161423929 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
916223517 1:162466424-162466446 GTGTGGAGAGAGGTAGACATGGG + Intergenic
916490374 1:165297151-165297173 GAGTGAACAGAGGTAGAGACAGG - Intronic
916542836 1:165773653-165773675 GTGTGCACAGGTGTAGAGCTAGG + Intronic
916785395 1:168083494-168083516 GTGTGCACAGAGGTGGAACAGGG - Exonic
916864208 1:168837728-168837750 GTGTGGAAAGAGGTAGACGTGGG + Intergenic
917006337 1:170419487-170419509 GTGTGGAAAGAAGTAGACATGGG + Intergenic
917206128 1:172572307-172572329 GTGTGGAAAGAGGTAGACACGGG + Intronic
917375497 1:174348845-174348867 GTGTAGAAAGAGGTAGACATGGG - Intronic
917860193 1:179136317-179136339 GTGTAGAAAGAGGTAGACATGGG + Intronic
918254961 1:182740941-182740963 GTGTAGAAAGAGGTAGACATGGG - Intergenic
918971078 1:191420275-191420297 GTGAAGACAGAAGTAGAGATTGG + Intergenic
919080323 1:192857992-192858014 GTGTAGAGAGAGGTAGACGTGGG + Intergenic
919474890 1:198020964-198020986 GTGGAGACAGAGGCAGAGATTGG - Intergenic
919767988 1:201139586-201139608 GTGTGGCCAGAGGCTGGGCTGGG - Intronic
919862323 1:201748475-201748497 CTGAGGCCAGGGGTAGAGCTTGG - Intronic
919925733 1:202191209-202191231 GTGTAGAAAGAGGTAGACATGGG - Intergenic
919929563 1:202212585-202212607 GTGAAGACAGAGGCAGAGATTGG - Intronic
920152100 1:203918952-203918974 GTGTAGAAAGAGGTAGACATGGG - Intergenic
920345095 1:205301372-205301394 GTGGGGCCAGAGCCAGAGCTGGG + Intergenic
920795146 1:209129811-209129833 GTGTGGAAAGAAGTAGACATGGG + Intergenic
920858941 1:209689215-209689237 GGGTGGAGAGGGGTAGAGCTAGG - Intronic
921016620 1:211197612-211197634 GTGTGGAAAGAAGTAGACATAGG + Intergenic
921139951 1:212298206-212298228 GTGTGGATAGAAGTAGACATGGG - Intronic
921142279 1:212320332-212320354 GTGTAGAAAGAGGTAGACATGGG - Intronic
921331528 1:214043374-214043396 CTGTGAACAGAGGGAGGGCTGGG - Intergenic
921439800 1:215172481-215172503 GTGTTGAAGGAGGTAGAGATGGG - Intronic
921638243 1:217523560-217523582 GTGTAGAAAGAGGTAGACATGGG - Intronic
922503676 1:226114686-226114708 GTGTAGAAAGAGGTAGACATGGG - Intergenic
922766033 1:228157178-228157200 GTGTGGAGGGAGGCAGAGCAGGG + Intronic
922823110 1:228497962-228497984 GTGACGAGAGAGGAAGAGCTCGG - Intergenic
922992965 1:229931703-229931725 GTGTGGCAAGAGGTAGACATGGG - Intergenic
923268223 1:232332694-232332716 GTGTAGAAAGAGGTAGACATGGG + Intergenic
923404367 1:233645471-233645493 GTGGAGACAGAGGCAGAGATTGG + Intronic
923468105 1:234267265-234267287 GTGTGGATAGAAGTAGACATGGG - Intronic
923716366 1:236428357-236428379 GTGTGGAAAGAAGTAGACATAGG - Intronic
923749263 1:236732363-236732385 GTGAAGACAGAGGGAGAGATTGG - Intronic
924474514 1:244371442-244371464 GTGTGGAGAGAGGGATGGCTGGG - Intronic
924788457 1:247220854-247220876 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1063084705 10:2806351-2806373 GTGTGGATAGAAGTAGACATGGG - Intergenic
1063369848 10:5514085-5514107 GTCTGGACAGAGGCAGAGGGAGG - Intergenic
1063438787 10:6055590-6055612 GTGTAGAGAGAGGTAGACATGGG - Intronic
1064601526 10:16998352-16998374 GTGTGGATAGAGGCAGAAATTGG + Intronic
1065471960 10:26091274-26091296 ATGTGGTCAGAGATTGAGCTGGG - Intronic
1065738151 10:28772269-28772291 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1066063685 10:31746364-31746386 GTGAAGACAGAGGTAGAGCTGGG - Intergenic
1066085886 10:31971222-31971244 GTGTGGATAGAAGTAGACATGGG + Intergenic
1066437293 10:35406616-35406638 GTGTAGAAAGAGGTAGACATGGG - Intronic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1066748981 10:38633529-38633551 TTGTGTACAGAGGTAGGGATTGG + Intergenic
1066967683 10:42284256-42284278 TTGTGTACAGAGGTAGGGATTGG - Intergenic
1067026644 10:42847943-42847965 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1067328196 10:45289849-45289871 GTGAAGACAGAGGAAGAGATTGG - Intergenic
1067339925 10:45392315-45392337 GTGTAGAAAGAGGTAGACATGGG + Intronic
1067520601 10:46999462-46999484 GTGTGGACACCAGTACAGCTGGG - Intronic
1067673199 10:48345480-48345502 GTGTGAACAGAATTAGATCTTGG - Intronic
1067758727 10:49026704-49026726 GTGTTGACAGGGGCAGGGCTGGG + Intronic
1068612078 10:59071218-59071240 GTGATGACAGAGGTAGATATTGG + Intergenic
1068668150 10:59697340-59697362 GTGTAGAAAGAGGTAGACATGGG + Intronic
1068969968 10:62948700-62948722 GTGTGGATAGAAGTAGACGTGGG + Intergenic
1069365900 10:67692347-67692369 GTGTAGAAAGAGGTAGACATGGG + Intronic
1069645227 10:69992464-69992486 GTGTGGATAGAAGTAGACATGGG - Intergenic
1069770323 10:70894429-70894451 GTGAAGACAGAGGCAGAGATAGG - Intergenic
1069789191 10:71008801-71008823 AAGTGGCCAGAGGCAGAGCTAGG + Intergenic
1069928717 10:71869045-71869067 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1069929916 10:71875533-71875555 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1070135602 10:73690215-73690237 GTGTAGAAAGAGGTAGACATGGG + Intronic
1070310595 10:75270844-75270866 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1070683938 10:78468315-78468337 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1070966859 10:80535171-80535193 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1071472592 10:85994316-85994338 GAGTGGACAGAGGTAAGGCAGGG + Intronic
1071616766 10:87081554-87081576 GTGTGGAAAGAAGTAGACATGGG + Intronic
1072291853 10:93971218-93971240 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1072481844 10:95816594-95816616 GTGAAGACAGAGGTGGAGATTGG + Intronic
1072602036 10:96940702-96940724 GTGTGGATAGAAGTAGACATGGG - Intronic
1073046389 10:100641435-100641457 GTGAGGACAGAGGCAGAGATGGG - Intergenic
1073449406 10:103600756-103600778 GTGTGGACTGTGCTGGAGCTTGG - Exonic
1073597592 10:104816689-104816711 GTGAGGAAAGAGGGAGGGCTTGG + Intronic
1073865697 10:107801140-107801162 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1074151858 10:110766712-110766734 GTGTAGAAAGAGGTAGACATGGG - Intronic
1074281889 10:112059873-112059895 GTGAGGACGGAGGCAGAGGTTGG - Intergenic
1074588237 10:114787937-114787959 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1075136840 10:119794406-119794428 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1075181317 10:120214852-120214874 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1075407172 10:122203046-122203068 GTGTAGAAAGAGGTAGACATGGG - Intronic
1075449529 10:122540080-122540102 GTGGCTACAGAGGTAGAGCTAGG + Intergenic
1075842871 10:125518795-125518817 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1076228199 10:128797888-128797910 GTGAGGACAGAGGCAGAGACAGG + Intergenic
1077274875 11:1699968-1699990 GTGGGGGCAGAGGTAGTGCAGGG + Intergenic
1077522339 11:3043726-3043748 GTGTGGCCTGAGCTAGAGCCGGG - Intronic
1077643965 11:3907086-3907108 GTGGGGACAGGGTTAGAGGTTGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078048727 11:7943060-7943082 GACTGGACAGAAGTAGAACTAGG + Intergenic
1078935487 11:15945773-15945795 GTGCTCAGAGAGGTAGAGCTGGG - Intergenic
1079020884 11:16907871-16907893 GTGTAGAAAGAGGTAGACATGGG + Intronic
1079114058 11:17629353-17629375 GTGGGGGCAGAGGTGGACCTGGG - Intronic
1079174042 11:18121607-18121629 GTGTGGAAAGAAGTAGACATGGG + Intronic
1079371741 11:19859527-19859549 GTGTAGAAAGAGGTAGACATGGG - Intronic
1079427374 11:20356508-20356530 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1079445086 11:20549219-20549241 GTGTGGATAGAAGTAGACATGGG + Intergenic
1079584500 11:22108999-22109021 GTGTGTACAGAAGTATGGCTGGG - Intergenic
1080860418 11:36145613-36145635 GTGTAGAAAGAGGTAGACATGGG + Intronic
1081348501 11:42019880-42019902 GGTTGGACAGAGGGAGAACTTGG + Intergenic
1081668015 11:44927781-44927803 ATTTGGAGAGAGGCAGAGCTGGG - Intronic
1081950070 11:47037773-47037795 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1083036746 11:59645167-59645189 GTGTAGAAAGAGGTAGACATGGG - Intronic
1083090962 11:60200677-60200699 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1083294357 11:61707193-61707215 GTGTGGTGGGAGGTGGAGCTGGG - Intronic
1083717179 11:64584132-64584154 GTGTGGACAGAGTTAGGTTTGGG - Intergenic
1083739813 11:64702408-64702430 GTGTAGAAAGAGGTAGACATGGG + Intronic
1083865816 11:65452079-65452101 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1083893492 11:65608492-65608514 GTGGGGACAGGGTAAGAGCTGGG + Intronic
1084171644 11:67403971-67403993 GTGGGGACAGGGGCAGGGCTTGG + Intronic
1084520801 11:69661518-69661540 GTGAGGACAGAGGCCGAGTTTGG - Intronic
1084624085 11:70294941-70294963 GTGTGGAAAGAAGTAGACATGGG - Intronic
1084745420 11:71167175-71167197 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1085111805 11:73896685-73896707 GTGTAGAAAGAGGTAGACATGGG - Intronic
1085292251 11:75409572-75409594 GTGTGGATAGAAGTAGACATGGG - Intronic
1085359810 11:75877236-75877258 GTGTGGAAAGAAGTAGACATGGG - Intronic
1085448886 11:76619451-76619473 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1085582311 11:77664580-77664602 GTGTGTCCAGAGGTAGAGACAGG + Exonic
1086017369 11:82182471-82182493 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1086122221 11:83315993-83316015 GTGTAGAGAGAGGTAGACATGGG - Intergenic
1086430654 11:86732754-86732776 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1086792987 11:91064096-91064118 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1087056993 11:93946474-93946496 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1087081369 11:94174047-94174069 GTGATGACAGAGGTAGAGACTGG - Intronic
1087130268 11:94663449-94663471 GTGGTGACAGAGGCAGAGATGGG + Intergenic
1087652801 11:100887945-100887967 GATTGGATAGAGGTAGAGATGGG - Intronic
1088257300 11:107913082-107913104 GTGTGGAAAGAAGTAGACATGGG + Intronic
1088658800 11:112026701-112026723 GTGTAGAAAGAGGTAGACATGGG - Intronic
1088821719 11:113462486-113462508 GTGAAGACAGAGGCAGAGATTGG + Intronic
1089003195 11:115069052-115069074 GTGAGGACAGAGGCAGAGATGGG + Intergenic
1089264660 11:117251001-117251023 GTGTAGAAAGAGGTAGACATGGG - Intronic
1089345974 11:117792134-117792156 GGATGGACAGAGGTAGAGAGGGG - Intronic
1089362442 11:117899992-117900014 GGGGGTACAGAGGTGGAGCTGGG + Intergenic
1089520329 11:119059003-119059025 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1089585376 11:119507376-119507398 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1089978176 11:122750751-122750773 ATCTTGACAGAAGTAGAGCTTGG - Intronic
1090036193 11:123251795-123251817 GTGACGACAGAGGCAGAGATTGG + Intergenic
1090241160 11:125182814-125182836 GTGGAGACAGAGGTATAGATTGG + Intronic
1090437976 11:126702733-126702755 GTGTGGTCAGAGATACAGCGGGG - Intronic
1090511090 11:127376220-127376242 GAGTGGACAGAAGCAGGGCTGGG + Intergenic
1090785425 11:130044013-130044035 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1090906781 11:131084030-131084052 GTGTGGATAGAAGTAGACATGGG - Intergenic
1091378899 12:42910-42932 GTGTGGATAGAAGTAGACATGGG + Intergenic
1091690326 12:2591898-2591920 GTGAAGACAGAGGCAGAGATTGG - Intronic
1092402069 12:8184959-8184981 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1092454047 12:8626377-8626399 GTGTGGATAGAAGTAGACATGGG + Intergenic
1092827332 12:12413467-12413489 GTGTGGATGGAGGTAGACATGGG - Intronic
1093453413 12:19340560-19340582 GTGTAGAAAGAGGTAGACATGGG + Intronic
1093761964 12:22920904-22920926 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1094103634 12:26786060-26786082 GTGTGGATAGAAGTAGACATGGG + Intronic
1094209522 12:27874469-27874491 GTGTAGACAGAGGTAGACATGGG + Intergenic
1094238868 12:28200661-28200683 GTGTAGAAAGAGGTAGACATGGG - Intronic
1094520353 12:31180630-31180652 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1094566006 12:31598992-31599014 GTGAAGACAGAGACAGAGCTTGG + Intergenic
1095267210 12:40174436-40174458 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1095891147 12:47235918-47235940 GTGGGGACAGAGGTAAGGCCGGG - Exonic
1096064084 12:48725173-48725195 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1096082672 12:48842905-48842927 GTGTAGAAAGAGGTAGACATGGG + Intronic
1096167174 12:49436029-49436051 GTGTAGAAAGAGGTAGACATGGG - Intronic
1096228979 12:49887127-49887149 CTGTAGACAGAGGCAAAGCTGGG - Intronic
1096416588 12:51419704-51419726 ATTTGGACAGAGGCAGAGGTAGG - Intronic
1096441307 12:51645563-51645585 GTGTAGAAAGAGGTAGACATGGG + Intronic
1096557167 12:52410298-52410320 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1097149286 12:56964131-56964153 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1097228495 12:57494892-57494914 GTGTGGAAAGAAGTAGACATAGG - Intronic
1097230304 12:57507238-57507260 GTGTAGAAAGAGGTAGACATGGG - Intronic
1097945313 12:65361341-65361363 GGGTGGAAAGTGGGAGAGCTGGG + Intronic
1098242663 12:68484524-68484546 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1098975486 12:76897619-76897641 GGGTGTACAGAGATAGATCTGGG + Intergenic
1099255159 12:80307194-80307216 GTGTAGAAAGAGGTAGACATGGG - Intronic
1099864633 12:88264255-88264277 GTGATGGCAGAGGTAGAGTTTGG + Intergenic
1100003600 12:89867483-89867505 GTGTGGATAGAAGTAGACATGGG - Intergenic
1100507322 12:95235044-95235066 GTGTAGAAAGAGGTAGACATGGG - Intronic
1100570201 12:95840226-95840248 GTGTGGATAGAAGTAGACATGGG - Intergenic
1100577468 12:95907210-95907232 GTGTAGAAAGAGGTAGACATGGG - Intronic
1100582560 12:95948738-95948760 GTGTGGAAAGAAGTAGACATGGG + Intronic
1100606847 12:96158509-96158531 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1100772343 12:97937286-97937308 GTGAAGACAGAGGCAGAGATCGG - Intergenic
1101069026 12:101053582-101053604 GTGAAGACAGAGGCAGAGATAGG - Intronic
1101209789 12:102524337-102524359 ATGTGGATAGAGGAACAGCTGGG + Intergenic
1101421773 12:104556595-104556617 GTGAGGATAGAGGCAGAGCCTGG - Intronic
1101546520 12:105718478-105718500 GTGGGGACAGAGGTAAACATTGG - Intergenic
1101558186 12:105830611-105830633 GTGATGACAGAGGCAGAGATAGG - Intergenic
1101963983 12:109269565-109269587 GTGTGGACAGAGGTCTTGTTGGG + Intergenic
1101984466 12:109434774-109434796 GTGAGGACGGAGGCAGAGATTGG - Intronic
1102089520 12:110173571-110173593 GTGTGGAAAGAAGTAGACATGGG + Intronic
1102310060 12:111837695-111837717 GTGAAGACAGAGGAAGAGCCTGG + Intergenic
1102590783 12:113955366-113955388 GTCTGGCCAGAGGTGGGGCTAGG + Intronic
1102661884 12:114536314-114536336 GTGAGGACAGAGGCAGAAGTTGG + Intergenic
1102665800 12:114571709-114571731 GTGAGGACAGAGGCAGAAGTTGG - Intergenic
1102692712 12:114773907-114773929 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1102780011 12:115556178-115556200 GTAAAGACAGAGGCAGAGCTTGG - Intergenic
1102855609 12:116290521-116290543 TTCTGGACAGAGGTAGAGTGAGG - Intergenic
1103033068 12:117633632-117633654 GTGAGGACAGAGGCAGAGATTGG - Intronic
1103045509 12:117731644-117731666 GTGTGGAAAGAGGTAGACATGGG + Intronic
1103535949 12:121634077-121634099 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1103641923 12:122358046-122358068 GTGTAGAAAGAGGTAGACATGGG + Intronic
1103682851 12:122708642-122708664 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1103982771 12:124747231-124747253 GTGTGGACAGATGTGCACCTGGG + Intergenic
1104439174 12:128781222-128781244 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1104523345 12:129495737-129495759 GTGGGGACAGGGGTAGTGATGGG + Intronic
1104674022 12:130700561-130700583 GTGGAGACAGAGGCAGAGGTGGG + Intronic
1104861367 12:131926122-131926144 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1105405070 13:20126976-20126998 GTGTGGTGAGAGGTAGAGGAGGG - Intergenic
1105976652 13:25479878-25479900 GTGTGGAAAGAAGTAGACATGGG - Intronic
1105980224 13:25512267-25512289 GTGTAGAAAGAGGTAGACATGGG - Intronic
1106104935 13:26724423-26724445 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1106459185 13:29953654-29953676 CCGGGTACAGAGGTAGAGCTTGG + Intergenic
1106495490 13:30270529-30270551 GTGTAGAAAGAGGTAGACATGGG + Intronic
1106559871 13:30838970-30838992 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1106599025 13:31171634-31171656 GTGTGGAGTCAGGCAGAGCTGGG + Intergenic
1107493479 13:40901503-40901525 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1107499231 13:40956180-40956202 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1107588725 13:41881451-41881473 GTGTAGAAAGAGGTAGACATGGG - Intronic
1108139255 13:47401381-47401403 GTGTTTACATAGGTAGAGATAGG - Intergenic
1108610667 13:52080499-52080521 GTGTAGAAAGAGGTAGACATGGG + Intronic
1109915314 13:68977412-68977434 TAGTGAACAGAGGTAGAGCTAGG + Intergenic
1110242364 13:73283305-73283327 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1110387219 13:74927529-74927551 GTGAAGATAGAGGTAGAGATTGG - Intergenic
1110525510 13:76531990-76532012 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1110542190 13:76719065-76719087 GTGTGTGTAGAGGTAGTGCTGGG - Intergenic
1111083233 13:83339997-83340019 GTAAGGACAGAGGCAGAGTTTGG + Intergenic
1111182318 13:84685509-84685531 ATGTGAACAGAGGTAGATTTTGG + Intergenic
1111201664 13:84945775-84945797 AGCTGGACAGAGGCAGAGCTGGG + Intergenic
1111418080 13:87975997-87976019 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1111835789 13:93386881-93386903 GTGAAGACAGAGGCAGAGATTGG - Intronic
1111850965 13:93574336-93574358 GTGACGACAGAGGAAGAGATTGG + Intronic
1112770775 13:102792653-102792675 GTGATGACAGAGGCAGAGATGGG + Intronic
1113263321 13:108590713-108590735 GTGAAGACAGAGGTGGAGATCGG + Intergenic
1113478842 13:110606045-110606067 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1113721526 13:112561326-112561348 GTGTGGAAAGAGCTAAAGGTTGG - Intronic
1113853148 13:113429293-113429315 GTGGGGACAGAGCTACAGTTTGG - Intronic
1113868256 13:113543151-113543173 GTCCGGACAGAGGTAGGGCGGGG - Intronic
1113915333 13:113867312-113867334 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1114131645 14:19799980-19800002 GTCTGGACAGAGCTGCAGCTAGG + Intronic
1114199556 14:20507221-20507243 GTGTGGATAGAAGTAGACATGGG + Intronic
1114336735 14:21698185-21698207 GTGTGGAAAGAAGTAGACATAGG + Intergenic
1114428089 14:22638260-22638282 GTGTGGATAGAAGTAGACATGGG + Intergenic
1114452322 14:22835556-22835578 GAGAGGACAGAGGTAGTGCGAGG - Intergenic
1115493841 14:33984175-33984197 GTGTAGAAAGAGGTAGACATGGG - Intronic
1115847392 14:37555028-37555050 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1115910319 14:38249348-38249370 GTGACAACAGAGGTAGAGATTGG + Intergenic
1116191377 14:41673102-41673124 GTGTAGAAAGAGGTAGACATGGG - Intronic
1116478961 14:45374485-45374507 AAGTGTACAGAGGCAGAGCTGGG - Intergenic
1116585089 14:46693461-46693483 GTGACCACAGAGGTAGAGATTGG - Intergenic
1117010581 14:51467352-51467374 GTGTGGAAAGAAGTAGACATAGG - Intergenic
1117277495 14:54204510-54204532 GTGCGGAGAGAGGTAGACATGGG + Intergenic
1117334181 14:54742625-54742647 GTGTGAAGAGGGGTAGAGATTGG + Intronic
1117411586 14:55456082-55456104 GTGTAGAAAGAGGTAGACATGGG - Intronic
1117597106 14:57334404-57334426 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1117680357 14:58197517-58197539 GTGATGACAGAGGCAGAGATTGG + Intronic
1118046706 14:61978025-61978047 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1118340697 14:64894530-64894552 GTGTGGATAGAAGTAGACATGGG - Intergenic
1118438007 14:65789144-65789166 ATGTGGACAGAGGTCGAGGCTGG + Intergenic
1118551936 14:66961807-66961829 TTGTGGACAGATGTATAGATTGG + Intronic
1119693193 14:76692692-76692714 GTGAGCACAGAGGAAGAGATTGG - Intergenic
1119797975 14:77416589-77416611 GTGTAGAAAGAGGTAGACATGGG - Intronic
1119963774 14:78889975-78889997 GTGAAGACAGAGGCAGAGATTGG + Intronic
1120221746 14:81742076-81742098 GTGTAGAAAGTGGTAGGGCTGGG - Intergenic
1120238389 14:81919257-81919279 GTGATGACAGAGGCAGAGATTGG - Intergenic
1120547494 14:85829547-85829569 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1120916346 14:89713826-89713848 GTGGGGACATGGGTGGAGCTGGG - Intergenic
1121285117 14:92729227-92729249 GTGGGGACAGAGGCAGACCTGGG - Intronic
1121409122 14:93737346-93737368 GTGGGGCAAGAGGTAGAGTTGGG + Exonic
1121512658 14:94523759-94523781 GTGACGACAGAGGCAGAGATTGG - Intergenic
1121531693 14:94658491-94658513 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1121832972 14:97067738-97067760 GTGTGCTCAGAGGCAGAGCCTGG + Intergenic
1122212489 14:100181537-100181559 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1122238354 14:100345279-100345301 GTGTAGAAAGAGGTAGACATGGG + Intronic
1122355297 14:101119560-101119582 GTGTGGTCAGGGGCAGAGCTGGG + Intergenic
1122568000 14:102676097-102676119 GTGTGGATAGAAGTAGACATGGG - Intronic
1122826691 14:104374118-104374140 GTGAGGACAGAGGCAGAGTCGGG - Intergenic
1123049293 14:105532851-105532873 GTGTGGACGGAGATGCAGCTGGG + Intergenic
1125017099 15:34947118-34947140 GTGTAGAAAGAGGTAGACATGGG + Intronic
1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG + Intronic
1125877880 15:43166923-43166945 GTGTAGAAAGAGGTAGACATGGG - Intronic
1126295886 15:47133813-47133835 GTGTGGATAGAAGTAGACATGGG + Exonic
1126336456 15:47590692-47590714 GTGATGACAGAGGCAGAGCTTGG + Intronic
1126465498 15:48957886-48957908 GTGAAGACAGAGGCAGAGATTGG + Intronic
1126516896 15:49549706-49549728 GTGTAGAAAGAGGTAGACATGGG - Intronic
1126692028 15:51294929-51294951 GTGTAGAAAGAGGTAGACATGGG + Intronic
1126799554 15:52286548-52286570 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127073379 15:55304070-55304092 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127154667 15:56111255-56111277 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127362923 15:58260827-58260849 GTGTGGACAGAGCTGGGACTGGG + Intronic
1127584801 15:60367919-60367941 GTGTGGATAGAAGTAGACATGGG + Intronic
1127644776 15:60947301-60947323 GTGTGGAAAGAGGTAGACATAGG + Intronic
1127782773 15:62331961-62331983 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1128116740 15:65112287-65112309 GGGTAGACTGGGGTAGAGCTGGG + Intronic
1128586756 15:68859285-68859307 GTGTAGAAAGAGGTAGACATGGG - Intronic
1128597225 15:68964062-68964084 GTGTAGAAAGAGGTAGACATGGG - Intronic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1129313907 15:74729427-74729449 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1129341222 15:74888187-74888209 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1129775799 15:78235518-78235540 GTGAGGACAGAGGCAGAGGCTGG - Intronic
1129812237 15:78520625-78520647 GTGTAGAAAGAAGTAGACCTGGG - Intronic
1130340543 15:82997589-82997611 GTGTGGAAAGAAGTAGACATGGG - Intronic
1130428102 15:83821629-83821651 GTGTAGAAAGAGGTAGACATGGG - Intronic
1130630678 15:85565755-85565777 GAGTGGACAGAGAGAGAGCAGGG + Intronic
1130926045 15:88386601-88386623 GTGTGGAGGGAGGAAGAGTTGGG + Intergenic
1130942785 15:88524568-88524590 GTGTGGAAAGAGGTAGACATGGG + Intronic
1131296579 15:91154706-91154728 GTGATGACAGAAGTAGAGATTGG + Intronic
1131459320 15:92607160-92607182 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1131479164 15:92767859-92767881 GTGTAGAAAGAGGTAGACATGGG - Intronic
1131677019 15:94680944-94680966 GTGAGGACAGAGGATGAACTGGG - Intergenic
1132300674 15:100773929-100773951 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132408958 15:101562250-101562272 GTGTCCACAGAGGAAGAGCGTGG - Intergenic
1132600746 16:771710-771732 GTGAGGATGGAGGCAGAGCTGGG + Intronic
1132744233 16:1430095-1430117 GTGAGGACAGAGGCAGAGACTGG + Intergenic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1132894085 16:2219722-2219744 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132921736 16:2399698-2399720 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132944161 16:2523350-2523372 GTGTGGGCAGAGCCAGAGCTGGG + Intronic
1132992136 16:2801727-2801749 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1133364698 16:5202134-5202156 GTGTGGATAGAAGTAGACATGGG - Intergenic
1133403832 16:5507752-5507774 GTGAAGACAGAGGCAGAGGTGGG + Intergenic
1133680514 16:8115530-8115552 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1133730999 16:8578396-8578418 GTGTGGATGGAGGTAGGGATTGG - Intronic
1133962974 16:10510558-10510580 GTGAAGACAGAGGTGGAGATTGG + Intergenic
1134082580 16:11335471-11335493 GTGTAGAAAGAGGTAGACATGGG - Intronic
1134091095 16:11392105-11392127 GTGAGGACAGAGGAAGAGGCTGG + Intronic
1134106834 16:11491650-11491672 GTGTGGGCAGGGGTGGGGCTGGG - Intronic
1134345153 16:13383824-13383846 GTGTTGGTAGAGGTAGAGATGGG + Intergenic
1134372258 16:13636537-13636559 GTGAAGACAGAGGCAGAGATGGG - Intergenic
1134471758 16:14532553-14532575 GTGTGGAGAGAGGTAGACATGGG - Intronic
1135052879 16:19206705-19206727 GTGAGGACAGAGGTGGAGGCTGG - Intronic
1135545836 16:23365850-23365872 CTGTTGACAGTGGCAGAGCTTGG + Intronic
1136593814 16:31233027-31233049 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1136733776 16:32443771-32443793 TTGTGTACAGAGGTAGGGATTGG - Intergenic
1137304107 16:47181790-47181812 GTGTAGAAAGAGGTAGACATGGG + Intronic
1137499255 16:48997825-48997847 GGGTGGAGAGAGGAAGAGCAGGG - Intergenic
1137522889 16:49210042-49210064 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1137932949 16:52605846-52605868 GTGATTACAGAGGCAGAGCTTGG + Intergenic
1138043708 16:53698996-53699018 GTGTGGAAAGAAGTAGACATGGG + Intronic
1138261310 16:55625138-55625160 GTGTGGAGGGAGATAGAGGTAGG + Intergenic
1138466956 16:57200292-57200314 GTGTAGAAAGAGGTAGACATGGG - Intronic
1138949412 16:61893170-61893192 TTGAGGACAGAGGCAGAGATTGG - Intronic
1139084779 16:63571582-63571604 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1139340136 16:66263051-66263073 GTGGAGACAGAGGCAGAGATTGG - Intergenic
1139623052 16:68163124-68163146 GTGTAGAAAGAGGTAGACATGGG - Intronic
1139864784 16:70052556-70052578 GTGTGGATAGAAGTAGACATGGG + Intergenic
1140161277 16:72497128-72497150 GTGTGGATAGAAGTAGACATGGG + Intergenic
1140994527 16:80244416-80244438 GTGTAGAGAGAGGTAGACATGGG + Intergenic
1141019310 16:80480020-80480042 GTGAAGACAGAGGCAGAGATGGG + Intergenic
1141275999 16:82588813-82588835 GTGTGGATGGAGGCTGAGCTTGG + Intergenic
1141788709 16:86218530-86218552 GTGGAGACAGAGGCAGAGGTTGG + Intergenic
1141936284 16:87240795-87240817 GTGAGGATGGAGGAAGAGCTGGG + Intronic
1142011864 16:87719277-87719299 GTGTGCAAAGAGGTAGACATGGG + Intronic
1142253117 16:89001872-89001894 GTGCGGACAGAGGCAGAGATGGG - Intergenic
1142265136 16:89060995-89061017 GTGCGGACAGATGTGGAGCTTGG - Intergenic
1142308060 16:89296712-89296734 GTGTAGACAGACGAAGAGCCTGG - Intronic
1203019307 16_KI270728v1_random:385830-385852 TTGTGTACAGAGGTAGGGATTGG + Intergenic
1203037642 16_KI270728v1_random:658988-659010 TTGTGTACAGAGGTAGGGATTGG + Intergenic
1142529963 17:572636-572658 GTGTGGAAAGAAGTAGACATGGG + Intronic
1142657329 17:1403032-1403054 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1142818958 17:2448351-2448373 GTGTGGATAGAAGTAGACATGGG + Intronic
1142825585 17:2507734-2507756 GTGTAGAAAGAGGTAGACATGGG + Intronic
1142891903 17:2949091-2949113 GTGGGGACAGGGGTGGAACTTGG + Intronic
1142913025 17:3112224-3112246 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1142939502 17:3371003-3371025 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1143746511 17:8998412-8998434 GTGAGTAGAGAGGCAGAGCTGGG + Intergenic
1144145474 17:12393689-12393711 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1144510164 17:15867979-15868001 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1144524529 17:15979375-15979397 GTGTGGAAAGAAGTAGACATGGG - Intronic
1144559678 17:16311844-16311866 GTGTAGAAGGAGGTAGACCTGGG - Intronic
1144642096 17:16943297-16943319 GTGAAGACAGAGGCAGAGATGGG + Intronic
1144782986 17:17817137-17817159 CTATGGACAGAGGGAAAGCTGGG + Intronic
1144860565 17:18298661-18298683 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1144960051 17:19039751-19039773 GTGGGGTCAGAGGGAGGGCTGGG - Intronic
1144975109 17:19134773-19134795 GTGGGGTCAGAGGGAGGGCTGGG + Intronic
1145174321 17:20685697-20685719 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
1145177693 17:20715680-20715702 GTCTGGACAAAGGAAGATCTGGG - Intergenic
1145733923 17:27212918-27212940 GTGTGGATAGAAGTAGACATGGG + Intergenic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146215777 17:30978994-30979016 GTGTGGATAGAAGTAGACATGGG - Intronic
1146443939 17:32921667-32921689 GTGTGGATAGAAGTAGACATGGG - Intergenic
1146622864 17:34413520-34413542 GTGTGGGAAGAGGTATAGATAGG + Intergenic
1146631332 17:34471966-34471988 GTGTGGACAGAGGTAGAGGCAGG + Intergenic
1146924827 17:36736895-36736917 GTGAGGACAGAGGCAGAGATTGG + Intergenic
1147167886 17:38603070-38603092 GTGTGGTCAGAGCTAGAGGGTGG - Intronic
1147172958 17:38631877-38631899 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1147184209 17:38704994-38705016 GTGCGGGCAGAGGGAGGGCTCGG + Intergenic
1147783894 17:42964278-42964300 GTGTGGAGAGGGCTAGGGCTAGG - Intronic
1147852518 17:43452799-43452821 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1147993642 17:44349968-44349990 GGGTGGGGAGAGGTCGAGCTGGG + Intronic
1148016519 17:44525352-44525374 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1148404513 17:47398469-47398491 GTGTAGAAAGAGGTAGACATGGG + Intronic
1148406648 17:47421252-47421274 GTGTAGAAAGAGGTAGACATGGG + Intronic
1148506777 17:48133574-48133596 GTGTGGACACATTTAGAGATGGG + Exonic
1148636157 17:49150530-49150552 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1149403643 17:56324842-56324864 GGGTGGCCAAAGGAAGAGCTTGG - Intronic
1149593110 17:57846524-57846546 GTGTGGAAAGAGGTAGACATGGG + Intronic
1150056367 17:62021075-62021097 GTGTAGAAAGAGGTAGACATGGG - Intronic
1150214180 17:63457286-63457308 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
1150312545 17:64140772-64140794 TTGAGGACAGAGGTAGAGATTGG - Intergenic
1150477400 17:65485574-65485596 ATGTAGACACAGGTAGATCTGGG - Intergenic
1150651004 17:67010158-67010180 ATGGGGACAAAGGCAGAGCTTGG - Intronic
1150726636 17:67656342-67656364 GCGAGGACAGAGGCAGAGATGGG - Intronic
1151116480 17:71740984-71741006 CTATGGGCAGAGGCAGAGCTGGG - Intergenic
1151316501 17:73325741-73325763 GTGAGGACACAGGCAGCGCTTGG - Intergenic
1151394388 17:73812405-73812427 GAGTAAACAGAGGTAGAGTTTGG + Intergenic
1151442122 17:74136176-74136198 GTGTGGACAGGGTTGGAGCTGGG + Intergenic
1152020426 17:77777251-77777273 GTGTGGATAGAAGTAGACATGGG + Intergenic
1152274198 17:79344877-79344899 GTGTGGACAGAGGCAGATTGGGG - Intronic
1152497295 17:80682526-80682548 GTGAAGACTGAGGCAGAGCTGGG + Intronic
1153007578 18:512042-512064 GTGTGGATAGAGGTAGACATGGG - Intergenic
1153142611 18:1991860-1991882 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1153328079 18:3842250-3842272 GAGTGGACAGAGGGAGTGTTAGG + Intronic
1153646836 18:7203569-7203591 GTGTGGAGAGAAGTAGACATAGG - Intergenic
1153748608 18:8206912-8206934 GGGAGGACAGAGGCAGAGATTGG + Intronic
1153749031 18:8210386-8210408 GGGAGGACAGAGGCAGAGATTGG + Intronic
1153843020 18:9024005-9024027 GTGTAGAGAGAGGTAGACATGGG - Intergenic
1154010438 18:10569428-10569450 GTGAGGACAGAGGCAGAGATTGG - Intergenic
1154265482 18:12874914-12874936 GTGTGGAAAGAAGTAGACATGGG + Intronic
1154440142 18:14382562-14382584 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1154990028 18:21592057-21592079 GTGTGGAAAGAAGTAGACATGGG - Intronic
1155544501 18:26901599-26901621 GTGATAACAGAGGCAGAGCTTGG + Intergenic
1155612126 18:27677604-27677626 CTGTTCACACAGGTAGAGCTGGG + Intergenic
1155956810 18:31961244-31961266 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1157429024 18:47608218-47608240 GTGTTGACAGAGGAAGAACCAGG + Intergenic
1157705386 18:49800504-49800526 GTGTGGAAAGAAGTAGACATGGG + Intronic
1158070709 18:53466877-53466899 GTGTGGACAGAGTTAGATTTAGG + Intronic
1158146748 18:54322894-54322916 GTGAAGACAGAGGTAGAGACTGG - Intergenic
1158179252 18:54695260-54695282 GAGTGGATAGAGGTGGAACTTGG - Intergenic
1158459121 18:57632465-57632487 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1158881514 18:61783601-61783623 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1159054371 18:63450158-63450180 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1160077799 18:75694440-75694462 GTGTGGGCAGAGTAAGTGCTTGG - Intergenic
1160108390 18:76001517-76001539 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1160182308 18:76646061-76646083 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1160228293 18:77028377-77028399 GTGTAGAAAGAGGTAGACATGGG - Intronic
1161138610 19:2635191-2635213 GTGAGGACAGAGGTGCAGGTGGG + Intronic
1161138981 19:2636981-2637003 GTGGGGACAGAGGTGCAGGTGGG - Intronic
1161604651 19:5207911-5207933 GTGCAGACAGAGGTAAAGATGGG - Exonic
1163143265 19:15363765-15363787 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1163542495 19:17919099-17919121 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1163558342 19:18005377-18005399 GTGTAGAAAGAGGTAGACATGGG - Intronic
1163691511 19:18741143-18741165 GTTTGGACAGAGATGGGGCTTGG + Intronic
1163906366 19:20152418-20152440 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1163921863 19:20296822-20296844 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164065108 19:21708300-21708322 GTGTGGAAAGAAGTAGACATAGG + Intergenic
1164066916 19:21722320-21722342 GTGTGGATAGAAGTAGACATGGG + Intergenic
1164071918 19:21776257-21776279 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164081450 19:21865132-21865154 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1164105528 19:22106495-22106517 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1164126198 19:22321457-22321479 GTGTGGAAAGAGGTAGACATGGG - Intergenic
1164214828 19:23134832-23134854 GTGTGGATAGAAGTAGACATGGG + Intronic
1164218748 19:23173625-23173647 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164298313 19:23936844-23936866 GTGTAGAAAGAGGTAGACATGGG - Intronic
1164597014 19:29536911-29536933 GTGTGGACAGAGCAAGGCCTTGG + Intronic
1164659166 19:29948727-29948749 GTGTGGAAAGAAGTAGACATAGG - Intronic
1164860186 19:31556470-31556492 CCTGGGACAGAGGTAGAGCTTGG + Intergenic
1165639803 19:37374713-37374735 GTGATGTCAGAGGTATAGCTGGG + Intronic
1165897989 19:39154929-39154951 GGGTGGACAGAGGTGGGGATGGG + Intronic
1166010216 19:39935874-39935896 GTGAGGACTGAGGAAGAGCCAGG + Intergenic
1166162411 19:40964899-40964921 GTGTGGATAGAAGTAGACATGGG - Intergenic
1166425635 19:42676179-42676201 GTGTAGAAAGAGGTAGACATGGG - Intronic
1166611797 19:44204424-44204446 GTGTGGAAAGAAGTAGACATAGG + Intergenic
1166785532 19:45364594-45364616 GTGTGGCCAGGGGTAGGGGTAGG - Intronic
1166832942 19:45648817-45648839 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1167105578 19:47428416-47428438 GTGTGGCTAGTGGAAGAGCTAGG + Exonic
1167823810 19:51953255-51953277 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1167897384 19:52593166-52593188 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1167924759 19:52812373-52812395 GTGTGGATAGAAGTAGACATGGG + Intronic
1167980221 19:53269773-53269795 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1168114547 19:54214665-54214687 GTGTAGAAAGAGGTAGACATGGG - Intronic
1168233731 19:55048997-55049019 GTGTGGACAGAGGCAAAGACCGG + Intronic
1168695888 19:58404620-58404642 GTGTAGAAAGAGGTAGACGTGGG - Intronic
924971064 2:127236-127258 GTGTGGATAGAAGTAGACATGGG + Intergenic
925146802 2:1587668-1587690 GTGCGGACAGAGGGACAGCAGGG - Intergenic
925373627 2:3365863-3365885 GTGTAGAAAGAGGTAGACATGGG - Intronic
925721623 2:6834266-6834288 GTGATGATAGAGGTAGAGATTGG - Intergenic
925776134 2:7338094-7338116 GTGTAGAAAGAGGTAGACATGGG - Intergenic
926639421 2:15219711-15219733 GTGTGGATAGAAGTAGACATGGG - Intronic
927747505 2:25634664-25634686 GTGTAGAAAGAGGTAGACATGGG + Intronic
927757727 2:25723022-25723044 GTGTAGAAAGAGGTAGACATGGG - Intergenic
927776786 2:25910102-25910124 GTGTAGAAAGAGGTAGACATGGG - Intergenic
927832980 2:26370245-26370267 GTGTAGAAAGAGGTAGACATGGG - Intronic
928002794 2:27539503-27539525 GTGTGGATAGAAGTAGACATGGG - Intronic
928005038 2:27557099-27557121 GTGTGGATAGAAGTAGACATGGG - Intronic
928114239 2:28535479-28535501 GTGTGGCCAGAGGTACCACTAGG - Intronic
928252081 2:29689850-29689872 GTGATGACAGAGGAAGAGTTTGG + Intronic
928541903 2:32293477-32293499 GTGTGGAAAGAAGTAGACATGGG - Intronic
928557826 2:32447139-32447161 GTGTGGATAGAGGTAGACATGGG - Intronic
928585411 2:32754531-32754553 GTGTGGAAAGAAGTAGACATGGG - Intronic
928620720 2:33085089-33085111 GTGAGGATAGAGGTAGAGATTGG + Intronic
929061839 2:37932449-37932471 GTGTAGAAAGAGGTAGACATGGG - Intronic
929515736 2:42604970-42604992 GTGTGGAAAGAAGTAGACATGGG - Intronic
929650678 2:43677585-43677607 GTGTGGAAAGAAGTAGACATGGG - Intronic
929740026 2:44589492-44589514 GTGTGGATAGAAGTAGACATGGG + Intronic
929815865 2:45230939-45230961 GTGAGGACAGAGGCAGAGATTGG - Intergenic
930079025 2:47432801-47432823 GTGTAGAAAGAGGTAGACGTGGG - Intronic
930396217 2:50827992-50828014 GTGTGGAAAGAAGTAGACGTGGG - Intronic
930418521 2:51120337-51120359 GTGTGAACAGTGGTATGGCTTGG + Intergenic
930821613 2:55651382-55651404 GTGTAGAAAGAGGTAGACGTGGG + Intronic
930827192 2:55706019-55706041 GTGTAGAAAGAGGTAGACATGGG + Intergenic
931783423 2:65600341-65600363 GTGTAGAAAGAGGTAGACATGGG - Intergenic
931827851 2:66019885-66019907 GTGACCACAGAGGTAGAGATTGG - Intergenic
931838800 2:66127728-66127750 GTGTGGAAAGAGTGAGAGCTAGG - Intergenic
932312020 2:70750543-70750565 GTGATGACAGAGGTAGAGACTGG + Intronic
932367424 2:71161687-71161709 GTGTAGAAAGAGGTAGACATGGG + Intergenic
932710533 2:74060901-74060923 GTGTAGAAAGAGGTAGACATGGG - Intronic
932807250 2:74795475-74795497 GTGTAGAAAGAGGTAGACATGGG - Intergenic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
933735275 2:85488659-85488681 GTGTAGAAAGAGGTAGACATGGG + Intergenic
933828496 2:86186524-86186546 GTGTGACAAGAGGCAGAGCTAGG - Intronic
934311973 2:91875651-91875673 TTGTGTACAGAGGTAGGGATTGG + Intergenic
934524041 2:95040106-95040128 GTGTGTAGGTAGGTAGAGCTGGG - Intronic
934716926 2:96549876-96549898 CTCTGGACAGAGGAAGAGCCAGG + Intronic
934752934 2:96805834-96805856 GTGTGGAAAGAAGTAGACATGGG - Intronic
934843402 2:97645904-97645926 GTGCAGAAAGAGGCAGAGCTGGG + Intergenic
935630391 2:105210052-105210074 GTGTGGATAGAGGTAGACATGGG - Intergenic
935636307 2:105251751-105251773 GTGTAGAAAGAGGTAGACATGGG + Intergenic
937437783 2:121893380-121893402 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
937871827 2:126791699-126791721 AAGGGGACAGAGGCAGAGCTGGG + Intergenic
938088566 2:128417964-128417986 GTGTGGATAGAAGTAGACATGGG - Intergenic
938534326 2:132222443-132222465 GTGTGGATAGAAGTAGACATGGG + Intronic
938569639 2:132550806-132550828 GTCTGGACAGAAATACAGCTAGG - Intronic
938582648 2:132661136-132661158 GTGAGGCCAGATGTGGAGCTGGG + Intronic
938720800 2:134064577-134064599 GTGTAGAAAGAGGTAGACATGGG + Intergenic
938891124 2:135706764-135706786 GTGTAGAAAGAGGTAGACATGGG - Intronic
939578325 2:143921695-143921717 GTGTGGAAAGAAGTAGACATGGG - Intergenic
939584886 2:143992141-143992163 GTGTGGAAAGAAGTAGACATGGG + Intronic
940299374 2:152161105-152161127 GTGTAGAAAGAGGTAGACATGGG + Intronic
940643833 2:156369734-156369756 GTGTGGATAGAAGTAGACATGGG + Intergenic
940859358 2:158756137-158756159 GTGTGGAGAGAGTCAGAGTTGGG + Intergenic
941023784 2:160438646-160438668 GTGTAGAAAGAGGTAGACATGGG - Intronic
941822263 2:169855734-169855756 GTGTGGAAAGAAGTAGACATAGG - Intronic
941847988 2:170150512-170150534 GTGTAGAAAGAGGTAGACATGGG + Intergenic
942020786 2:171866219-171866241 GTGTAGAAAGAGGTAGACATGGG - Intronic
942024899 2:171900564-171900586 GTGTAGAAAGAGGTAGACATGGG + Intronic
942076105 2:172358566-172358588 GTGCAGACAGAGGCAGAGATGGG + Intergenic
942112865 2:172700142-172700164 GTGTGGAAAGAAGTAGACATAGG - Intergenic
942414749 2:175746799-175746821 GTGAGTGCAGTGGTAGAGCTAGG - Intergenic
942421210 2:175809894-175809916 GTGATGACAGAGGCAGAGATTGG - Intergenic
942754004 2:179319341-179319363 GTGTGGATAGAAGTAGACATGGG - Intergenic
943005905 2:182387027-182387049 GTGTGGAAAGAAGTAGACATGGG + Intronic
943100432 2:183479609-183479631 GTGTGGAAAGAAGTAGACATAGG + Intergenic
943110226 2:183595513-183595535 GTGAAGACAGAGGCAGAGATTGG - Intergenic
943412029 2:187557518-187557540 GTGTAGAAAGAGGTAGACATGGG + Intronic
943739681 2:191397579-191397601 GTGTGGATAGAAGTAGACATGGG - Intronic
944255493 2:197619350-197619372 GTGTAGAAAGAGGTAGACATGGG + Intronic
944464118 2:199983152-199983174 GTGAAGACAGAGGCAGAGATTGG + Intronic
944501014 2:200360441-200360463 GGGAGGACAGAGGTAGAGAAGGG - Intronic
944532684 2:200683013-200683035 GTGTGGATAGAAGTAGACATGGG - Intergenic
944593376 2:201239154-201239176 GTGTAGAGAGAGGTAGACATGGG - Intronic
944598248 2:201282323-201282345 GTGTGGATAGAAGTAGACATGGG - Intronic
945106932 2:206325058-206325080 GTGAGGACAGAGGCAGAGATTGG - Intergenic
945107647 2:206330926-206330948 GTGAGGACAGAGGCAGAGATTGG + Intergenic
945233358 2:207611627-207611649 GTGTGGATAGAAGTAGACATGGG + Exonic
945729812 2:213520117-213520139 GTGATGACAGAGGCAGAGATTGG + Intronic
945835470 2:214834684-214834706 GTGTGGATGGAAGTAGACCTGGG - Intergenic
945864723 2:215163120-215163142 GTGTGGAAAGAAGTAGACGTGGG - Intergenic
945904193 2:215572373-215572395 ATGTGGTCAGAGGTAGAGGTTGG + Intergenic
946318359 2:218932208-218932230 GTGTAGAAAGAGGTAGACATGGG + Intergenic
946347623 2:219123973-219123995 GTGGGGGCAGAGGTAGAGAGAGG + Intronic
946639885 2:221772961-221772983 GTGGGGACAAGGGTAGAGTTGGG + Intergenic
946651082 2:221892640-221892662 GTGTGGAAAGAGGTAGACATGGG + Intergenic
946750928 2:222895866-222895888 GTGTGGATAGAAGTAGACATGGG - Intronic
947002415 2:225472114-225472136 GTCTAGCAAGAGGTAGAGCTGGG + Intronic
947503932 2:230692530-230692552 GTGTGGCCAGACGCAGTGCTAGG + Intergenic
948024759 2:234768180-234768202 GTGAGGACAGAGGCAGAGGTTGG - Intergenic
948528762 2:238589738-238589760 GGGAGTATAGAGGTAGAGCTTGG - Intergenic
948651571 2:239449325-239449347 GTGTAGAAAGAGGTAGACATGGG - Intergenic
948873206 2:240813883-240813905 GCGTGGACAGAGGTTGTGCTCGG - Intronic
1169041485 20:2499143-2499165 GTTTGGACAGAGTTGGAGGTAGG + Intronic
1169086261 20:2825349-2825371 GTGTGGATAGAAGTAGACATGGG + Intergenic
1169108600 20:3018611-3018633 GTGTGGAAAGAAGTAGACATGGG - Intronic
1169702630 20:8465237-8465259 CTGTCCACAGAGGTAGAGGTGGG + Intronic
1169718393 20:8644935-8644957 GTGTAGAAAGAGGTAGACATGGG + Intronic
1169735522 20:8833566-8833588 GTGTCCACAGAGGCAGAGATTGG + Intronic
1169958318 20:11130766-11130788 CTGTGCACAGAGATAGAGTTTGG + Intergenic
1170384468 20:15800796-15800818 GTGTAGAAAGAGGTAGACATGGG + Intronic
1170551670 20:17482105-17482127 GCGAGGACAGAGGCGGAGCTGGG - Exonic
1170677403 20:18495195-18495217 GTGTAGAAAGAGGTAGACATGGG + Intronic
1171861702 20:30406210-30406232 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1172014846 20:31867233-31867255 GTGGGGTGAGAGGGAGAGCTGGG - Intronic
1172338154 20:34133277-34133299 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1172574879 20:36001124-36001146 GTGTAGAAAGAGGTAGACATGGG - Intronic
1172721402 20:37001368-37001390 GTGTAGAAAGAGGTAGACATGGG + Intronic
1172722989 20:37013196-37013218 GTGTAGAAAGAGGTAGACATGGG + Intronic
1173272900 20:41554767-41554789 GTGTAGAAAGAGGTAGACATGGG - Intronic
1173517895 20:43677912-43677934 GTGTAGAAAGAGGTAGACATGGG + Intronic
1173942677 20:46925071-46925093 GTGATGACAGAGGCAGAGATTGG - Intronic
1174020390 20:47525320-47525342 GTGTAGAAAGAGGTAGACATGGG - Intronic
1174189474 20:48729970-48729992 GTGAAGACAGAGGCAGAGATTGG + Intronic
1174218500 20:48935480-48935502 GTGTAGAAAGAGGTAGACATGGG - Intronic
1174345032 20:49922727-49922749 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1174674496 20:52340445-52340467 GATTGGAGAGAGGCAGAGCTTGG - Intergenic
1174728858 20:52894470-52894492 GTGGAGACAAAGGTAGAGATTGG + Intergenic
1174835909 20:53854828-53854850 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1174878186 20:54250144-54250166 GTGTGGATAGAAGTAGACATGGG - Intergenic
1175162018 20:57015586-57015608 GTGAGGACGGAGGCAGAGATTGG + Intergenic
1175183826 20:57166608-57166630 GGGTAGACAGAGGCAGAGATTGG + Intergenic
1175559349 20:59907171-59907193 GTAAGTACAGGGGTAGAGCTGGG + Intronic
1175592464 20:60203946-60203968 GTGTTGGAAGAAGTAGAGCTTGG - Intergenic
1175775825 20:61653323-61653345 GTGTAGAAAGAGGTAGACATGGG - Intronic
1176348123 21:5770193-5770215 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176354937 21:5890777-5890799 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176496704 21:7554262-7554284 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1176542444 21:8168263-8168285 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176561395 21:8351308-8351330 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176665470 21:9683046-9683068 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1177061405 21:16378725-16378747 GTGTCAACAGAGGAAGAGCAAGG + Intergenic
1177221588 21:18200849-18200871 GTGAAGACAGAGGGAGAGATTGG + Intronic
1177811922 21:25934104-25934126 GTGAAGACAGAGGTGGAGATTGG + Intronic
1177850577 21:26342606-26342628 GTGATGACAGAGGCAGAGCTTGG + Intergenic
1178075887 21:29012380-29012402 GTGTAGAAAGAGGTAGACATGGG + Intronic
1178237928 21:30864806-30864828 GTGAAGACAGAGGTAGAGATTGG + Intergenic
1178604701 21:34025635-34025657 GTGAAGACAGAGGCAGAGTTTGG + Intergenic
1178873071 21:36392310-36392332 GTGTAGAAAGAGGTAGACATAGG - Intronic
1178887027 21:36492733-36492755 GTGACGACAGAGGCAGAGGTGGG + Intronic
1179646441 21:42778832-42778854 GTGTGGATAGAAGTAGACATGGG + Intergenic
1179969425 21:44825543-44825565 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1180125276 21:45785741-45785763 GTGTAGAAAGAGGTAGACATGGG + Intronic
1180398815 22:12389014-12389036 GTGTGGGCAGAAGCAGAGCGAGG + Intergenic
1180538731 22:16421479-16421501 TTGTGTACAGAGGTAGGGATTGG + Intergenic
1180569612 22:16702859-16702881 GTGAGGACAGGGGAGGAGCTGGG - Intergenic
1181301287 22:21883325-21883347 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1181458858 22:23074518-23074540 ATGTGGCCAGAGGGAGAGCAAGG + Intronic
1181532565 22:23525217-23525239 GTGTAGACAGAGGCAGAGGGTGG + Intergenic
1181598986 22:23937501-23937523 GTGTAGAGAGAGGTAGACATGGG + Intergenic
1181657601 22:24316665-24316687 GTGTAGAAAGAGGTAGACATGGG - Intronic
1182033587 22:27180165-27180187 TTGTGGACTGAGTTAGAGCTAGG - Intergenic
1182051688 22:27317258-27317280 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1182242932 22:28931632-28931654 GTGTGGACAGATGGACAGATGGG - Intronic
1182412759 22:30201215-30201237 GTGAAGACAGAGGTAGAGACTGG - Intergenic
1182539246 22:31027957-31027979 GTGTGGATAGAAGTAGACATGGG + Intergenic
1183517594 22:38276164-38276186 GTGTGTAGGGAGGGAGAGCTGGG - Intergenic
1183562748 22:38589162-38589184 GTGATGACAGAGGCAGAGATTGG + Intronic
1183675484 22:39296925-39296947 GTCTGGACTGAGGGAGAGTTGGG - Intergenic
1183714199 22:39524180-39524202 TTGAGCAAAGAGGTAGAGCTGGG + Intergenic
1183871301 22:40744540-40744562 GTGTGGATAGAAGTAGACATGGG - Intergenic
1183941123 22:41295306-41295328 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1183958267 22:41395628-41395650 GTGTGGCCAGAGCTAAAGCAGGG - Intronic
1184201471 22:42972115-42972137 GTGTGGAAAGAAGTAGACATAGG + Intronic
1184203098 22:42982482-42982504 GTGTGGATAGAAGTAGACATGGG + Intronic
1184521050 22:44994372-44994394 GTGTAGACAGAGGCAGAGACTGG + Intronic
1184647472 22:45903900-45903922 GAGTGGCCAGAGGGAGAGCAGGG - Intergenic
1184723783 22:46331416-46331438 TTGTGGACAGAGGCAGATCCTGG - Intronic
1185067376 22:48639033-48639055 GTGAGGCCAGAAGAAGAGCTGGG - Intronic
1185314646 22:50173833-50173855 GTGAGGACAGAAGTGGGGCTGGG - Intronic
1203247383 22_KI270733v1_random:84681-84703 GTGTAGAAAGAGGTAGACATGGG - Intergenic
949906641 3:8863737-8863759 GTGTGGACAGAGTGAGAGCAGGG - Intronic
949992746 3:9592352-9592374 GTGTAGAAAGAGGTAGACATGGG + Intergenic
950742659 3:15062676-15062698 GTGTGGAAAGAGGTAGACATGGG + Intronic
950754550 3:15162418-15162440 GTGTAGAAAGAGGTAGACATGGG - Intergenic
950819673 3:15742983-15743005 GTGTAGAAAGAGGTAGACATGGG + Intronic
950948952 3:16979724-16979746 GTGTAGAAAGAGGTAGACATGGG - Intronic
951550364 3:23871064-23871086 GTGTAGAAAGAGGTAGACATGGG - Intronic
951602147 3:24388303-24388325 GTGTGGATAGAGGGAGAAGTTGG - Intronic
952091019 3:29886356-29886378 ATGTAGTCCGAGGTAGAGCTGGG + Intronic
952522881 3:34179699-34179721 GTGAAGACAGAGGCAGAGATTGG + Intergenic
953183761 3:40619860-40619882 GTGTGGACAAAGGAGGAGGTGGG - Intergenic
953457615 3:43055398-43055420 GGGTGGACAGAGACAGAGGTGGG - Intronic
954355869 3:50084033-50084055 GTGTAGAAAGAGGTAGACATGGG - Intronic
954483426 3:50823553-50823575 GTGTAGAAAGAGGTAGACATGGG - Intronic
954599947 3:51859259-51859281 GTGTAGAAAGAGGTAGACATGGG + Intergenic
954660478 3:52224348-52224370 GAGTGGGTGGAGGTAGAGCTGGG - Intronic
954919649 3:54179015-54179037 GTGTGGGCAGAGGCAGTGCTGGG - Intronic
955343525 3:58143872-58143894 GTGTGGCCAGAGGTCAAGCTGGG + Intronic
955362739 3:58289622-58289644 GTGTAGAAAGAGGTAGACATGGG - Intronic
955699670 3:61671526-61671548 GTGTAGAAAGAGGTAGACATGGG - Intronic
956443679 3:69305073-69305095 GTGAGGAAAGTGCTAGAGCTGGG + Intronic
956801497 3:72763682-72763704 GTGAAGACAGAGGCAGAGATTGG + Intronic
957203482 3:77165169-77165191 GTGTGGAAAGAAGTAGACATGGG + Intronic
957286637 3:78224560-78224582 GTGTAGACAGAGGCAGAAATTGG - Intergenic
958164249 3:89858771-89858793 GTGAGGACAGAGGCAGATATTGG + Intergenic
958560692 3:95744549-95744571 GTGTAGAAAGAGGTAGACATGGG - Intergenic
958646297 3:96879487-96879509 ATGTGGACAAAGTTAGAGTTAGG + Intronic
959415012 3:106073205-106073227 GTGTGGATAGACGTAGACATGGG - Intergenic
959651570 3:108755989-108756011 GTGCAGTCAGGGGTAGAGCTAGG + Intronic
960388752 3:117051086-117051108 GTGTAGAAAGAGGTAGACATGGG + Intronic
960865992 3:122201387-122201409 GTGTGGAGAGAGGTAGACATGGG - Intronic
961163585 3:124749780-124749802 GTGTAGAAAGAGGTAGACATGGG - Intergenic
961353764 3:126321086-126321108 GTGAGGACAGAGACAGAGCCTGG - Intergenic
961498172 3:127309306-127309328 GTGTGGAAAGAAGTAGACATAGG + Intergenic
961505889 3:127370259-127370281 CTGTAGACAGGTGTAGAGCTGGG - Intergenic
961784038 3:129338846-129338868 GTGTAGAAAGAGGTAGACATGGG - Intergenic
961788549 3:129362086-129362108 GTGTAGAAAGAGGTAGACATGGG - Intergenic
962382408 3:134908574-134908596 GTGAGGACAGGGGCAGGGCTGGG + Intronic
962504081 3:136028247-136028269 GTGAGGTCAGAGGTAGGGCAGGG - Intronic
963451070 3:145482638-145482660 GTGTAGAAAGAGGTAGACATGGG - Intergenic
963498652 3:146097406-146097428 GTGTGGATAGAAGTAGACATGGG + Intronic
963911090 3:150819789-150819811 GTGTGGATAGAAGTAGACATGGG - Intergenic
963941997 3:151104851-151104873 GTGAAGACAGAGGCAGAGATTGG - Intronic
964174252 3:153806274-153806296 GTGAAGACAGAGGCAGAGATTGG + Intergenic
964766093 3:160179190-160179212 GTGTAGAAAGAGGTAGACATGGG + Intergenic
966014990 3:175131529-175131551 GTGTAGAAAGAGGTAGACATGGG - Intronic
966116612 3:176470748-176470770 GTAATGACAGAGGTAGAGCTTGG - Intergenic
966253351 3:177891465-177891487 GTGTAGAAAGAGGTAGACATGGG - Intergenic
966419961 3:179727553-179727575 GTGTAGAAAGAGGTAGACGTGGG - Intronic
966784374 3:183609379-183609401 GTGTGGATAGAAGTAGACATGGG + Intergenic
967524375 3:190473807-190473829 GTGTAGAAAGAGGTAGACATGGG + Intergenic
967556628 3:190866123-190866145 GTGTGATCAGAGGTAGACCTAGG + Intronic
967896639 3:194400781-194400803 GTGTGGATAGAAGTAGACATGGG + Intergenic
968042374 3:195599525-195599547 GTGTAGAAAGAGGTAGACATAGG - Intergenic
968175100 3:196542969-196542991 GTGTGGAAAGAAGTAGACATGGG - Intergenic
968226229 3:196973935-196973957 GTGTAGAAAGAGGTAGACATGGG + Intergenic
968299447 3:197602122-197602144 GTGTAGAAAGAGGTAGACATGGG - Intergenic
968316644 3:197731381-197731403 GTGTGGAAAGAGGTAGACATGGG - Intronic
968429752 4:550229-550251 GTGTAGAAAGAGGTAGACATGGG - Intergenic
968436419 4:592548-592570 GTGTAGAAAGAGGTAGACATGGG + Intergenic
968473241 4:791462-791484 AAGTGGACAGAGGTGGAGCTGGG - Intronic
968507259 4:976472-976494 GTGTGGATAGAAGTAGACATGGG + Intronic
968589707 4:1451198-1451220 GTGTGGACAGAGCAGGTGCTCGG + Intergenic
968729348 4:2262265-2262287 ATGTTGACAGATGCAGAGCTGGG + Exonic
968924040 4:3538235-3538257 GTGTAGAAAGAGGTAGACATGGG - Intergenic
969146384 4:5127676-5127698 GTGAGGACAGAGGCAGAGGTTGG + Intronic
969248420 4:5951715-5951737 GTGTGGAGGGCGGTAGAGCAGGG - Intronic
969251058 4:5969187-5969209 GTGGGGAGAGAGGCAGGGCTCGG - Intronic
969322302 4:6419826-6419848 GTGATGACAGAGGCAGAGATTGG - Intronic
969331840 4:6478101-6478123 GTGTGTGCAGATGTAGAGTTTGG - Intronic
969336840 4:6515929-6515951 GTGAGGACAGAGGCAGAGATTGG - Intronic
969404297 4:6978348-6978370 GTGTAGAAAGAGGTAGACATGGG + Intronic
969461832 4:7333144-7333166 GTGGGGTCAGAGGCAGAGGTGGG - Intronic
969687110 4:8681795-8681817 GTTTGGACAGTGGTGGGGCTGGG + Intergenic
969692452 4:8711109-8711131 ATGTGGACAGATGTGGAGCTTGG + Intergenic
969862258 4:10046834-10046856 ATGATGACAGAGGAAGAGCTTGG + Intronic
970409681 4:15792032-15792054 GTGTGGATAGAAGTAGACATGGG + Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
970472501 4:16392918-16392940 GTGTGGAAAGAAGTAGACATGGG - Intergenic
970559436 4:17268367-17268389 GTGTGGGTTCAGGTAGAGCTGGG + Intergenic
970606635 4:17687682-17687704 GTGATGACAGAGGCAGAGATCGG + Intronic
971046528 4:22811189-22811211 GTGGAGACAGAGGCAGAGATTGG - Intergenic
971093504 4:23372143-23372165 GTGTGGATAGAAGTAGACATGGG + Intergenic
971243612 4:24910188-24910210 GTGAAGACAAAGGTAGAGATTGG - Intronic
971261711 4:25063242-25063264 GTGAAGACAGAGGCAGAGATTGG + Intergenic
971379734 4:26085752-26085774 GTGAAGACAGAGGCAGAGATTGG + Intergenic
971503464 4:27341506-27341528 GTGAGCACAGAGGTAGAACAAGG + Intergenic
972288531 4:37669640-37669662 GTGTAGAAAGAGGTAGACATGGG + Intronic
972607986 4:40631141-40631163 GTGTGGTCAGAGTTAGACATGGG + Intergenic
973002807 4:44972831-44972853 GTGTATACAGGGGTAGAGGTGGG - Intergenic
973109372 4:46378266-46378288 GTGTAGAAAGAGGTAGACGTGGG + Intronic
973263504 4:48187040-48187062 GTGTAGAAAGAAGTAGACCTGGG + Intronic
973706453 4:53585656-53585678 GTGAGGAGAGAGGCAGAGATTGG + Intronic
973784862 4:54325180-54325202 GTGTAGAAAGAGGTAGACATGGG - Intergenic
974021104 4:56693244-56693266 GTGTAGAAAGAGGTAGACATGGG - Intergenic
974076725 4:57173695-57173717 GTGTAGAAAGAGGTAGACATGGG + Intergenic
974507424 4:62794305-62794327 GTGAAGACAGAGGCAGAGATTGG - Intergenic
974575261 4:63711427-63711449 GTGTCGATAGAGGCAGAGATTGG + Intergenic
974821365 4:67070636-67070658 GTGAAGACAGAGGCAGAGATTGG + Intergenic
975042623 4:69762595-69762617 GTGTAGAAAGAGGTAGACATGGG + Intronic
975478935 4:74856419-74856441 GTGAAGACAGAGGCAGAGATAGG - Intergenic
975633582 4:76423886-76423908 GTGTGGAAAGAAGTAGACATGGG + Intergenic
975686257 4:76918471-76918493 GTGTGGATAGAAGTAGACATGGG + Intergenic
975848566 4:78548659-78548681 GTGTGGAAAGAAGTAGACATGGG + Intergenic
976126109 4:81835351-81835373 GTGAGGACAGAAGCAGAGATTGG + Intronic
976265501 4:83184992-83185014 GTGTGGATAGAAGTAGACATGGG - Intergenic
976331283 4:83833605-83833627 GTGAGGACAGAGGCAGAGATTGG - Intergenic
976607492 4:86996332-86996354 GTGTAGAAAGAGGTAGACATGGG + Intronic
978224996 4:106321805-106321827 GTGTGGAAAGAAGTAGACATAGG + Intronic
978409339 4:108410177-108410199 GTGTGGATAGAAGTAGACATGGG + Intergenic
978660753 4:111123616-111123638 GTGTAGACAGAGGGAGAGAGAGG + Intergenic
979066793 4:116147439-116147461 TTGTGGACAGCGGTAGAACTAGG - Intergenic
979117642 4:116847912-116847934 GTGTGGAAGGAGGGAGGGCTTGG + Intergenic
979289092 4:118960035-118960057 GTGACCACAGAGGTAGAGCTTGG + Intronic
979622669 4:122812801-122812823 GTGTGGAAAGAAGTAGACATGGG + Intergenic
981994988 4:150964432-150964454 GTGTGGAAAGAAGTAGACATAGG + Intronic
982022031 4:151214255-151214277 GTGTGGAAAGAAGTAGACATGGG - Intronic
982040559 4:151391400-151391422 GTGTGGATAGAAGTAGACATGGG + Intergenic
982053406 4:151526144-151526166 GTGTGGAAAGAGGTAGACATGGG - Intronic
982709509 4:158746172-158746194 GTGTGGAAAGAAGTAGACATGGG - Intergenic
982784861 4:159524882-159524904 GTGTGGAAAGAAGTAGACATGGG + Intergenic
983217946 4:165019596-165019618 GTGTAGAGAGAGGTAGACATGGG - Intergenic
983652471 4:170047172-170047194 GTGTAGAAAGAGGTAGACATGGG + Intergenic
984038009 4:174692547-174692569 GTGTAGAAAGAGGTAGACATGGG + Intronic
984245813 4:177274490-177274512 CTGTGGAGAAAGGAAGAGCTGGG + Intergenic
984537046 4:180989566-180989588 GTGAAGACAGAGGCAGAGATTGG - Intergenic
984651676 4:182277325-182277347 ATGTTCACAGAGGTAGAGTTGGG + Intronic
984728026 4:183040505-183040527 GTGTAGAAAGAGGTAGACATGGG - Intergenic
984803469 4:183735127-183735149 GTGTGGATAGAAGTAGACATGGG - Intergenic
984832032 4:183984734-183984756 GTGTGGGCAGAGGCTGTGCTTGG - Intronic
984876865 4:184376621-184376643 GTGAAGACAGAGGTGGAGTTTGG + Intergenic
984977006 4:185240153-185240175 GTGTAGAAAGAGGTAGACATGGG - Intronic
985410960 4:189683504-189683526 GTGAAGACAGAGGCAGAGATTGG - Intergenic
985736705 5:1586911-1586933 GTGTAGAAAGAGGTAGACATGGG + Intergenic
986196193 5:5538079-5538101 GTGTGGACAGAGACAGAGATTGG - Intergenic
986383827 5:7211481-7211503 GTGAAGACAGAGGTAGAGGCTGG - Intergenic
987267817 5:16276565-16276587 GTGTAGAAAGAGGTAGACATGGG - Intergenic
987398463 5:17449140-17449162 GTGGGGAGAGAGGTGGAGGTTGG - Intergenic
987906182 5:24080212-24080234 GTGATGACAGAAGTAGAGATTGG - Intronic
988393367 5:30664814-30664836 GTGAAGACAGAGGCAGAGATTGG + Intergenic
988544575 5:32143058-32143080 GTGTAGAAAGAGGTAGACATGGG + Intronic
988548141 5:32176438-32176460 GGGTGAACAGGGGCAGAGCTGGG - Intergenic
989021316 5:37012852-37012874 GTGTAGAAAGAGGTAGACATGGG - Intronic
989075653 5:37562834-37562856 GTGTAGAAAGAGGTAGACATGGG - Intronic
989211203 5:38861505-38861527 GTGTAGAAAGAGGTAGACATGGG - Intronic
989273692 5:39561692-39561714 GTGATGACAGAGGCAGAGATTGG - Intergenic
989380024 5:40801383-40801405 GTGTGGATAGAAGTAGACATGGG + Intergenic
989587418 5:43086913-43086935 GTGTGGATAGAAGTAGACATGGG - Intronic
989634997 5:43522686-43522708 GTGTAGAAAGAGGTAGACATGGG + Intergenic
990160798 5:52937891-52937913 GTGAAGACAGAGGCAGAGATAGG - Intronic
990294003 5:54381840-54381862 GTGTGGAAAGAAGTAGACATGGG + Intergenic
990414245 5:55571120-55571142 GTGTGGAAAGAAGTAGACATAGG + Intergenic
990498715 5:56373083-56373105 GTGTAGAAAGAGGTAGACATGGG + Intergenic
990603247 5:57382281-57382303 CAGAGGACAGAGGTAGAGATTGG - Intergenic
990870918 5:60430929-60430951 GTGTAGAAAGAGGTAGACATGGG - Intronic
991375015 5:65957601-65957623 GTGTGGAAAGAAGTAGACATGGG - Intronic
991376871 5:65976903-65976925 GTGTAGAAAGAGGTAGACATGGG - Intronic
991597806 5:68323489-68323511 GTGTAGAAAGAGGTAGACATGGG - Intergenic
991672495 5:69062650-69062672 GTGTAGAAAGAGGTAGACATGGG - Intergenic
991907046 5:71525021-71525043 GTGTAGAAAGAGGTAGACATGGG - Intronic
992290186 5:75271764-75271786 GTGTGGAAAGAAGTAGACATGGG + Intergenic
992340602 5:75819317-75819339 GTGTGGAAAGAAGTAGACATGGG + Intergenic
992367217 5:76105125-76105147 GTGAAGACAGAGGCAGAGATTGG + Intronic
992443314 5:76813276-76813298 GTGTGGAAAGAAGTAGACATGGG + Intergenic
992574910 5:78097886-78097908 GTGTAGAAAGAGGTAGACATGGG + Intronic
992670821 5:79059403-79059425 GTGTTGACTGAGGTAGAGGAAGG - Intronic
992801965 5:80301942-80301964 GTGTGGAAAGAGGTAGACATGGG + Intergenic
992864498 5:80943722-80943744 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
992914429 5:81433215-81433237 GTGTGGAAAGAAGTAGACATGGG + Intronic
992963928 5:81982940-81982962 GTGTAGAAAGAGGTAGACATGGG - Intronic
992978496 5:82140831-82140853 GTGTGGAAAGAAGTAGACATGGG + Intronic
993496759 5:88616423-88616445 GTGTAGAAAGAGGTAGACATGGG + Intergenic
993630814 5:90283751-90283773 GTGTTGTAAGAGGTAGACCTAGG - Intergenic
995123408 5:108558762-108558784 GTGTAGAAAGAGGTAGACATGGG - Intergenic
995456867 5:112361128-112361150 GTGTGGAAAGAAGTAGACATAGG + Intronic
995772882 5:115690852-115690874 GTGTAGAAAGAGGTAGACATGGG + Intergenic
995858818 5:116620626-116620648 GTATGGGCAGTGGTAGAGCTTGG + Intergenic
995894982 5:117002151-117002173 GTGTAGAAAGAGGTAGACATGGG - Intergenic
995994612 5:118283149-118283171 GTGTAGAAAGAGGTAGACATGGG + Intergenic
996376158 5:122810009-122810031 GTGTGGATAGAAGTAGACATGGG + Intronic
996407825 5:123123908-123123930 GGGTGGAGAAAGGGAGAGCTGGG + Intronic
996810852 5:127515104-127515126 GTGGAGACAGAGGCAGAGATTGG + Intergenic
997389440 5:133501963-133501985 GTGAAGACAGAGGCAGAGATGGG + Intronic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
997565146 5:134881574-134881596 GTGTAGAAAGAGGTAGACATGGG - Intronic
997572674 5:134943725-134943747 GTGTGGACTGCAGTGGAGCTGGG + Intronic
997874621 5:137537381-137537403 GTGTAGAAAGAGGTAGACATGGG - Intronic
997892533 5:137687773-137687795 GTGTGGATAGAAGTAGACATGGG + Intronic
998239111 5:140426903-140426925 GTGTAGAAAGAGGTAGACATGGG - Intronic
998940269 5:147274314-147274336 GTGTGGGCAAAGGCAGAGCCTGG - Intronic
999180867 5:149669914-149669936 GTGTAGAAAGAGGTAGACATGGG - Intergenic
999378553 5:151104079-151104101 GTGAGGACAGAGGCAGAGACCGG + Intronic
999797408 5:155001494-155001516 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1000222005 5:159223307-159223329 GTGATGACAGAGGCAGAGATTGG - Intergenic
1000398269 5:160798471-160798493 ATGAAGACAGAGGTAGAGGTTGG + Intronic
1001182316 5:169531936-169531958 ATGTGGACAGAGGCAGAAATGGG - Intergenic
1001235231 5:170023694-170023716 GGGTGGAAAGAAGTAGAGTTGGG - Intronic
1001476609 5:172055075-172055097 GTGTGGACAGAGGTAGAGCTTGG - Intronic
1001650004 5:173309566-173309588 GAGGGGACAGAAGGAGAGCTGGG - Intergenic
1001689348 5:173621323-173621345 GTGAAGACAGAGGTAGAGGATGG - Intergenic
1002171131 5:177375134-177375156 GTGTGGCCAGAGGTTGGGGTAGG + Intergenic
1002206920 5:177569278-177569300 GTGTGGTCAGAGGTCCAGCAGGG + Intergenic
1002501457 5:179650207-179650229 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1002529349 5:179834790-179834812 GTGTGGAAAGAAGTAGACATGGG - Intronic
1002658220 5:180771062-180771084 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1002848500 6:969832-969854 TTGTGGACAGAGGAACAGCGTGG - Intergenic
1003319201 6:5037396-5037418 GTGTGGATAGAAGTAGACATGGG - Intergenic
1003383369 6:5645450-5645472 GTGGGGACAGAGGAGGAGCTTGG - Intronic
1003407206 6:5835269-5835291 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1004277705 6:14253178-14253200 GTGTGGAGAGAAGGAGAGCAGGG + Intergenic
1004467936 6:15903188-15903210 GTGAAGACAGAGGCAGAGGTTGG + Intergenic
1004511098 6:16285412-16285434 GTGTGGACAGTGGAATGGCTGGG + Intronic
1004690820 6:17990631-17990653 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1005063199 6:21796517-21796539 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1005069444 6:21851117-21851139 GTGTGGATAGAGGTAGACATGGG - Intergenic
1005159118 6:22837487-22837509 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1005711006 6:28502725-28502747 GTGTAGACAGAAGTAGACATAGG + Intergenic
1005837681 6:29719868-29719890 GTGTGGATAGAAGTAGACATGGG + Intergenic
1005917117 6:30362575-30362597 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1005933106 6:30498545-30498567 GTGTGGAAAGAGGTGGACATGGG - Intergenic
1005946510 6:30599700-30599722 GGCTGTAGAGAGGTAGAGCTGGG + Intergenic
1006141260 6:31931650-31931672 GTGTAGAAAGAGGTAGACCTGGG - Intronic
1006148810 6:31975666-31975688 GTGTGGAAAGAGGTAGACATGGG - Intronic
1006281663 6:33059337-33059359 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1006403691 6:33832327-33832349 GTGTAGAAAGAGGTAGACCTGGG - Intergenic
1007403301 6:41616800-41616822 GTGTAGAGAGAGGTAGACATGGG + Intergenic
1007730487 6:43942543-43942565 GTGAGGATAGAGGGAGAGCCTGG - Intergenic
1008111984 6:47505415-47505437 GTGTAGAAAGAGGTAGACATGGG - Intronic
1008480792 6:51982417-51982439 GTGTGGATAGAAGTAGACATGGG + Intronic
1008553462 6:52655367-52655389 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1008841433 6:55909703-55909725 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1008926122 6:56893985-56894007 GTGTGGATAGAAGTAGACATGGG - Intronic
1010030182 6:71265796-71265818 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1010270794 6:73914675-73914697 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1010868566 6:81010413-81010435 GTGTCAACAGAGGTAGACTTTGG - Intergenic
1011404937 6:87009448-87009470 GTGTGGAGAGAAGTAGACATGGG - Intronic
1011485811 6:87840479-87840501 GTGTCTACAGAGGTAGAGATTGG + Intergenic
1011621253 6:89244858-89244880 GTGAGGACAGAGATTGACCTTGG + Intergenic
1012063913 6:94522657-94522679 GTGTAGACAAAGGCAGAGATTGG + Intergenic
1012428792 6:99142474-99142496 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1013185987 6:107758660-107758682 GTGACGACAGAGGCAGAGATTGG + Intronic
1013190971 6:107803657-107803679 GTGTAGAAAGAGGTAGACATGGG + Intronic
1013244107 6:108270542-108270564 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1014763736 6:125388074-125388096 GTGTGGATAGAAGTAGACATGGG - Intergenic
1014911800 6:127103804-127103826 GTGGGGGCAGAGGTGGAGGTGGG - Intergenic
1015221015 6:130802917-130802939 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1015252793 6:131144148-131144170 GTGTGGATAGAAGTAGACATGGG - Intronic
1015337178 6:132053192-132053214 GTGATGACAAAGGTAGAGATTGG + Intergenic
1015449746 6:133351805-133351827 ATGTGTACAGAGGTAGAGAAAGG + Intronic
1015643440 6:135363435-135363457 GTGTAGAAAGAGGTAGACATTGG - Intronic
1015831436 6:137373543-137373565 GTGTGGACACATGGAGAGCCTGG - Intergenic
1017068829 6:150554123-150554145 GTCTGGAGAGAGGGAGAGATGGG - Intergenic
1017135843 6:151146795-151146817 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1017214861 6:151898786-151898808 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1017419985 6:154263632-154263654 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1018009992 6:159660838-159660860 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1018568637 6:165184122-165184144 GTGAAGACAGAGGCAGAGATGGG - Intergenic
1019057834 6:169235902-169235924 GTGTGGACAGAGGGAGAGTGTGG - Intronic
1019067419 6:169313862-169313884 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067452 6:169314166-169314188 GTGTGGACAGAGGTGGGCGTTGG - Intergenic
1019067492 6:169314526-169314548 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067504 6:169314624-169314646 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067527 6:169314807-169314829 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067544 6:169314938-169314960 GTGTGGACAGAGGTGGGCGTTGG - Intergenic
1019067569 6:169315160-169315182 GTGTGGACAGAGGGAGGCATTGG - Intergenic
1019067578 6:169315236-169315258 GTGTGGACAGAGGGAGGCGTTGG - Intergenic
1019067590 6:169315322-169315344 GTGTGGACAGAGGGAGGCATTGG - Intergenic
1019067612 6:169315518-169315540 GTGTGGACAGAGGGAGGCATTGG - Intergenic
1019067621 6:169315592-169315614 GTGTGGACAGAGGGAGGCGTTGG - Intergenic
1019067626 6:169315636-169315658 GTGTGGACAGAGGGAGGCATTGG - Intergenic
1019067648 6:169315836-169315858 GTGTGGACAGAGGGAGGCATTGG - Intergenic
1019543363 7:1561180-1561202 GCGTGGGCAGGGGCAGAGCTTGG - Intergenic
1019626483 7:2018533-2018555 GTGTGGACTTAGGGAGTGCTGGG - Intronic
1019714781 7:2533879-2533901 GTGTGGATAGAAGTAGACATGGG - Intergenic
1019733146 7:2638367-2638389 GCGTGGGCAGCGGGAGAGCTGGG + Intronic
1020284509 7:6670609-6670631 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1020831902 7:13103279-13103301 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1021440538 7:20669335-20669357 GTGTGGATAGAAGTAGACATGGG + Intronic
1021672129 7:23045681-23045703 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1021773766 7:24031220-24031242 GTGTGGACAGCTGGGGAGCTAGG + Intergenic
1021774406 7:24038218-24038240 GTCTAGACAGTGGCAGAGCTGGG + Intergenic
1021949811 7:25763682-25763704 GTGGAGAAAGAGGAAGAGCTAGG - Intergenic
1022083622 7:27045754-27045776 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1022274164 7:28839133-28839155 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1022318299 7:29264421-29264443 GTGTAGAAAGAAGTAGACCTGGG + Intronic
1022371922 7:29779994-29780016 CTGTGGACAGTGGAAGATCTGGG - Intergenic
1023044306 7:36197521-36197543 GTGTAGAAAGAGGTAGACATGGG + Intronic
1023160803 7:37293326-37293348 GTGTAGAAAGAGGTAGACATGGG + Intronic
1024037692 7:45522824-45522846 GTGACGACAGAGGCAGAGGTTGG - Intergenic
1024266383 7:47610015-47610037 GAGTGGACAGTGGCAGAACTGGG + Intergenic
1024931069 7:54667400-54667422 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1024972434 7:55082945-55082967 GTGAGGATAGAGGTGGAGATCGG - Intronic
1025011341 7:55401928-55401950 GTGTAGAAAGAGGTAGACATGGG - Intronic
1025103516 7:56152137-56152159 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1025707010 7:63874757-63874779 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1025821255 7:64967316-64967338 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1025853535 7:65259847-65259869 GTGTGGATAGAAGTAGACATGGG + Intergenic
1025979057 7:66393119-66393141 GTGTGGATAGAAGTAGACATGGG - Intronic
1026042142 7:66877155-66877177 GTGTGGAAGGAGGTAGACATGGG - Intergenic
1026540804 7:71278486-71278508 GTGAAGACAGAGGCAGAGATTGG - Intronic
1026775011 7:73225973-73225995 GTGGGGACAGCGGGAGATCTTGG - Intergenic
1026861989 7:73796976-73796998 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1027015867 7:74779344-74779366 GTGGGGACAGCGGGAGATCTTGG - Exonic
1027072162 7:75166593-75166615 GTGGGGACAGCGGGAGATCTTGG + Intergenic
1027589931 7:80105776-80105798 GTGAAGACAGAGGCAGAGGTTGG + Intergenic
1027745632 7:82070454-82070476 GTGTGGAGAGTGGTAGTGCATGG + Intronic
1028227161 7:88265867-88265889 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1028598182 7:92569024-92569046 TAGTAGACAGAGATAGAGCTGGG + Intronic
1028685372 7:93585609-93585631 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1029334301 7:99887697-99887719 GTGTGGAAAGAAGTAGACATGGG - Intronic
1029504909 7:100957399-100957421 GTGAGGAGAGAGGAAGAGGTGGG - Exonic
1030036112 7:105410392-105410414 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1030681425 7:112438413-112438435 GTGAGGAGAGAGGTAGATCAAGG + Intronic
1031413348 7:121466586-121466608 GTGATGACAGAGGCAGAGATTGG - Intergenic
1031573486 7:123387283-123387305 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1031914957 7:127554310-127554332 GTGAAGACAGAGGTAGACGTTGG - Intergenic
1032291466 7:130592008-130592030 GTGTAGAAAGAGGTAGACATGGG + Intronic
1032363356 7:131276272-131276294 TTGGGGAGAGAGGGAGAGCTAGG + Intronic
1032546789 7:132750693-132750715 GTGTGGAGAGAGGGAGAGAAGGG - Intergenic
1032570024 7:132986011-132986033 GTGTAGAAAGAGGTAGACATGGG + Intronic
1033114344 7:138612003-138612025 GTGTAGAAAGAGGTAGACATGGG + Intronic
1033176993 7:139133972-139133994 GTGGGAACACAGGGAGAGCTGGG - Intronic
1033219606 7:139519762-139519784 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1033324150 7:140363301-140363323 GTGTGGATAGAAGTAGACATGGG + Intronic
1033376018 7:140762994-140763016 GTGTAGAAAGAGGTAGACATGGG - Intronic
1033424029 7:141227067-141227089 GTGTGGACAGCACTGGAGCTGGG + Intronic
1034209878 7:149354212-149354234 GTGGGAACAGAGGCAGAGCCTGG + Intergenic
1034361768 7:150506098-150506120 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1034922636 7:155096678-155096700 GTGTGGAAAGAAGTAGACATAGG - Intergenic
1034961297 7:155366468-155366490 GTGTGGATAGAAGTAGACATGGG - Intronic
1036482890 8:9153791-9153813 GTGTGGAAAGAAGTAGACATGGG - Intronic
1036506855 8:9364761-9364783 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1036738927 8:11344661-11344683 GTGTTGACAGAGGAGGCGCTGGG - Intergenic
1037562159 8:20084696-20084718 GTGTGAAGAGAGGCAGAGATTGG - Intergenic
1037857019 8:22379102-22379124 GTGAAGACAGAGGCAGAGATGGG - Intronic
1038246465 8:25860970-25860992 GAGTGGACAGAGTCAGAGGTTGG - Intronic
1038342076 8:26694870-26694892 GTGTGTACAGAGCAAGAACTGGG + Intergenic
1038382075 8:27105613-27105635 GTGTCAACAGAGGCAGAGGTTGG + Intergenic
1038595523 8:28882062-28882084 GTGTGGATAGAAGTAGACATGGG + Intronic
1038744578 8:30246312-30246334 GTGTGGATAGAAGTAGACATGGG - Intergenic
1038928516 8:32167541-32167563 GTGTGAAGAAAGGTAGATCTGGG - Intronic
1039176834 8:34818065-34818087 GTGAGGACAGAGGCAGAGACTGG + Intergenic
1039515973 8:38133931-38133953 GTGTGGAAAGAGGTAGACATGGG + Intronic
1040043293 8:42939103-42939125 GTGTAGAAAGAGGTAGACATGGG - Intronic
1040069488 8:43178998-43179020 GTGTGGATAGAAGTAGACATGGG - Intronic
1040785702 8:51159791-51159813 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1040819068 8:51535325-51535347 GTGTGGATAGAAGTAGACATGGG + Intronic
1041224005 8:55680443-55680465 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1041362832 8:57071176-57071198 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1041513502 8:58676185-58676207 GTGTAGAAAGAGGTAGACCTGGG - Intergenic
1041523165 8:58776719-58776741 GTGTGGAAAGAGGTGGACGTGGG + Intergenic
1041920645 8:63179605-63179627 GTGTAGAAAGAGGTAGACATGGG - Intronic
1042139437 8:65663138-65663160 GTGTAGAAAGAGGTAGACATGGG + Intronic
1042470365 8:69180307-69180329 GGGAGGACAGAGGGAGGGCTGGG - Intergenic
1042795075 8:72653029-72653051 GTGAAGACAGAGGCAGAGATTGG - Intronic
1042847028 8:73178672-73178694 CTGTGGACAGGGGTAGAGTGGGG - Intergenic
1042961610 8:74309470-74309492 GTGTGGACAGAAGCAGAGCTTGG - Intronic
1043220924 8:77662761-77662783 GTGTGAAAAGTTGTAGAGCTGGG - Intergenic
1044310128 8:90684072-90684094 GTGTAGAAAGAGGTAGACATAGG + Intronic
1044618069 8:94162721-94162743 GTGGGGACAGAGGTAGCTCCTGG + Intronic
1044777403 8:95705233-95705255 GTGAGGACAGAGGCAGAGATTGG - Intergenic
1044883551 8:96749749-96749771 GTGAGGACAGAAGTAGAAATTGG + Intronic
1044973009 8:97638210-97638232 GATTGGGCAGAGGGAGAGCTGGG + Intergenic
1045056421 8:98372072-98372094 GTGAAGACAGAGGCAGAGGTTGG + Intergenic
1045120098 8:99028099-99028121 GTGTGGAGAGAAGTAGACATGGG - Intronic
1045298370 8:100891858-100891880 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1045344700 8:101283558-101283580 GTGTGTGGAGAGGAAGAGCTGGG - Intergenic
1045483095 8:102608742-102608764 GTGATGACAGAGGCAGAGATTGG + Intergenic
1045524321 8:102928940-102928962 GTGTAGAAAGAGGTAGACATGGG + Intronic
1046044601 8:108948694-108948716 GAGTGGGCAGAGGTGGAGCCAGG - Intergenic
1046636960 8:116680434-116680456 GTGTGGATAGAAGTAGACATGGG + Intronic
1046736106 8:117778003-117778025 GTGTGGAAAGAAGTAGACATAGG + Intergenic
1047212274 8:122849573-122849595 GTGAAGACAGAGGCAGAGATGGG - Intronic
1047573735 8:126130631-126130653 GTGAAGACAGAGGCAGAGGTTGG + Intergenic
1047720014 8:127630444-127630466 GTGTGGATAGAAGTAGACATGGG + Intergenic
1047781856 8:128118202-128118224 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1048061393 8:130922596-130922618 GTGTAGAAAGAGGTAGACATGGG - Intronic
1048221299 8:132544682-132544704 GAGAGGAGAGAGGCAGAGCTGGG - Intergenic
1048835637 8:138516297-138516319 GTGTGAGCAGAGGCAGAGTTGGG + Intergenic
1049038856 8:140097671-140097693 CTGTGGACAGCGGCACAGCTGGG - Intronic
1049298079 8:141854530-141854552 GGGTGTACAGAGGCAGAGGTGGG + Intergenic
1049672094 8:143874483-143874505 GTGACGACAGAGGCAGAGATTGG + Intronic
1049704989 8:144037425-144037447 GTGTAGAAAGAGGTAGACATGGG + Intronic
1049892435 9:83286-83308 GTGTGGATAGAAGTAGACATGGG - Intergenic
1049938089 9:518611-518633 GTGTGTAAAGAGGAGGAGCTGGG + Intronic
1050065950 9:1759638-1759660 ATCTGAACAGAGGGAGAGCTGGG - Intergenic
1050120421 9:2301908-2301930 GTGAGGACAGAAGCAGAGATTGG - Intergenic
1050143269 9:2538683-2538705 GTGAGGACAGTGCTAGAGCTAGG - Intergenic
1050557023 9:6798626-6798648 GTGTGGAAAGAAGTAGACATGGG - Intronic
1050634891 9:7601948-7601970 GTGTGAAAAGAGGAAGAGATCGG - Intergenic
1050663593 9:7910542-7910564 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1050726142 9:8651385-8651407 GTGTGGACAGAGTTAGTTCATGG - Intronic
1051108058 9:13603503-13603525 GTGTGTAGAGAGGTGAAGCTGGG + Intergenic
1051661732 9:19433541-19433563 GTGTAGAAAGAGGTAGACATGGG - Intronic
1052236047 9:26214572-26214594 GTGTGGAAAGAGGTAGACATGGG - Intergenic
1052279432 9:26716116-26716138 GTGTGGAAAGAGGTAGACATAGG - Intergenic
1052473545 9:28930071-28930093 GTGTGAAAAGGGGTAGAGCAGGG - Intergenic
1052637876 9:31125785-31125807 TTCTGGAAAGAGGCAGAGCTTGG + Intergenic
1052818558 9:33121190-33121212 GTGAGGGCAGAGGTTGAGTTGGG - Intronic
1052858859 9:33424019-33424041 GTGTGGATAGAAGTAGACATGGG + Intergenic
1052970428 9:34373922-34373944 GTTTGGAGGGAGGTAGAGTTGGG + Intronic
1053317613 9:37065470-37065492 GTGATGACAGAGGCAGAGGTTGG + Intergenic
1053321993 9:37106926-37106948 GTGATGACAGAGGCAGAGGTTGG + Intergenic
1054359849 9:64101529-64101551 GTGTGGAGAGAGGTAGACATGGG + Intergenic
1054761036 9:69004365-69004387 GTGTGTACAGAGGTTCACCTGGG + Intronic
1054773391 9:69103996-69104018 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1055242314 9:74198248-74198270 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1055506746 9:76955877-76955899 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1055586744 9:77762705-77762727 GTGTGGAAAGAAGTAGACATGGG + Intronic
1056409686 9:86312720-86312742 GTGTAGAAAGAGGTAGACATGGG + Intronic
1056547523 9:87625194-87625216 ATGTGACCAGAGGTAGATCTCGG + Intronic
1056624614 9:88244479-88244501 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1056706794 9:88959088-88959110 GTGTAGAGAGAGGTAGACATGGG - Intergenic
1056783300 9:89568136-89568158 GTGGGGACAGAGCAAGGGCTTGG - Intergenic
1057087729 9:92227192-92227214 GTGTAGAAAGAGGTAGACATGGG - Intronic
1057154620 9:92830451-92830473 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1057751733 9:97797251-97797273 GTGTAGAAAGAGGTAGATATGGG + Intergenic
1058661726 9:107272696-107272718 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1058972624 9:110097339-110097361 GTGTAGAAAGAGGTAGACATGGG - Intronic
1059694843 9:116721234-116721256 ATCTGGGAAGAGGTAGAGCTGGG + Intronic
1059707685 9:116840263-116840285 GTGTAGAAAGAGGTAGACATGGG - Intronic
1060185622 9:121562382-121562404 GTGTAGAGAGGGGTAGGGCTGGG - Intergenic
1060334832 9:122711547-122711569 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1060352182 9:122868349-122868371 GTGTGGAAAGAAGTAGACATGGG + Intronic
1060483631 9:124032875-124032897 GTGTGGACCGAGGAACAACTTGG + Exonic
1061070080 9:128304264-128304286 GTGTGGGCAGAGGAAGAACCAGG + Intergenic
1061143248 9:128780757-128780779 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1061225380 9:129278262-129278284 GTGTGGAGAAGGGTGGAGCTGGG - Intergenic
1061427039 9:130506279-130506301 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1061618514 9:131795561-131795583 GTGTGAAGACAGGTAGAGATTGG - Intergenic
1061831745 9:133300439-133300461 GTGTGGAAAGAAGTAGACATAGG + Intergenic
1061870399 9:133517256-133517278 GTGGGGAGAGAGGGAGCGCTGGG - Intronic
1061994467 9:134176740-134176762 GTGAAGATAGAGGTAGAGATGGG - Intergenic
1062210240 9:135359727-135359749 GTGAAGACAGAGGCAGAGCCTGG + Intergenic
1062281969 9:135756223-135756245 GTGTGGAGAGCAGTAGAGCCTGG - Intronic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1203463715 Un_GL000220v1:67741-67763 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1203660628 Un_KI270753v1:38714-38736 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1203671802 Un_KI270755v1:21932-21954 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1185585071 X:1236631-1236653 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1185632526 X:1525421-1525443 GTGAAGACAGAGGCAGAGATTGG + Intronic
1185955343 X:4483044-4483066 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1186172260 X:6889880-6889902 GTGAGGAAACAGGTAGAACTGGG + Intergenic
1186666149 X:11719765-11719787 GTGATGACAGAGGCAGAGATTGG + Intergenic
1186967163 X:14800353-14800375 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1187183343 X:16964416-16964438 GTGTGGAAAGAGGTAGACATGGG - Intronic
1187184056 X:16968228-16968250 GTGTAGAAAGAGGTAGACATGGG - Intronic
1187204566 X:17169911-17169933 GATGGGACAGAGGGAGAGCTTGG - Intergenic
1187212427 X:17244660-17244682 GTGTGGAAAGAGGTAGACATAGG - Intergenic
1188367383 X:29333034-29333056 GTGTGGATAGAAGTAGACATGGG - Intronic
1188492624 X:30753743-30753765 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1188519019 X:31017110-31017132 ATGAATACAGAGGTAGAGCTAGG + Intergenic
1189210573 X:39278618-39278640 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1189246029 X:39564242-39564264 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1189458126 X:41212069-41212091 GTGTAGAAAGAGGTAGACATGGG + Intronic
1189569893 X:42285420-42285442 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1189837417 X:45039897-45039919 GTGTGGATAGAAGTAGACATGGG - Intronic
1189968136 X:46395044-46395066 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1190282221 X:48938729-48938751 TGGAGGACAGAGGTGGAGCTAGG - Intronic
1190799134 X:53772359-53772381 GTGTGGATAGAAGTAGACATGGG - Intergenic
1190820562 X:53967722-53967744 GTGTGGAAAGAAGTAGACATGGG + Intronic
1191010265 X:55749642-55749664 GTGTGGAAAGAAGTAGACATGGG + Intronic
1191068831 X:56379860-56379882 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1191835515 X:65457673-65457695 GTGTGGATAGAAGTAGACATGGG + Intronic
1191881634 X:65848587-65848609 GTGGGGACAGAGGCAGAGGCTGG + Intergenic
1192107257 X:68327386-68327408 GTGTGGATAGAAGTAGACATGGG + Intronic
1192352730 X:70371362-70371384 GTGTAGAAAGAGGTAGACATGGG - Intronic
1192386979 X:70680189-70680211 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1192500009 X:71644756-71644778 GTGTGGAAAGAAGTAGACATAGG - Intergenic
1192568040 X:72179583-72179605 GTGTGGATAGAAGTAGACATGGG + Intergenic
1192621701 X:72682532-72682554 GTGTGGAGAGAAGTAGACATGGG + Intronic
1192761448 X:74098960-74098982 GTGTGGAAAGAAGTAGACATGGG + Intergenic
1193082816 X:77422603-77422625 GTGTGGGCAGAGGTGGGGGTGGG - Intergenic
1193114748 X:77766076-77766098 GTGTAGAAAGAGGTAGACATGGG - Intronic
1193164475 X:78265231-78265253 GTGTGGAAAGAAGTAGACATGGG - Intergenic
1193345102 X:80396660-80396682 GTGTAGAAAGAGGTAGACATGGG - Intronic
1193362446 X:80591853-80591875 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1193782735 X:85723624-85723646 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1195010046 X:100724478-100724500 GTGTAGAAAGAGGTAGACATGGG + Intronic
1195306138 X:103585743-103585765 GTGTGGACAGAGATGGCGGTGGG + Intronic
1195634943 X:107103373-107103395 GTGATGACAGAGGCAGAGATAGG + Intronic
1196030831 X:111094397-111094419 TTGTAGAAAGTGGTAGAGCTGGG - Intronic
1196123144 X:112071437-112071459 GTGTAGTCAGTGGTAGAGTTGGG + Intronic
1196364788 X:114912153-114912175 GATTGGACAGAGGTAGAAGTTGG + Intergenic
1196778693 X:119362629-119362651 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1196983261 X:121239047-121239069 GTGTGGACTGAGTTAGAGAGAGG + Intergenic
1197199394 X:123734590-123734612 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1197241637 X:124128332-124128354 GTGTGGAAAGAGGTAGACATGGG - Intronic
1197897209 X:131327833-131327855 GTGTAGAAAGAGGTAGACATGGG + Intronic
1198706146 X:139450649-139450671 GTGAAGACAGAGGCAGAGATTGG + Intergenic
1198754450 X:139968368-139968390 ATGGGGACAGAGGTACAGTTTGG + Intergenic
1199231079 X:145436734-145436756 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1199256263 X:145721738-145721760 GTGTGGAAAGAAGTAGACATAGG - Intergenic
1199761575 X:150908321-150908343 GTGAAGACAGAGGCAGAGATTGG - Intergenic
1200280509 X:154773688-154773710 GTGTGGAGAGAAGTAGACATGGG - Intronic
1200324496 X:155223583-155223605 GTGTGGAAAGAGGTGGACATGGG - Intronic
1201282339 Y:12352531-12352553 GTGTGGAAAGAGGTAGACATGGG + Intergenic
1201313671 Y:12621609-12621631 GTGTGCCCAGCGGTGGAGCTGGG - Intergenic
1201335884 Y:12879159-12879181 GTGTAGAAAGAGGTAGACATGGG + Intergenic