ID: 1001477429

View in Genome Browser
Species Human (GRCh38)
Location 5:172060490-172060512
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4105
Summary {0: 3, 1: 71, 2: 530, 3: 1249, 4: 2252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001477429 Original CRISPR CTGTATCCTCACATAGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr