ID: 1001479604

View in Genome Browser
Species Human (GRCh38)
Location 5:172078889-172078911
Sequence GAAGTTGCCTAGTTTAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001479604 Original CRISPR GAAGTTGCCTAGTTTAGGAG GGG (reversed) Intronic
904285441 1:29450600-29450622 TAAGCTGCCAAGTTTTGGAGAGG + Intergenic
906821662 1:48936347-48936369 AAAGTTGCCTACCTAAGGAGAGG - Intronic
908139680 1:61171573-61171595 GAAGTTTCCTTATTTAGGAAAGG + Intronic
911388271 1:97205072-97205094 GAAGGTGCCGAGTTTGGGGGTGG - Intronic
911468431 1:98284645-98284667 GAAATTGCATAGCTTAGGATTGG - Intergenic
917746776 1:178017376-178017398 GAAGTTGCCTCTTTTTGAAGTGG + Intergenic
917957196 1:180111615-180111637 GAGCTTGCCTATTTTAGAAGTGG - Exonic
920990900 1:210938479-210938501 GATATTGCCTAGTTTAAGTGGGG - Intronic
921999248 1:221458093-221458115 GAAGTTGTTTACTTTAGGAATGG - Intergenic
1064949474 10:20832034-20832056 GAAGCTGGATGGTTTAGGAGTGG - Intronic
1066327570 10:34378724-34378746 TAATTTGCCTTGTTTGGGAGTGG - Intronic
1071729293 10:88232071-88232093 GCAGTTTCAAAGTTTAGGAGGGG + Intergenic
1074283077 10:112071458-112071480 GAAGTTGTCTAATTTAGGAGTGG + Intergenic
1074724357 10:116292097-116292119 GGAGTTGCCCAATTTAGGGGAGG + Intergenic
1080185749 11:29483266-29483288 AAAGTTGCACAGATTAGGAGTGG + Intergenic
1083019358 11:59490688-59490710 GAATTTGACTATTTTAGAAGTGG - Intergenic
1089051442 11:115549315-115549337 GGACTAGCCCAGTTTAGGAGGGG + Intergenic
1090240987 11:125181673-125181695 GGCTTTGCCTAGTTTGGGAGAGG + Intronic
1092749592 12:11706328-11706350 TAAGTTGCCCAGTTTAGTAAAGG + Intronic
1095708952 12:45267973-45267995 GAAGTTTCCTAAAATAGGAGAGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1098346276 12:69507204-69507226 GAAATTGACTAGTGTAGGAGAGG - Intronic
1100412558 12:94336029-94336051 AAAGTAGTCTAGTTTAGGAGAGG + Intronic
1101377310 12:104182350-104182372 GAAGTTGCCTAGTTTGGTTTAGG + Intergenic
1103152078 12:118649596-118649618 AAAGTTGCCTTGTTAAGGATTGG + Intergenic
1104933963 12:132354784-132354806 GAAGTTGCTGAGATTAGCAGCGG + Intergenic
1105727977 13:23184746-23184768 GAAGCCGGCTAGGTTAGGAGAGG - Intronic
1119310094 14:73638818-73638840 GAGGGTGCCTATTTTGGGAGTGG + Intergenic
1120768038 14:88349166-88349188 CATGTTGCCCAGTTTAAGAGTGG - Intergenic
1121616910 14:95319633-95319655 GGAGTTGCCAAGTGTCGGAGCGG + Intronic
1123494083 15:20806833-20806855 GTGGTTGCCTAGACTAGGAGGGG + Intergenic
1123550581 15:21375915-21375937 GTGGTTGCCTAGACTAGGAGGGG + Intergenic
1126733799 15:51711536-51711558 GAAGTTGCATTGTTTAGAAATGG + Intronic
1127172872 15:56321897-56321919 GTAGTTGCCGGGGTTAGGAGTGG + Intronic
1131378982 15:91948351-91948373 GCTGTTGCCAAGTTTAGAAGTGG + Intronic
1131441099 15:92460392-92460414 GCAATGGGCTAGTTTAGGAGGGG + Intronic
1202958924 15_KI270727v1_random:103169-103191 GTGGTTGCCTAGACTAGGAGGGG + Intergenic
1133897639 16:9944611-9944633 GTGGTTGCCTAGTTGCGGAGAGG + Intronic
1140922306 16:79550700-79550722 GAATTTGCCTAGTTTGGGTATGG + Intergenic
1141158406 16:81612643-81612665 GAACTTGGCAAGTTTGGGAGAGG + Intronic
1144817125 17:18042322-18042344 GCAGTTGCCTAGGATTGGAGTGG - Intronic
1151561309 17:74871384-74871406 ACAGTTGCCTAGCTTTGGAGAGG - Intronic
1154451610 18:14481290-14481312 GTGGTTGCCTAGACTAGGAGGGG + Intergenic
1154942632 18:21130193-21130215 ATAGTTGCCTAGGGTAGGAGGGG - Intergenic
1155273668 18:24165633-24165655 GAGGCTGCCTAGTGTGGGAGAGG + Intronic
1162940263 19:14005360-14005382 GAAGGTGGCAGGTTTAGGAGTGG + Intronic
1163429410 19:17258169-17258191 GAACTGGCCTGGTTGAGGAGTGG - Intronic
1163614873 19:18321015-18321037 GGAGTGGCCTAGGTTAGCAGCGG - Intronic
1166458212 19:42962605-42962627 GATGTTACCTACTTTTGGAGTGG + Intronic
1166475152 19:43117859-43117881 GATGTTACCTACTTTTGGAGTGG + Intronic
925788467 2:7456521-7456543 GAAGTGGCCTAGTCTCGAAGTGG + Intergenic
928163183 2:28948696-28948718 TTTGTTGCCTGGTTTAGGAGTGG - Intergenic
932631012 2:73343379-73343401 AAAGTAGCCTTCTTTAGGAGAGG + Intergenic
933252743 2:80047139-80047161 GAAGTTACTTTATTTAGGAGAGG - Intronic
934644861 2:96052873-96052895 GAAGTTGATTTGTTCAGGAGGGG - Intergenic
935601793 2:104929527-104929549 GTAGTTGCCTGGTTTATGAACGG + Intergenic
939636054 2:144583840-144583862 GAATTTGACTTGTTTGGGAGTGG - Intergenic
940355455 2:152737191-152737213 AAAATTGCATAGTTTATGAGGGG - Intronic
942068330 2:172292988-172293010 GAAGTTGCAGAGGTTGGGAGTGG - Intergenic
943034461 2:182724714-182724736 GTAGTTGTATAGTTTAGAAGTGG + Intronic
944264001 2:197705145-197705167 AGAGTTGCCGGGTTTAGGAGAGG - Intronic
948433261 2:237934281-237934303 CAAGCTGCCTGGTGTAGGAGGGG - Intergenic
1170379755 20:15744383-15744405 TAAGTTGCCTAGTCTAGTAATGG + Intronic
1170476684 20:16721876-16721898 ACAGTTACCTATTTTAGGAGGGG - Intergenic
1170700892 20:18702436-18702458 GAAGTTGGCTAATTTAGCAAGGG + Intronic
1173666938 20:44769744-44769766 GAAGATGCCCAGTTTAGGAGGGG + Intronic
1174610575 20:51794954-51794976 GAGGTTGCCTTGGTTAGGAAGGG + Intronic
1176444534 21:6808932-6808954 GTGGTTGCCTAGACTAGGAGGGG - Intergenic
1176822699 21:13673970-13673992 GTGGTTGCCTAGACTAGGAGGGG - Intergenic
1177739241 21:25134001-25134023 GAAGTTTCCTGGTTGAGGATGGG - Intergenic
950760634 3:15221613-15221635 AAAGTTGCATAGATTAAGAGTGG - Intronic
954314981 3:49796113-49796135 GAGGTTGCCTATTTAAGGGGAGG - Intronic
955967289 3:64401479-64401501 GAAGTTTCCTAGAGTAGAAGAGG + Intronic
956038189 3:65118195-65118217 GAAGTTGCCTAGGTTAAGACAGG + Intergenic
960131983 3:114066722-114066744 AAAGTTACCCAGGTTAGGAGTGG + Intronic
960888876 3:122425051-122425073 GGAGTTGACTAGTTTTGCAGTGG + Exonic
961999814 3:131284299-131284321 AAAGTTGCCTAGATCTGGAGAGG - Intronic
965951670 3:174316349-174316371 GAAGTTGACTAGATGAGAAGGGG - Intergenic
966485598 3:180465972-180465994 GAAGTTGAATAGTTTATGACTGG - Intergenic
967934160 3:194713363-194713385 GCAGTTGCCTATTTTAGGTTGGG + Intergenic
972263836 4:37439826-37439848 GTAGGTGCCTTGTTTATGAGAGG - Intronic
973934467 4:55828936-55828958 GAAGTTTTGTAGTTTAGGAATGG - Intergenic
974157066 4:58087504-58087526 AAAGTTGCATAGTCTAGAAGAGG - Intergenic
977739679 4:100463350-100463372 GAAGGTGCGAAGTTTAGTAGTGG - Intronic
978331572 4:107618829-107618851 GGAGTTGACTAGTTATGGAGGGG + Intronic
991079771 5:62585712-62585734 GAAGTTTCCTTGTTTTGGAAAGG + Intronic
993587902 5:89754971-89754993 GAAATTGCCTAGATTTTGAGGGG - Intergenic
994930178 5:106172781-106172803 TTAGTTGCCTAGTGCAGGAGTGG - Intergenic
996606214 5:125326601-125326623 GAAGTTACATAATTTAGGATGGG - Intergenic
999277577 5:150341642-150341664 GAATTGGCCAAGTTGAGGAGAGG - Intergenic
1001187303 5:169586818-169586840 TATGTTGACTAGTTTAGAAGGGG - Intronic
1001479604 5:172078889-172078911 GAAGTTGCCTAGTTTAGGAGGGG - Intronic
1007124795 6:39416933-39416955 GATGTAGCCCAGTTTGGGAGTGG + Intronic
1008230035 6:48975126-48975148 GAAGTTGCCTATATTGAGAGGGG + Intergenic
1008360030 6:50606233-50606255 TAAGTTTCCTAGGTTAGAAGCGG - Intergenic
1012641385 6:101621022-101621044 GGAGTTGCATTGTTTTGGAGAGG + Intronic
1012853795 6:104477113-104477135 GAAGTTCCCAAGACTAGGAGGGG - Intergenic
1017915807 6:158830916-158830938 GAAGTTGCCTGGTTAAGGCCGGG - Intergenic
1019546561 7:1579803-1579825 GAAGATGCATAATTTCGGAGAGG - Intergenic
1021607899 7:22427508-22427530 GGAGGTCCCTAGTTTAGGCGTGG + Intronic
1021805266 7:24348999-24349021 GCAGCTGCCTGGTTTAGGAAAGG + Intergenic
1025030671 7:55554265-55554287 GGAGTTGCCAAGGTCAGGAGAGG + Intronic
1038611789 8:29065683-29065705 GAAGTTGCCAAGTAGAGGCGGGG + Intergenic
1039260097 8:35762123-35762145 GAAGTTTCCTAGTAGAGGAGGGG - Intronic
1041187385 8:55314996-55315018 GAAATCACCTAGTTTAGGAACGG - Intronic
1043367682 8:79554374-79554396 GAAGTAGCTTAGTTTGGTAGGGG - Intergenic
1047009641 8:120657570-120657592 AAAGTGGCCTATTTTTGGAGAGG - Intronic
1050252594 9:3760949-3760971 GAATTTCCCTCCTTTAGGAGAGG - Intergenic
1058082927 9:100718430-100718452 GAATGTGCCTAGTTAAGGATAGG - Intergenic
1203524664 Un_GL000213v1:75595-75617 GTGGTTGCCTAGACTAGGAGGGG + Intergenic
1186184742 X:7009648-7009670 GATGTTACCTACTTTTGGAGTGG + Intergenic
1189399048 X:40647830-40647852 GAAGTGCCCTACATTAGGAGAGG - Intergenic