ID: 1001480973

View in Genome Browser
Species Human (GRCh38)
Location 5:172089084-172089106
Sequence TTGTTTAAGGGACTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001480973_1001480979 -2 Left 1001480973 5:172089084-172089106 CCCTCCACCAGTCCCTTAAACAA 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1001480979 5:172089105-172089127 AAGCTGAGTAGTTATCCCTCAGG 0: 1
1: 1
2: 0
3: 6
4: 76
1001480973_1001480984 24 Left 1001480973 5:172089084-172089106 CCCTCCACCAGTCCCTTAAACAA 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1001480984 5:172089131-172089153 TCAGCAACTGCAATTTCCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
1001480973_1001480980 -1 Left 1001480973 5:172089084-172089106 CCCTCCACCAGTCCCTTAAACAA 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1001480980 5:172089106-172089128 AGCTGAGTAGTTATCCCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 112
1001480973_1001480985 25 Left 1001480973 5:172089084-172089106 CCCTCCACCAGTCCCTTAAACAA 0: 1
1: 0
2: 1
3: 15
4: 226
Right 1001480985 5:172089132-172089154 CAGCAACTGCAATTTCCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001480973 Original CRISPR TTGTTTAAGGGACTGGTGGA GGG (reversed) Intronic
900546691 1:3233382-3233404 TGGTTTAAGTGATTGGGGGAAGG + Intronic
900796747 1:4712633-4712655 TTGTTGCTGGGACTGGTGGAAGG - Exonic
900978411 1:6032006-6032028 CTCTTTCAGGGACTGATGGAAGG - Intronic
903492754 1:23742200-23742222 TTGCTTAGGGAACTGGGGGAGGG + Intergenic
904375775 1:30081511-30081533 TTGGTTAAGGGACTTGTCTAAGG - Intergenic
905329309 1:37181216-37181238 TTGTTTTAGGGACTGAATGAGGG + Intergenic
907802832 1:57788993-57789015 TTGTTTAAGCGAAGGGTGGGGGG - Intronic
908058352 1:60317657-60317679 TTTTTAAAAGGATTGGTGGAAGG - Intergenic
911134814 1:94428549-94428571 TTGTAGGAGGGACTGGTGGGAGG + Intronic
911850914 1:102819247-102819269 TTGCTTGTGGGACTTGTGGAGGG + Intergenic
912727912 1:112075821-112075843 TGGGTGAAGGGACGGGTGGATGG + Intergenic
915813760 1:158945019-158945041 TTGGTGAAGGAACTGCTGGATGG - Exonic
915816609 1:158973748-158973770 TTATTTAAGGAACTGCTGGATGG - Exonic
915876052 1:159613193-159613215 TTGTGGGAGGGACTGGTGGGAGG - Intergenic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
920384842 1:205563821-205563843 TAGTTTAACGGACAGTTGGAAGG - Intergenic
920415327 1:205795616-205795638 TTCTTTTGGGGACTGGTGAATGG - Intronic
921676923 1:217986787-217986809 TGGTTTAAGGGGTTGGTGGTGGG - Intergenic
924538282 1:244957195-244957217 TAGTTTCAGGAACTGTTGGAGGG + Intergenic
1063556969 10:7089602-7089624 TTGTTTAAGCCACTTTTGGAAGG + Intergenic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1066701637 10:38135857-38135879 TTGTGAGAGGGACTGGTGGGAGG - Intergenic
1067170910 10:43904933-43904955 TTCTTCAAGGGGCTGGTAGAGGG + Intergenic
1070077006 10:73146348-73146370 TTTTTTAAGGGACTGATAGAAGG - Exonic
1070197385 10:74171434-74171456 TTGTTGAAGAGATTAGTGGATGG + Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1073390775 10:103174568-103174590 TTTTTTGAGGGAGTGCTGGATGG - Intronic
1073649863 10:105346890-105346912 TTATTTTAGGGAGTGGTGGAAGG - Intergenic
1073729548 10:106272223-106272245 TTGCTTAAGGGTTTGGGGGAGGG - Intergenic
1074214797 10:111373769-111373791 ATGTTTAAGGGAATGCTTGAAGG + Intergenic
1074359976 10:112817838-112817860 ATGTTTAAGGGAGTGGTTGGGGG + Exonic
1075281442 10:121142264-121142286 TTATTTAAGGCACTTGGGGAAGG + Intergenic
1075995671 10:126874245-126874267 TGGTTTAAGAGGCTGGTGGTTGG - Intergenic
1077365655 11:2160511-2160533 TTGTTTGAGGGGCGAGTGGAGGG + Intronic
1078571516 11:12462041-12462063 TTGTTTAAGGGACTGGGTTGGGG + Intronic
1078736164 11:14023070-14023092 TTGTTTAAGGAACTGGAGCTCGG + Intronic
1079664984 11:23093672-23093694 ATGTTTAAGGAAATGGTGGGTGG - Intergenic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1083737254 11:64688462-64688484 GACTTCAAGGGACTGGTGGAGGG + Intronic
1084537912 11:69768698-69768720 ATGTTTAAGGCACTGTGGGATGG - Intergenic
1087660726 11:100985104-100985126 TATTTTATGGGACTGGTTGAGGG - Intronic
1087837047 11:102885847-102885869 TTATTTAAGTGACAGGTGGATGG + Intergenic
1088088727 11:106012280-106012302 TGGTTTAAGGGAGGGGAGGATGG - Intronic
1090466756 11:126941896-126941918 ATGTTTAAGGAACTTGTTGATGG - Intronic
1091849585 12:3684428-3684450 TTGGTTAAGGGGGTAGTGGAGGG + Intronic
1094169590 12:27478692-27478714 TTGTTCAAGGGCCTGGTGATAGG - Intronic
1095043938 12:37477880-37477902 TTGTTTTGGTGACTGGTAGATGG - Intergenic
1097735515 12:63177152-63177174 CTATTTAGGGGACTGTTGGAAGG + Intergenic
1098022225 12:66168368-66168390 TGGTTCCAGGGACTGGGGGAAGG + Intronic
1098381142 12:69870865-69870887 CTCGTTAAGGGACTGCTGGATGG + Intronic
1101578638 12:106021414-106021436 TTGTTTAAGCCACTGGAGTAGGG - Intergenic
1104500607 12:129282052-129282074 TTGTGGAAGGGATTGATGGAGGG - Intronic
1104524257 12:129503385-129503407 TTGTTTAGGGGACTGGGTGTTGG + Intronic
1108672031 13:52700968-52700990 TTATTTGAGGTGCTGGTGGAAGG + Intergenic
1109244749 13:59940068-59940090 TTGTTTAGGGGAGTGGGGGCAGG - Intronic
1109833789 13:67828388-67828410 TAGGTTAAGGGACAGGTGTAGGG + Intergenic
1110830944 13:80030192-80030214 TTCTGAAAGGGACTTGTGGATGG - Intergenic
1111172724 13:84549962-84549984 TTGTGGGAGGGACTGGTGGGAGG - Intergenic
1115342678 14:32308918-32308940 TTGTTTGATGGACAGATGGATGG - Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117671470 14:58111059-58111081 TTTTTTAATGGACTGGTTTATGG + Intronic
1117840246 14:59853389-59853411 ATGTTTATGTGACTGGCGGATGG - Intronic
1118156466 14:63247244-63247266 TTGCTTAAGGGACTTGTTGAGGG - Intronic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1121315868 14:92960723-92960745 TGGTTAAAGGGGCTGGTGGAAGG + Intronic
1202942481 14_KI270725v1_random:165513-165535 TTGTTTTGGTGACTGGTAGATGG - Intergenic
1124362689 15:29049692-29049714 GTCTTTCAGCGACTGGTGGATGG - Intronic
1126290937 15:47077983-47078005 TTGTTTTGGTGACTGGTAGACGG + Intergenic
1130073053 15:80665302-80665324 CTGTTTAAGGGACTGAGAGAAGG + Intergenic
1132280773 15:100612806-100612828 ATGTTTAAAGGACTGGTGCTCGG - Intronic
1132653820 16:1033344-1033366 TGGATTGATGGACTGGTGGAAGG - Intergenic
1132653870 16:1033580-1033602 TGGATTGATGGACTGGTGGATGG - Intergenic
1135350592 16:21726124-21726146 TTGATTGATGGACTGGTTGAGGG - Intronic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137797165 16:51231445-51231467 TTTTTTAAGTGCCTGGTGGCAGG + Intergenic
1138341146 16:56289854-56289876 TTGTTTGGGGGACTGGGGCAGGG - Intronic
1138629716 16:58283612-58283634 TTGTTTGACGGAATGGTTGACGG + Exonic
1139171689 16:64638036-64638058 TTGTGGGAGGGACTGGTGGGAGG + Intergenic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1145988967 17:29066665-29066687 TTGTTAAAGGGACTGGCAGTGGG - Intergenic
1146142578 17:30379933-30379955 TTGTTCAAGGGATGGCTGGAGGG + Intronic
1146165748 17:30587076-30587098 ATGTTTGAGGGCCTGGTGGTGGG + Intergenic
1147213926 17:38888089-38888111 TTACTTCAGGGACTGGTGGGTGG - Intronic
1147702091 17:42402722-42402744 TGTTTTAAGGGATTGGGGGAGGG - Exonic
1148886563 17:50777577-50777599 TTGTTTAAGGCACCAGTTGATGG + Intergenic
1149458413 17:56808198-56808220 TTCCTTGAGGGAATGGTGGATGG - Intronic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1203167534 17_GL000205v2_random:111661-111683 TTCTGTAAGGGATTGCTGGAAGG + Intergenic
1154082547 18:11272674-11272696 TTGTGACAGGGACTGGTGGGAGG + Intergenic
1155404623 18:25474192-25474214 GAGGTTAAGGGACTTGTGGAAGG + Intergenic
1155846633 18:30716179-30716201 TTATTTAAGGGACAGGTTTAAGG + Intergenic
1157427258 18:47594572-47594594 TTGTTAAAGGGGCGGGTGGGGGG + Intergenic
1157615212 18:48982980-48983002 TTGTTCAAGGGACTCTTGAAGGG + Intergenic
1159193789 18:65084899-65084921 TTTTTTAATTGACTGGTGCAAGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1161429678 19:4224348-4224370 TGGTCTATGGGAGTGGTGGAGGG + Intronic
1162742233 19:12779792-12779814 TGGTTTCGGGGACTGGGGGAGGG + Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163703431 19:18798713-18798735 TTGTTCAGGGGAGTGATGGATGG + Intergenic
1164514633 19:28923269-28923291 TAGTTTAAGTGAGTGGTAGATGG + Intergenic
1164776811 19:30859098-30859120 ATGTTGGAGGGACTGATGGAAGG - Intergenic
1165586344 19:36919426-36919448 TTTTTCCAGGGACTGGGGGATGG + Intronic
925640613 2:5982909-5982931 TTGTTCAAGGGATGGGGGGAAGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
926942295 2:18151439-18151461 TGGATGTAGGGACTGGTGGAAGG - Intronic
929380913 2:41352308-41352330 TTTTTTAAGGGTCAGGTAGAAGG - Intergenic
932387511 2:71349883-71349905 TTGGTTAATGGATTGGTTGACGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933818566 2:86088977-86088999 TTGTTTAAGAAAGTGGTGGTGGG - Intronic
935309231 2:101766777-101766799 TTCTTTATGTTACTGGTGGACGG + Intronic
935798826 2:106671878-106671900 GACTTTAAGGGACTGTTGGAAGG + Intergenic
936261674 2:110965459-110965481 TTGTTTTAGGCACTGTTGGTGGG - Intronic
938106288 2:128532630-128532652 TGTTTTCAGGGACTGGGGGATGG + Intergenic
938736132 2:134188382-134188404 GTGGTTAAGGGACTTGTGCAAGG - Intronic
941516696 2:166488932-166488954 TTATTTAAGAGACTGTTGGTCGG - Intronic
944045750 2:195410000-195410022 GTGTTGGAGGGACTGTTGGAGGG - Intergenic
944742726 2:202628096-202628118 TTGTTTAAGGAACCAGAGGAAGG - Intergenic
947810211 2:232999403-232999425 TTGTGTCGGGGACTGGTGGGTGG + Intronic
948055877 2:235008978-235009000 TTGCCCAAGGGACAGGTGGACGG + Intronic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
1170142819 20:13142248-13142270 TTGTTTGTGGGACGGCTGGAAGG - Intronic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170691425 20:18619255-18619277 TTGCTTAAGGGACTGTTTGCTGG + Intronic
1171538466 20:25921465-25921487 TTGTTTTGGTGACTGGTAGACGG - Intergenic
1171802668 20:29639960-29639982 TTGTTTTGGTGACTGGTAGACGG + Intergenic
1171841414 20:30216751-30216773 TTGTTTTGGTGACTGGTAGATGG - Intergenic
1172633696 20:36395048-36395070 TGGGTGAAGGGACTGGTGCAAGG - Intronic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1175497293 20:59423739-59423761 TTGTCTACGAGACTGGGGGAGGG - Intergenic
1175653496 20:60749236-60749258 TGGCTTAAGCAACTGGTGGATGG + Intergenic
1176404224 21:6347474-6347496 TTCTGTAAGGGATTGCTGGAAGG - Intergenic
1176432933 21:6641630-6641652 TTCTGTAAGGGATTGCTGGAAGG + Intergenic
1182454182 22:30439316-30439338 TAGTTTAAGGGAAGGGTGGCGGG + Intergenic
1183107906 22:35627872-35627894 TTTTTCAAGGGAATGGTGGGAGG - Intronic
1183814057 22:40284290-40284312 TAGATTAAGGGACTGCTGTAGGG - Intronic
949519291 3:4835120-4835142 TTGCTTAAGATACTGGTGGGTGG - Intronic
949981399 3:9504019-9504041 TTTTTTAAGAGATTGGGGGAGGG - Intronic
951803318 3:26621590-26621612 TTGATTTAGGGTGTGGTGGAGGG - Intergenic
952140295 3:30471387-30471409 CTGATTAAGGGACAGTTGGAAGG - Intergenic
954271281 3:49511478-49511500 TTGTTTCATGGACAGGTGGGTGG + Intronic
954593777 3:51806597-51806619 TTTTTTAATGGAGTGCTGGATGG - Intergenic
954966382 3:54614844-54614866 TTTTTTTGGGGAGTGGTGGAGGG - Intronic
955278965 3:57575288-57575310 TTTTTGAAGGGAGAGGTGGAAGG - Intronic
955501847 3:59592978-59593000 TGGTTTAAAGGAAAGGTGGAAGG + Intergenic
957774684 3:84741858-84741880 TTTTCTAAGGGACTGGTTGCTGG + Intergenic
957949656 3:87107972-87107994 TTGTGGGAGGGACTGGTGGGAGG + Intergenic
960155351 3:114292772-114292794 TTGTCTAAGGGTCTGGAGGTGGG + Intronic
960194190 3:114745244-114745266 TTGTTTGTGGAACTGTTGGACGG - Intronic
960355431 3:116647037-116647059 TAGTATAAGGGATGGGTGGATGG - Intronic
961016338 3:123471145-123471167 AAGTTTAAGGGACCTGTGGAAGG + Intergenic
961512685 3:127412801-127412823 GGATTTCAGGGACTGGTGGAAGG + Intergenic
962368513 3:134802049-134802071 TTGTTAAATAGACTGGAGGAAGG + Intronic
964589602 3:158345525-158345547 TTGTTTAAAGGCCTGCTGGGAGG - Intronic
967767333 3:193295610-193295632 TTGTATAAGGGAATGTTGAATGG + Intronic
967901406 3:194457160-194457182 TTATTTAGGGGACTGGATGAAGG - Exonic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971091335 4:23349084-23349106 TTGTTTAAGCCACTGGTGTATGG + Intergenic
972202541 4:36732261-36732283 TTGTGGCAGGGACTGGTGGGAGG - Intergenic
972799639 4:42461357-42461379 TTGTGGGAGGGACTGGTGGGAGG + Intronic
976864479 4:89707466-89707488 TGGATTAAGAGACTGGAGGATGG - Intergenic
978257272 4:106707970-106707992 TTGTGTAAGGGACTGGCTGTAGG - Intergenic
978491634 4:109316811-109316833 TTGTTTGAGGGTTTGGGGGAAGG - Intergenic
978957667 4:114634161-114634183 TTGCTTGAGCAACTGGTGGATGG + Intronic
979764312 4:124446154-124446176 GAGTTTGAGGGACTGTTGGAAGG - Intergenic
980082852 4:128362765-128362787 GTGTTTAGGGTACTGGAGGAAGG + Intergenic
980427247 4:132642128-132642150 TTGTTTAATTGCCTGGTGCATGG + Intergenic
985385517 4:189443236-189443258 TGGTTTAAAGCACTGATGGATGG - Intergenic
989711223 5:44399647-44399669 ATGTTTAAGAGCCTGATGGAAGG + Intergenic
994841100 5:104926080-104926102 TTGTTGAGGGGAGTGGTGGTAGG - Intergenic
996677143 5:126189302-126189324 TTGTTGAGGGGAGTGGAGGAGGG - Intergenic
997045475 5:130311762-130311784 ATTTTTAAGGTATTGGTGGATGG - Intergenic
999625704 5:153517987-153518009 CTGTTTAAGGAACTGAAGGAAGG - Intronic
1000245622 5:159446539-159446561 TTGTTTAAGGGTCTGGCACATGG - Intergenic
1000702042 5:164464240-164464262 TTGTTTTAGGGATTTGTGAAAGG - Intergenic
1001104242 5:168839702-168839724 TTATTTAGGAGACTGGGGGAGGG - Intronic
1001319595 5:170669516-170669538 TTGTTGAAAGGACAGATGGATGG + Intronic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1001928136 5:175654062-175654084 TTGTTTAAGATACTTGGGGAAGG - Intergenic
1002701451 5:181127912-181127934 TAGTTTAAGAGACTGGGGGAGGG - Intergenic
1002853600 6:1018619-1018641 TTGTTTAAGGCAATGGTTAATGG - Intergenic
1003233454 6:4275331-4275353 GTGTGTAAGGCACTGGTTGAAGG - Intergenic
1006303481 6:33206245-33206267 TTTTCTAGGGGACTGGTGGTTGG + Intronic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1008161934 6:48088741-48088763 TAGTTTAAAGGAATGGGGGATGG + Intergenic
1008591539 6:52998309-52998331 TTATATAAGGGACTGGAGCATGG - Intergenic
1010620026 6:78062605-78062627 TTTTTCAAGGGACTCATGGAAGG - Intergenic
1011679390 6:89768247-89768269 TTGTGCAAGGGACAGGTGGGAGG + Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012768387 6:103397798-103397820 GAGTTTAGGGGACTGTTGGATGG + Intergenic
1013794390 6:113869406-113869428 TTATGTGAGGGACTGGTGGAAGG + Intergenic
1017064581 6:150517657-150517679 TTGTTTTGGGCACTGGTTGAGGG - Intergenic
1017549714 6:155493089-155493111 TCGTAGAAGGGACTGGTGGGAGG + Intergenic
1018159398 6:161023553-161023575 CTGTTTATGGCACTGGTGCATGG + Intronic
1018748689 6:166782467-166782489 TTGTTTAAGAGTCTGGTGCATGG - Intronic
1021264903 7:18508119-18508141 TTGTTCAATGGAATGATGGATGG + Intronic
1023031490 7:36093763-36093785 TTTTTTCACGGACTGGTGGGTGG - Intergenic
1025289864 7:57707433-57707455 TTGTTTTGGTGACTGGTAGATGG - Intergenic
1025636500 7:63324531-63324553 TTGTTTCACGGCGTGGTGGATGG + Intergenic
1025646196 7:63423571-63423593 TTGTTTCACGGCGTGGTGGATGG - Intergenic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1030195438 7:106848614-106848636 TTGTTTTAAGGAATGGAGGATGG + Intergenic
1031461383 7:122053418-122053440 CACTTTAAGGAACTGGTGGATGG + Intronic
1034442830 7:151095612-151095634 TTTTTCCAGGCACTGGTGGATGG + Intronic
1037373972 8:18208889-18208911 TTGTTTTAGGGTCTGGCGGAAGG - Intronic
1038768351 8:30451816-30451838 ATCTTTTAGGGACTGGGGGACGG + Intronic
1039175346 8:34798065-34798087 TGGTTTAAGGTACAGGTGAAAGG + Intergenic
1039285914 8:36040813-36040835 TGGTTTAAGAGACTAGTGGGAGG + Intergenic
1040737796 8:50531728-50531750 TTGTGTGAGGGACACGTGGAGGG - Intronic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048910535 8:139130474-139130496 GTATTTAAGGGCCTGGTGGCTGG + Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1055914140 9:81382967-81382989 TTGTGGGAGGGACTGGTGGGAGG - Intergenic
1056254526 9:84785228-84785250 TTGTTTAAGGGCCTGTGTGATGG - Intronic
1056302077 9:85252304-85252326 TGGTTTGAGGGACTAGGGGAGGG - Intergenic
1058759555 9:108117908-108117930 TTGTTTAATGGACTGCTCCACGG + Intergenic
1058816887 9:108692464-108692486 TATGTGAAGGGACTGGTGGAGGG - Intergenic
1060276111 9:122184101-122184123 TTGGTTGAGGGTCTGGTGCATGG - Intronic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1061141446 9:128769937-128769959 TTGTTGAAGTGTCTGGTGGTTGG - Intronic
1061892005 9:133627166-133627188 TTGGAGGAGGGACTGGTGGAAGG - Intergenic
1062015628 9:134289717-134289739 CTGTTTCACAGACTGGTGGACGG + Intergenic
1203438602 Un_GL000195v1:167040-167062 TTCTGTAAGGGATTGCTGGAAGG - Intergenic
1185992088 X:4902561-4902583 TTGTTTCAGGGACCTGGGGAAGG - Intergenic
1186304062 X:8234984-8235006 TGGTTTAAGGGAATGTTGTATGG + Intergenic
1186481811 X:9901911-9901933 TGGATGGAGGGACTGGTGGATGG + Intronic
1187811882 X:23188253-23188275 TTTTTTAAGGGACTCCTGAAAGG + Intergenic
1189487790 X:41446259-41446281 TGTTTTAGGAGACTGGTGGAGGG - Intergenic
1189642752 X:43090927-43090949 TTGTTTAATGTACAGGTGTATGG + Intergenic
1191211359 X:57888765-57888787 TATTTTAGGGGACTGTTGGAAGG - Intergenic
1191718544 X:64209907-64209929 TTGGACAAGGGACTGCTGGATGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194446458 X:93993268-93993290 TGATTAAAGGAACTGGTGGAGGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195545080 X:106105040-106105062 TTGTGGGAGGGACTGGTGGGAGG + Intergenic
1196412238 X:115432538-115432560 TTGCTACAGGGACTGGTGGGTGG + Intergenic
1197451779 X:126628607-126628629 GACTTTGAGGGACTGGTGGAAGG - Intergenic
1197569261 X:128129005-128129027 TCGTTTAAGGATCTGGAGGATGG - Intergenic
1197811026 X:130443266-130443288 TTGATTATGTGTCTGGTGGAGGG + Intergenic
1199212904 X:145234820-145234842 ATGTTCAAGTGACTGGAGGAAGG + Intergenic
1202328163 Y:23714995-23715017 TTGTTTGATGGATTGATGGATGG + Intergenic
1202542607 Y:25955057-25955079 TTGTTTGATGGATTGATGGATGG - Intergenic