ID: 1001483615

View in Genome Browser
Species Human (GRCh38)
Location 5:172104867-172104889
Sequence TACCCACTAAAAACCCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001483611_1001483615 4 Left 1001483611 5:172104840-172104862 CCAGGCAGGGGGTGCTTATGTGA 0: 1
1: 2
2: 7
3: 33
4: 170
Right 1001483615 5:172104867-172104889 TACCCACTAAAAACCCTAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001483615 Original CRISPR TACCCACTAAAAACCCTAAG GGG Intronic
903021207 1:20396532-20396554 TACCCACCACACACCCTAAGAGG - Intergenic
903706835 1:25292117-25292139 TACTCCCTCAAAACCCTATGTGG - Intronic
903720398 1:25401224-25401246 TACTCCCTCAAAACCCTATGTGG + Intronic
908306306 1:62822228-62822250 TACACACTACAAACACTAGGTGG - Intronic
908718382 1:67095634-67095656 TCCCCACTCAAAATCCAAAGAGG - Intronic
908873877 1:68647559-68647581 AACCCACCAAAAAACCTAAGTGG + Intergenic
912118185 1:106434041-106434063 TACCCCCAAACAACCCTCAGAGG - Intergenic
912630889 1:111245867-111245889 TACCCACTACAACCCCTTTGAGG + Intergenic
913703229 1:121395219-121395241 TCCCAACTAAAGACACTAAGAGG + Intergenic
913939667 1:125088714-125088736 TCCCAACTAAAGACACTAAGAGG - Intergenic
913979401 1:143496383-143496405 TCCCAACTAAAGACACTAAGAGG + Intergenic
914073806 1:144322033-144322055 TCCCAACTAAAGACACTAAGAGG + Intergenic
914105349 1:144644327-144644349 TCCCAACTAAAGACACTAAGAGG - Intergenic
915403471 1:155641380-155641402 TGCCCCTTAAAAACCCTAATTGG - Intergenic
917123531 1:171665306-171665328 AACCCTCTAACAACCCTATGTGG - Intergenic
922587048 1:226741560-226741582 TCCTCATTAAAAACCCTACGAGG + Intergenic
1064141223 10:12792090-12792112 TATCCACCAAAAAGCCAAAGTGG - Intronic
1068831211 10:61497370-61497392 TTCCCCCAAAAAACCCCAAGTGG + Intergenic
1073643111 10:105273096-105273118 TAACCACTTAAAACCTTAATTGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1083799940 11:65040961-65040983 TACACGTTAAAAACACTAAGGGG + Exonic
1087084503 11:94202937-94202959 TTTCCACAAAAAACCCTCAGTGG - Intergenic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1089777120 11:120845925-120845947 TACCCAATGCAAACCCTGAGAGG + Intronic
1090553583 11:127849790-127849812 TCCCCAGAAAAATCCCTAAGTGG + Intergenic
1093635348 12:21459967-21459989 TACACACTTAATACCCTAATTGG + Intronic
1093713548 12:22355217-22355239 TACCTATTAATAAACCTAAGGGG - Intronic
1097629349 12:62040759-62040781 TACCCACGAATGACACTAAGAGG + Intronic
1098974935 12:76892632-76892654 TACTCAATAAAAAACCTGAGGGG - Intergenic
1103514184 12:121496195-121496217 TAGCCAAAAAAAACCCTATGTGG - Intronic
1104789683 12:131473665-131473687 TTCCCACTGAAGACCCCAAGGGG + Intergenic
1105984947 13:25556710-25556732 AACCCACCAGGAACCCTAAGGGG + Intronic
1108367620 13:49731543-49731565 TAAATACTAAAAACCCTTAGTGG + Intronic
1115978615 14:39024108-39024130 TACCAACTTAAAACCAAAAGGGG + Intergenic
1118180160 14:63484263-63484285 TACAGACTAAAAAGCCTGAGAGG + Intronic
1119508269 14:75191372-75191394 GACCCACTAAAACATCTAAGAGG + Intergenic
1122364223 14:101185002-101185024 TACCCAACAAATACCCTAAAGGG - Intergenic
1123432496 15:20230705-20230727 TTCCTAATATAAACCCTAAGAGG + Intergenic
1126048022 15:44662680-44662702 AGCCCACTCAAAACACTAAGAGG + Intronic
1126623465 15:50663619-50663641 TACGAACCAAAAACCTTAAGAGG + Intronic
1133718269 16:8470047-8470069 TACTCACTAAAAATACTAACAGG - Intergenic
1134897876 16:17906195-17906217 TATCTACTGAAACCCCTAAGAGG + Intergenic
1136768717 16:32812945-32812967 TCCCAACTAAAGACACTAAGAGG - Intergenic
1136799399 16:33058178-33058200 TCCCAACTAAAGACACTAAGAGG + Intergenic
1136840495 16:33537085-33537107 TATCACCTAAAAATCCTAAGAGG + Intergenic
1136852142 16:33620442-33620464 TTCCTAATATAAACCCTAAGAGG - Intergenic
1203113739 16_KI270728v1_random:1468910-1468932 TTCCTAATATAAACCCTAAGAGG - Intergenic
1203150661 16_KI270728v1_random:1837378-1837400 TATCACCTAAAAATCCTAAGAGG + Intergenic
1144970689 17:19107509-19107531 TCCTCATAAAAAACCCTAAGAGG - Intergenic
1147950507 17:44105090-44105112 TCCCCACTAAAAAACAGAAGGGG + Intronic
1152852765 17:82647799-82647821 TACCTACTAAAGACCCTGAAAGG + Intronic
1165028743 19:32982103-32982125 TTCCTAATATAAACCCTAAGAGG + Intronic
1168582276 19:57565573-57565595 TGCCCCTTGAAAACCCTAAGTGG - Intergenic
940000138 2:148959420-148959442 TCCCCCAAAAAAACCCTAAGGGG - Intronic
945582439 2:211611968-211611990 TACCCTCTGAAAACCCTTTGAGG - Intronic
947247473 2:228065620-228065642 CACAAACTCAAAACCCTAAGGGG - Intronic
1169933661 20:10859926-10859948 TACCCACTAAATACCCAAGTAGG - Intergenic
1170614359 20:17937038-17937060 TACACAAAAAAGACCCTAAGGGG - Intergenic
1172410766 20:34721184-34721206 GCCCCACTAAAAACCCAAAAGGG + Intronic
1176357764 21:5966703-5966725 TCCCCACTGAAAACCGGAAGGGG + Intergenic
1179487676 21:41721364-41721386 TACCCTCAAAGAACCCTGAGTGG - Intergenic
1179765754 21:43571848-43571870 TCCCCACTGAAAACCGGAAGGGG - Intronic
1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG + Intronic
1181655132 22:24291157-24291179 TACCCACTGAAAATCCAAAAAGG - Intronic
1182433441 22:30314847-30314869 AACCCACAAAAAACCCACAGAGG + Intronic
950271366 3:11618327-11618349 TATCCAATAAAAAAACTAAGAGG + Intronic
959084784 3:101840274-101840296 TACCCACTATAGACACCAAGAGG - Intronic
965452558 3:168856922-168856944 TATCCAATAAAAACCCAAACAGG - Intergenic
975637873 4:76468480-76468502 TAACTACTGAAAGCCCTAAGAGG - Intronic
981234249 4:142396425-142396447 TACCCACTAAAATAGCTAAGTGG + Intronic
982261558 4:153498625-153498647 CACTCTCTATAAACCCTAAGGGG - Intronic
990282321 5:54264473-54264495 TCCCTACTCAAAACCCTATGAGG + Intronic
990335243 5:54765979-54766001 TCCCCATAAAAACCCCTAAGAGG + Intergenic
990454805 5:55974805-55974827 TCCTCACTAATAACCCTAGGAGG + Intronic
991317841 5:65330226-65330248 TACATACTAAAATCCCCAAGGGG - Intronic
996326213 5:122277360-122277382 TGCCTACAAAAAACCCTTAGTGG - Intergenic
996837373 5:127808475-127808497 TTCTCACTTAAAACCCTCAGTGG + Intergenic
997932564 5:138084310-138084332 TACCCACTGAGGGCCCTAAGGGG + Intronic
1001483615 5:172104867-172104889 TACCCACTAAAAACCCTAAGGGG + Intronic
1002410835 5:179074920-179074942 TAACCACTAAAAATACAAAGAGG + Intronic
1005094742 6:22102508-22102530 TACACACCAAAAATCTTAAGAGG - Intergenic
1008838592 6:55869192-55869214 TACACACTAAAATACCGAAGTGG - Intronic
1019125423 6:169837511-169837533 TTCCCACTACACATCCTAAGAGG - Intergenic
1020154471 7:5711130-5711152 TATTCACTAAAAACTCTAAGTGG + Intronic
1020439032 7:8197678-8197700 AGCCCACCAAAAACTCTAAGGGG + Intronic
1025481583 7:60991058-60991080 TCCCAACTAAAGACACTAAGAGG + Intergenic
1025838610 7:65122341-65122363 TCCCAACTAAATACACTAAGAGG + Intergenic
1025878663 7:65510757-65510779 TCCCAACTAAATACACTAAGAGG - Intergenic
1025884462 7:65573641-65573663 TCCCAACTAAATACACTAAGAGG - Intergenic
1029932453 7:104386853-104386875 CACCAACTAAAAACCCTGGGTGG + Intronic
1032598922 7:133272134-133272156 TTCTCACTAACAACCCTATGTGG + Intronic
1033465554 7:141586160-141586182 TACCCTCTAAAGAGGCTAAGCGG - Intronic
1033711138 7:143946710-143946732 TAACCACTAAAAAACGTGAGTGG - Intergenic
1035053905 7:156021061-156021083 GACCTTCTAAAAAACCTAAGTGG + Intergenic
1037233336 8:16686826-16686848 CAGCCACTAAAAACTCTAGGTGG + Intergenic
1047822035 8:128531460-128531482 TCCCCAGTGAAAACCCTTAGTGG + Intergenic
1052105254 9:24506650-24506672 TACACACTAAAAACACAAAAAGG - Intergenic
1060902540 9:127273082-127273104 TCCCCACAAAAAACCATATGAGG + Intronic
1061316055 9:129796462-129796484 TCCCCACTTAAAATCCTGAGAGG - Intergenic
1186171881 X:6885506-6885528 TACCCAATACAAACCTTAAGGGG + Intergenic
1190853356 X:54268219-54268241 TACCCACTAAAAGGAATAAGGGG + Intronic
1193667475 X:84339688-84339710 TACCCAGTAAAAACTCTAGAGGG + Intronic
1195960883 X:110385224-110385246 AACCCTCACAAAACCCTAAGAGG - Intronic
1199329819 X:146546007-146546029 GATCCACTAAATACCCTAATTGG + Intergenic