ID: 1001486735

View in Genome Browser
Species Human (GRCh38)
Location 5:172125176-172125198
Sequence ATGCAGATGCCGAAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001486735_1001486743 29 Left 1001486735 5:172125176-172125198 CCTGGCTCTTTCGGCATCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1001486743 5:172125228-172125250 TCAATCTCGTCAACAGGCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 78
1001486735_1001486742 23 Left 1001486735 5:172125176-172125198 CCTGGCTCTTTCGGCATCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1001486742 5:172125222-172125244 TTTTGATCAATCTCGTCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 49
1001486735_1001486736 -1 Left 1001486735 5:172125176-172125198 CCTGGCTCTTTCGGCATCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1001486736 5:172125198-172125220 TATGCCCTAGTGACCCACTGAGG 0: 1
1: 0
2: 3
3: 5
4: 103
1001486735_1001486737 0 Left 1001486735 5:172125176-172125198 CCTGGCTCTTTCGGCATCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1001486737 5:172125199-172125221 ATGCCCTAGTGACCCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001486735 Original CRISPR ATGCAGATGCCGAAAGAGCC AGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
902078324 1:13804481-13804503 ATGCAGACGCCGCAAGAGCATGG - Intronic
907947792 1:59151517-59151539 AGGAAGATGCTGAAAGAGACTGG + Intergenic
908508294 1:64828004-64828026 AGGCAGATGGCAAAAAAGCCAGG - Intronic
909425735 1:75522617-75522639 ATGCATATGACTAAAGAGTCGGG - Intronic
910146572 1:84086569-84086591 ATGCAGGTGGCAGAAGAGCCAGG - Intronic
911499743 1:98670424-98670446 ATGCAGCTGCAGAAAGGGACAGG + Intronic
916029230 1:160862087-160862109 ATCCAGATGCCACAGGAGCCTGG - Intronic
917963533 1:180164613-180164635 AGACAGATGCAGGAAGAGCCTGG - Intronic
918287342 1:183070378-183070400 AGAGAGATGCCTAAAGAGCCAGG - Intronic
923475796 1:234329889-234329911 ATGAAGATGCCAAAAGAGAGTGG - Intergenic
1065105695 10:22381565-22381587 ATGCAAATGCCCACAGGGCCCGG - Intronic
1066287205 10:33979848-33979870 ATGCATTTGCCGAAGGAGCAGGG - Intergenic
1067554857 10:47261628-47261650 ATGCTGATGCCCAGAGAGACAGG - Intergenic
1068938616 10:62659090-62659112 AGGCAGAAGACAAAAGAGCCTGG + Intronic
1070252783 10:74787623-74787645 AAGCAGATGCGGGAAGAGCAGGG + Intergenic
1071072230 10:81708194-81708216 ATGCACATGGATAAAGAGCCAGG - Intergenic
1071257704 10:83887658-83887680 ATGCAGATGTTCAAAGAGCTTGG - Intergenic
1071515745 10:86295570-86295592 TTGCAGATGCGGAAAGAGAGGGG + Intronic
1072633671 10:97164064-97164086 ATGCAGAGTCCCACAGAGCCAGG - Intronic
1091237213 11:134030416-134030438 ATATAGAAGCCGAAAGAGCTCGG - Intergenic
1101733651 12:107446636-107446658 ATGCAGATGCGGCTAGACCCTGG - Intronic
1106085015 13:26534134-26534156 ATGGAGCTTCCGAAAGAGCTAGG + Intergenic
1108415294 13:50192311-50192333 ATGGAAATGCAGGAAGAGCCTGG - Intronic
1110224733 13:73107768-73107790 GTGCAGCTCCCGAAAGAGCTGGG + Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1111914987 13:94351397-94351419 ATGCTGATTCTGAAAGAGACTGG + Intronic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG + Intronic
1116998181 14:51346203-51346225 ATGCACTTGCAGAAACAGCCAGG - Intergenic
1117753472 14:58947988-58948010 ATGCATATGTCTTAAGAGCCAGG - Intergenic
1121923143 14:97902100-97902122 CTACAGATGTGGAAAGAGCCTGG + Intergenic
1124267397 15:28249329-28249351 AAGCAGGTGCCCAAAGAGCACGG + Intronic
1124406849 15:29400795-29400817 ATGCAGATGCAGAGAGGCCCTGG - Intronic
1125555515 15:40581527-40581549 CTGCAGATGCCTAAAAAGCAGGG + Intergenic
1126428858 15:48559339-48559361 CTGCTGATGCTGAAAGTGCCTGG - Intronic
1130866385 15:87936484-87936506 ATGAAGATGCTGAATGACCCAGG - Intronic
1132828164 16:1915078-1915100 TCGCAGATGCCAAAAGGGCCTGG + Intronic
1134824085 16:17270480-17270502 ATGCTGATAGGGAAAGAGCCAGG - Intronic
1135143286 16:19939951-19939973 ATGCAGAGGAGGGAAGAGCCAGG + Intergenic
1137484535 16:48880679-48880701 AGGCAGAGGCCTAGAGAGCCAGG + Intergenic
1137868388 16:51925586-51925608 ATGTAGATGCCTATAGAGCTTGG - Intergenic
1138143275 16:54586557-54586579 ATGATGATGGGGAAAGAGCCAGG + Intergenic
1142535465 17:614668-614690 ATGCAGGTGCCGGAAGACCAGGG + Intronic
1149590183 17:57823275-57823297 ATTCAGATGGCGAAAGGGCCTGG + Intergenic
1149953339 17:61016222-61016244 TTTCAAATCCCGAAAGAGCCAGG - Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1152384764 17:79965692-79965714 AGGCATATGCCAAAAGAGTCAGG - Intronic
1156202467 18:34849880-34849902 ATGCAAATGCTGAAAGGGGCAGG - Intronic
1160406027 18:78646912-78646934 ATGCAGATGTGGAAAGAGTGTGG - Intergenic
1164549429 19:29196571-29196593 ATGCATATGCAGAAAGAGATTGG - Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1167143402 19:47667622-47667644 AAGCAGATGTCGCAAGACCCTGG - Intronic
926490587 2:13521987-13522009 ATGCAGATGCATAAAGTGTCAGG + Intergenic
927658485 2:24971870-24971892 ATGCCGAAGCGGAAGGAGCCCGG - Exonic
931134772 2:59385738-59385760 ATGCAGATGCCAAGAGAACATGG - Intergenic
931950135 2:67353181-67353203 ATGCAAAAGTCGTAAGAGCCAGG - Intergenic
935786738 2:106555800-106555822 ATGCAGATGCCCTGAGAGCTCGG + Intergenic
935972866 2:108547457-108547479 ACACAGATGCAGAAAGAGACAGG + Intronic
940064426 2:149611246-149611268 AGCCAGAGGGCGAAAGAGCCTGG + Intergenic
942857259 2:180564074-180564096 ATCCAGAGGCTGAAAGAACCTGG + Intergenic
947929528 2:233952354-233952376 AGGCAGGTGCCGAGGGAGCCTGG + Intronic
1174867188 20:54149029-54149051 ATACAGATGGCGTAAGAGCAGGG + Intergenic
1176178177 20:63738292-63738314 CTGCAGCTGCCGGCAGAGCCCGG - Exonic
1177734679 21:25073741-25073763 ATGCAGAAGCTGGAAGAGCTTGG - Intergenic
1180726391 22:17949753-17949775 AAGCAGAGGACGAAACAGCCAGG + Intronic
1183684168 22:39351816-39351838 AGGCAGAGGCCGCAAGAGCCAGG + Intronic
1184327696 22:43802719-43802741 ATGGAGATGCCAAAACAGACCGG + Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
954335321 3:49913046-49913068 AGCCAGATGCAGAATGAGCCTGG + Intronic
955001373 3:54930680-54930702 ATGCTGATGCTCAGAGAGCCTGG - Intronic
955567265 3:60260776-60260798 ATGCAGATGCGTAAAGAAGCTGG + Intronic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
958877973 3:99637763-99637785 AAGCAGATGCTGGAAGACCCAGG + Intergenic
960402454 3:117218303-117218325 AATCAGATGCCCAAAGAGACAGG + Intergenic
961608278 3:128114668-128114690 GTGCAGATGCCTAATGAGGCAGG - Intronic
962709875 3:138077354-138077376 GTGCAGATGCCAGAGGAGCCCGG + Intronic
967830327 3:193913038-193913060 AAGCAGAAGCTGAAAGATCCAGG - Intergenic
970069254 4:12138076-12138098 AAGCAGAAGCCCACAGAGCCTGG + Intergenic
970678569 4:18481019-18481041 AAGCAGAGGTAGAAAGAGCCAGG + Intergenic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
978154692 4:105475098-105475120 TTGGAGATGCTGAAAGAACCTGG - Intergenic
978430358 4:108626813-108626835 ATGCAGAAGCTGAAAGTACCTGG + Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
985762547 5:1757726-1757748 ATGCAGATGCCACAGCAGCCAGG + Intergenic
993781049 5:92065764-92065786 AGGCAGATGTTGAAAGAGCTTGG + Intergenic
997741257 5:136256947-136256969 GTCCAGATGCTGAAAAAGCCTGG + Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1001077284 5:168639432-168639454 ATGCAGAGGCCCAAAGGGACAGG + Intergenic
1001486735 5:172125176-172125198 ATGCAGATGCCGAAAGAGCCAGG - Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003138586 6:3453440-3453462 ATGCAGAAGGCGAGAGAGGCTGG + Intronic
1006985633 6:38173759-38173781 ATGCTGATGGCGACAGAGGCCGG + Exonic
1007594751 6:43044634-43044656 ATGCAGGTGCCAAAAGGGCCAGG + Intronic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1013919600 6:115387440-115387462 ATGCAAAAGCTGAAAGAGCCTGG + Intergenic
1016954007 6:149608833-149608855 AGGCAGGTGCCGACAGAGGCTGG + Intronic
1018991134 6:168675227-168675249 AGCCAGATGCTGAAATAGCCAGG - Intergenic
1019499279 7:1356238-1356260 CTGCAGATCCCGGAGGAGCCTGG - Intergenic
1022013510 7:26329263-26329285 AAGCCAAGGCCGAAAGAGCCTGG - Intronic
1028290660 7:89060900-89060922 ATGCAGTTGCCAATAAAGCCAGG - Intronic
1029232170 7:99079246-99079268 TTGCAGATGGAGAACGAGCCTGG - Intronic
1031300794 7:120059304-120059326 ATGCCGATGCAGAAAGGGCCAGG - Intergenic
1032863022 7:135899394-135899416 ATGGAGAGGCCTAAACAGCCAGG + Intergenic
1036409790 8:8488886-8488908 ATGCAAATGCCAAAAAAGACTGG + Intergenic
1037499870 8:19475226-19475248 ATGCAGAAGCCGAGAAAGTCTGG + Intronic
1040580907 8:48697774-48697796 ATGCAGAAGCCAAAGGTGCCTGG + Intergenic
1042996957 8:74711213-74711235 GTGCAGATGCACAGAGAGCCAGG - Intronic
1045873543 8:106952429-106952451 ATGCAGAAGAGAAAAGAGCCTGG + Intergenic
1047218125 8:122895687-122895709 CTGCAGATGTCTAAAGAGCAAGG - Intronic
1050561899 9:6842846-6842868 ACTCAGGTGCCCAAAGAGCCAGG - Intronic
1053326232 9:37154182-37154204 ATCAAGATCCCCAAAGAGCCAGG - Intronic
1057247219 9:93466849-93466871 AAGCAAATGCCGTATGAGCCAGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1187568455 X:20476145-20476167 AGGCAGATGCCCCAGGAGCCCGG + Intergenic
1190267465 X:48835731-48835753 ATGGAGATGCCCAAAGGGCAAGG + Intergenic