ID: 1001491643

View in Genome Browser
Species Human (GRCh38)
Location 5:172160175-172160197
Sequence CTGGCTAGGGGCCATTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001491643_1001491651 13 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491651 5:172160211-172160233 TGCCTGTAATCCCAGCATTTTGG 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
1001491643_1001491652 14 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491652 5:172160212-172160234 GCCTGTAATCCCAGCATTTTGGG 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
1001491643_1001491659 30 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491659 5:172160228-172160250 TTTTGGGAGGCCAAGGTAGGTGG 0: 122
1: 4762
2: 59718
3: 140337
4: 199252
1001491643_1001491656 23 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491656 5:172160221-172160243 CCCAGCATTTTGGGAGGCCAAGG 0: 4293
1: 91194
2: 212713
3: 235265
4: 160325
1001491643_1001491658 27 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491658 5:172160225-172160247 GCATTTTGGGAGGCCAAGGTAGG 0: 1686
1: 36543
2: 141068
3: 238931
4: 216642
1001491643_1001491654 17 Left 1001491643 5:172160175-172160197 CCTACAAAATGGCCCCTAGCCAG 0: 1
1: 0
2: 3
3: 10
4: 109
Right 1001491654 5:172160215-172160237 TGTAATCCCAGCATTTTGGGAGG 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001491643 Original CRISPR CTGGCTAGGGGCCATTTTGT AGG (reversed) Intronic
900667002 1:3822369-3822391 CTGGGTTGGAGCCATTTTGCTGG + Intronic
901142015 1:7041133-7041155 CTGGCTTGGGGCCAACTTTTAGG - Intronic
901364388 1:8733388-8733410 CTCACTGGGGGCCATTTTGTGGG - Intronic
903824339 1:26132145-26132167 ATGTCTAGGTGTCATTTTGTGGG - Intergenic
912318917 1:108692410-108692432 TTGGCCCGGGGTCATTTTGTCGG + Exonic
919872211 1:201830503-201830525 CAGGCTAAGGACCATTTTGAAGG + Intronic
921065057 1:211616814-211616836 CTGGCCGGCGGCCATCTTGTGGG + Intergenic
922954167 1:229585329-229585351 ATGGCTAGTGGCTATTTTGCTGG + Intergenic
924201488 1:241663668-241663690 GTGGCTAGTGGCCACTTTGTCGG - Intronic
1067350857 10:45474383-45474405 CTGTCAAGGGGCCATTGTCTCGG - Intronic
1067744672 10:48926622-48926644 CTGTCCAGGGGCCAATATGTAGG + Intronic
1068509437 10:57945519-57945541 CTGGCTGGTGGCCTTTTTGGTGG - Intergenic
1069823868 10:71243515-71243537 ATGGCTAGTGGCCACTGTGTTGG + Intronic
1069888631 10:71639265-71639287 CTGCAGAGGGGCGATTTTGTTGG - Intronic
1075055466 10:119215243-119215265 GTGGCTAGTGGCCATTGTATTGG + Intronic
1077265716 11:1648503-1648525 CTGGCTGGGGGACAGTTTGGGGG + Intergenic
1077893909 11:6439804-6439826 CTAGCCAGGTGCCATTGTGTTGG + Intronic
1078127828 11:8585610-8585632 CTGCCTGAGGTCCATTTTGTTGG - Intronic
1078571472 11:12461707-12461729 GTGCCTAGGGGCCATTTGCTTGG + Intronic
1079081965 11:17419976-17419998 CTGGTTAGGGGGCAGGTTGTAGG + Intronic
1083925097 11:65801248-65801270 CTGGCTGGGGGTCATTTGCTGGG + Intergenic
1085455259 11:76661859-76661881 CTGGCTTGGGGTCACTCTGTGGG - Intronic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1091181465 11:133608176-133608198 CTAGGTGGGGGCCATTTTGGTGG - Intergenic
1098842654 12:75495075-75495097 CTGGATAGGAGCCATTTGGCTGG - Exonic
1101415048 12:104501569-104501591 TCGGCTTGGGGCCATTTTGCAGG - Intronic
1103741707 12:123095732-123095754 CTGCCTCGGGGCCATTGTGAAGG + Intronic
1110826075 13:79973904-79973926 CTGCCTGGGGCCCATTTTGGTGG - Intergenic
1112851507 13:103711873-103711895 CGGGCTAGTGGACAGTTTGTAGG + Intergenic
1113280918 13:108786475-108786497 CTGGCCAAGGGTCATTTTGAAGG - Intronic
1115286597 14:31720781-31720803 GTGGCTAGTGGCTATTGTGTTGG + Intronic
1121292891 14:92792013-92792035 AAGACTAGGGGCCATGTTGTAGG - Intergenic
1124915240 15:33963867-33963889 CTGGCAAGGAGCCATTCTCTGGG - Intronic
1125117522 15:36112713-36112735 GTGGCTAGTGGCTATTGTGTTGG - Intergenic
1127810541 15:62561461-62561483 CTGCCTTGGGGCCATTTTACAGG + Exonic
1127930423 15:63592960-63592982 GTGGCTAGGGGCCATTGTACTGG - Intronic
1128494343 15:68184817-68184839 CTTGCTTGGGGCCATATTGCAGG + Intronic
1130003370 15:80067668-80067690 GTGGCTAGTGGCGATTGTGTTGG + Intronic
1130390347 15:83448694-83448716 CTTTCTATGGGCCAATTTGTGGG - Intronic
1131354478 15:91732746-91732768 CTGGCCAGGGGCCATTTTGAGGG - Intergenic
1133028414 16:2998501-2998523 CTGGCCAGGGCCCATTTTCATGG - Intergenic
1135528467 16:23232167-23232189 CTGGGAAGGGCCCATTTGGTTGG - Intergenic
1137060227 16:35786847-35786869 CTGGCTACAGGCCAGGTTGTGGG - Intergenic
1139750663 16:69107231-69107253 CTGGCTGAGGGACATTTTGGGGG + Intronic
1141070783 16:80952733-80952755 GTGGCTAGTGGCCATTATGTTGG - Intergenic
1145980883 17:29010810-29010832 CGGGCGAGGGGCCATTTTAATGG + Intronic
1148407387 17:47428904-47428926 ATGGTGAGGGGACATTTTGTTGG + Intronic
1148604068 17:48915621-48915643 CTGGTTAGAGGCCATGTGGTGGG - Intronic
1149734611 17:58980853-58980875 CAGGCTAGTGCCTATTTTGTGGG - Exonic
1150604012 17:66675804-66675826 ATCGCTAGGGGCTATTATGTGGG - Intronic
1150664827 17:67123724-67123746 CTGAAAAGGGGCAATTTTGTAGG - Intronic
1152281541 17:79387645-79387667 CTGCCTATGTGCCATGTTGTTGG + Intronic
1152991841 18:370754-370776 CTGGCTAGGCACCATTTAGAAGG - Intronic
1155399865 18:25426441-25426463 CAGGATAGGGGCCACTTTGCAGG - Intergenic
1156675028 18:39517382-39517404 CTACCTAGGGACCATTTTGTAGG - Intergenic
1158625498 18:59067915-59067937 GTGGCTAGGGGCTATTGTCTGGG + Intergenic
925413276 2:3652321-3652343 AGAGCTCGGGGCCATTTTGTGGG + Intergenic
930982012 2:57537680-57537702 CAGGCTAGGAGGCATTTTGTAGG + Intergenic
931321984 2:61180691-61180713 CTGGCTTGAGGGCATTGTGTGGG - Intronic
932822741 2:74915347-74915369 CTCGCTTGGAGCCATTTTCTTGG + Intergenic
936523704 2:113228624-113228646 CTGGCTAAGAACCATTGTGTTGG + Intronic
940243019 2:151583688-151583710 CTGACTTGGGGTCATCTTGTAGG + Exonic
940243974 2:151594240-151594262 CTGACTTGGGGTCATCTTGTAGG + Exonic
940244934 2:151604793-151604815 CTGACTTGGGGTCATCTTGTAGG + Exonic
941687806 2:168465301-168465323 CTGGTTAGGGCCCACTTTCTGGG + Intronic
942533505 2:176938160-176938182 CTGGGTAAGAGCCATTTTGATGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947647576 2:231755043-231755065 CTCTCTAGGGTCCCTTTTGTAGG - Intronic
1169191253 20:3660438-3660460 CTGGCTGGGAGCCATTTTAGAGG - Intronic
1170563397 20:17578016-17578038 GTGGCTAGTGGCCACTTTATTGG + Intronic
1171445351 20:25198932-25198954 CTGGGAAGGGGCCATTTGGCAGG - Intronic
1175738426 20:61403494-61403516 CTGGAGAGTGGCCACTTTGTGGG + Intronic
1178629533 21:34247311-34247333 ATCACTAGGGGCCATTTTGGAGG - Intergenic
1181023367 22:20114670-20114692 CTGGCTAGGAGTCTTTCTGTGGG + Exonic
949324077 3:2843979-2844001 ATGGCCAGGGGCCAGTTTATGGG - Intronic
950123704 3:10498595-10498617 CTGCCCCGGGACCATTTTGTGGG - Intronic
950134307 3:10569970-10569992 CTAGCCTGGGGCCATTTTGATGG + Intronic
952280736 3:31920734-31920756 ATGGCTTGGGACCATTTTCTTGG + Intronic
953485572 3:43291410-43291432 GTGTTTAGGGGCCAGTTTGTTGG + Intronic
954211236 3:49098646-49098668 CTGGCTTGGGGCCAGCCTGTGGG - Exonic
956260662 3:67336746-67336768 CTGGCTAGGATCCATTGTGAAGG - Intergenic
957049202 3:75398357-75398379 CAGGCGTGGGGCCATTTTATAGG - Intergenic
957452662 3:80400066-80400088 CTGTTAAGGGGCCATATTGTAGG - Intergenic
962848457 3:139290275-139290297 CTGGATAGGGGCCATTTGCAGGG - Intronic
963531190 3:146475322-146475344 TTTTGTAGGGGCCATTTTGTGGG + Intronic
963704298 3:148666458-148666480 CTTGCCAGGTGCCATTTTGTAGG - Intergenic
970542554 4:17094455-17094477 CTGGCCAGTGGTTATTTTGTGGG - Intergenic
974138447 4:57850548-57850570 ATGGCTTGGTGCCATTTTGGTGG + Intergenic
985249995 4:188014125-188014147 CTGGCAAGGGGCAGTTTTGCAGG + Intergenic
988891655 5:35624104-35624126 CTGGCTAAGGGCCATTTTGATGG + Intronic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992074375 5:73177198-73177220 CTGGAGAGGGGCCATGTGGTGGG + Intergenic
992251803 5:74883334-74883356 GTGGCAAGGGGCGATATTGTGGG + Intergenic
994074506 5:95635434-95635456 CTGGCAAGGGGCCATCTTCCAGG + Intergenic
997075661 5:130672960-130672982 CTGGCTGCTAGCCATTTTGTGGG - Intergenic
1001491643 5:172160175-172160197 CTGGCTAGGGGCCATTTTGTAGG - Intronic
1003001186 6:2335214-2335236 CTGGCTTGGGGAGATTTTTTTGG + Intergenic
1003278798 6:4674695-4674717 CTGGCTTGGGATCACTTTGTGGG - Intergenic
1003989640 6:11473004-11473026 TTGGCTAGGGGCTATTTTCTAGG + Intergenic
1005997681 6:30941226-30941248 CTGGCTAAGGGACATGTAGTAGG + Intronic
1006597424 6:35203635-35203657 CTGGAAGGGGGCCTTTTTGTAGG - Intergenic
1007753974 6:44086973-44086995 CTGGCCAGGGGCCGCATTGTAGG + Intergenic
1012907115 6:105080159-105080181 CTGGCTAGGGGCCATAGTATTGG + Exonic
1017137298 6:151159432-151159454 CTGGCTGGGGTACATTTTCTTGG - Intergenic
1017152117 6:151290211-151290233 CTTGATTGGGGCCATTTTGGAGG + Intronic
1019001809 6:168759952-168759974 CTGGCTTTGGGCTTTTTTGTTGG - Intergenic
1020213342 7:6171167-6171189 CTGGCAAGGGGCCAGGCTGTGGG + Intronic
1030329796 7:108259056-108259078 CTGGCTAGTGGCTACTGTGTTGG + Intronic
1031422775 7:121569381-121569403 ATGGGGTGGGGCCATTTTGTAGG + Intergenic
1034063731 7:148117238-148117260 CTGGCTGAGAGCCATTTGGTGGG + Intronic
1035970301 8:4240362-4240384 CTGGCTATGCCCCATTTTGCAGG + Intronic
1042985076 8:74574372-74574394 CTGCCTAGGGTTGATTTTGTTGG + Intergenic
1047977909 8:130149794-130149816 CTGGCTAGAGACCTTTCTGTGGG + Intronic
1049999586 9:1062772-1062794 ATGGGTAGGGTCCAATTTGTAGG + Intergenic
1058095444 9:100855001-100855023 ATGGTGAGGGGGCATTTTGTTGG + Intergenic
1059705719 9:116821505-116821527 CTGGCTAGGAGCCCTTTTCATGG - Intronic
1060880394 9:127113898-127113920 CAAGCAAGGGGCCACTTTGTGGG + Intronic
1186499661 X:10041157-10041179 CTGGCCAGGGGCCATTTCGATGG - Intronic
1186934261 X:14430105-14430127 GTGGCTAGTGGCCATTGTATTGG + Intergenic
1187086860 X:16050127-16050149 ATGGGTTGGGGCCATTTTATAGG + Intergenic
1187177890 X:16913313-16913335 CTGGTTTGGGGACATTTGGTTGG + Intergenic
1187939548 X:24368702-24368724 ATGGCTAGTGGCTATTGTGTGGG + Intergenic
1196130992 X:112156023-112156045 GTGGCTATTGGCCATTGTGTTGG + Intergenic