ID: 1001492469

View in Genome Browser
Species Human (GRCh38)
Location 5:172165287-172165309
Sequence CCTCATCTGCAGAGTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001492469_1001492476 12 Left 1001492469 5:172165287-172165309 CCAACCCAACTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1001492476 5:172165322-172165344 CCAAGGCGAATGCAGAGACCAGG 0: 1
1: 0
2: 0
3: 16
4: 157
1001492469_1001492473 -5 Left 1001492469 5:172165287-172165309 CCAACCCAACTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1001492473 5:172165305-172165327 TGAGGAAGCTGAGTCCACCAAGG 0: 1
1: 1
2: 3
3: 31
4: 344
1001492469_1001492477 13 Left 1001492469 5:172165287-172165309 CCAACCCAACTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1001492477 5:172165323-172165345 CAAGGCGAATGCAGAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001492469 Original CRISPR CCTCATCTGCAGAGTTGGGT TGG (reversed) Intronic
900796171 1:4709554-4709576 CATGACCTGCAGAGCTGGGTGGG - Intronic
901039883 1:6357497-6357519 CCTCAGCTGGAAAGCTGGGTGGG + Intronic
901061550 1:6474141-6474163 CCTCATCTCCAGGCTTGGCTGGG + Exonic
902871099 1:19314042-19314064 CCTCACCTGCAGGGATGGGAAGG - Intronic
903851214 1:26307209-26307231 CCTCATCTGTAAAATTGTGTTGG + Intronic
904052585 1:27648682-27648704 CCTCCTCTGAATAGTGGGGTTGG - Intergenic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905852368 1:41283558-41283580 CCTTATCTGTAAAGTGGGGTGGG + Intergenic
907416505 1:54318094-54318116 CCTCATCTCCAGGCTTGGGGTGG + Intronic
908508940 1:64835395-64835417 CCTCATCTGGACAGTTAGGTGGG + Exonic
909378957 1:74974981-74975003 ACTCATCTCCAGATTTGGGATGG - Intergenic
912551540 1:110488391-110488413 CCTCATCTGAAGCGTGGGGTAGG + Intergenic
912693636 1:111823415-111823437 CCTGATCTGCAGAGCTGTGATGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915252371 1:154599848-154599870 CCTCCTCTGCACAGATGGGTAGG - Intronic
915627453 1:157124100-157124122 TCTCAGCTGCATAGTTGGGACGG - Exonic
917245733 1:172998300-172998322 CCTCATTTCCAGTCTTGGGTGGG + Intergenic
917693505 1:177493467-177493489 AATCATCTGTAGAGTTGGGGTGG - Intergenic
919856544 1:201709974-201709996 CCACATCAGCAGAGTGTGGTGGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
921312834 1:213861600-213861622 GCACATCTGCAGAGGTGGCTTGG - Intergenic
924017494 1:239743547-239743569 ACTCATCTGGAAGGTTGGGTGGG - Intronic
924615066 1:245605821-245605843 CCTGCTGTGCAGAGTTGGGGCGG - Intronic
1064963875 10:20995774-20995796 CAGCATCTGCAGAGGTGGCTCGG - Intronic
1067255510 10:44635035-44635057 CCTCATCTTTACAGTTGAGTAGG + Intergenic
1070628543 10:78068145-78068167 CCTCAGCTCCAGAGATGGGAGGG - Intergenic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1072916681 10:99541032-99541054 TCTCACCTGCAGAGTCGGCTAGG - Intergenic
1073272842 10:102280824-102280846 TATCATCGGCAGATTTGGGTTGG + Intronic
1075673215 10:124278280-124278302 CCTCTGCTGGAGAGGTGGGTGGG + Intergenic
1075740041 10:124689704-124689726 CCTTACCAGCAGAGTTGGGGTGG + Intronic
1076674532 10:132141259-132141281 CCTCAGGTGCAGGGTTGGGCAGG + Intronic
1078469631 11:11576659-11576681 CCCAAGCTTCAGAGTTGGGTGGG - Intronic
1078898328 11:15617947-15617969 CCTCATATACTAAGTTGGGTAGG + Intergenic
1079478571 11:20857611-20857633 CTTCACCGGCAGAGTTGGATGGG + Intronic
1079579394 11:22044220-22044242 CCTCATAAAAAGAGTTGGGTTGG + Intergenic
1081635229 11:44716856-44716878 CCTCATCTGCAAAGTTGGTTGGG + Intergenic
1081994223 11:47353123-47353145 CCTCATCTGTAAAGCGGGGTGGG + Intergenic
1083769314 11:64857553-64857575 CCTCATCTACAGGGTGAGGTGGG + Intronic
1083882312 11:65554649-65554671 CCTCATCTGTAGAGATGTGTGGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084358298 11:68653584-68653606 CCTGGCCTGCAGAGCTGGGTAGG - Intergenic
1084956594 11:72694889-72694911 CCTCATGTGCAGGGTAGGGGAGG + Intronic
1085462133 11:76700554-76700576 CCACATCTGGAGGGTTGTGTGGG + Intergenic
1088045964 11:105451907-105451929 GCTCAACTGCAGATTTGAGTGGG - Intergenic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1093271560 12:17068615-17068637 CTTCATCTGCAGGATTGGCTTGG - Intergenic
1093652170 12:21657982-21658004 CCTCATCTGGAGGGTGGGGGAGG - Intronic
1096673374 12:53213487-53213509 CCTCATCTGCGGAGGTGCGGGGG - Exonic
1099219167 12:79891889-79891911 TCTCATCTGAAGGCTTGGGTAGG - Intronic
1100584416 12:95966544-95966566 CCTCATCTGCATACTTCAGTGGG - Intronic
1102728377 12:115086450-115086472 CCTTCTCTGTAGACTTGGGTGGG + Intergenic
1102728551 12:115087909-115087931 CCTTCTCTGTAGACTTGGGTGGG - Intergenic
1102741784 12:115213879-115213901 CCACATCTGCAGACTTGTGAGGG - Intergenic
1103801955 12:123543847-123543869 CTTTCACTGCAGAGTTGGGTAGG - Intergenic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1113512611 13:110868061-110868083 CCACCTCTGCAGACTTTGGTAGG - Intergenic
1116116705 14:40661666-40661688 TCCAATCTGCAGTGTTGGGTGGG - Intergenic
1117971329 14:61253771-61253793 CCTCCTCTGCAAAATTGGATTGG + Intronic
1118363742 14:65076886-65076908 CCTTCTCTTCAGAGTTGGGTGGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1121812461 14:96903217-96903239 CCATATTTGCAGAGTTGGGGTGG + Intronic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123774567 15:23565972-23565994 CCTCCTCTGCGGAGGTGGGCAGG - Exonic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128897681 15:71390691-71390713 CCTGATCTACAGAGTAGAGTTGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132833307 16:1940366-1940388 CCTCCTCTGCAGAGTGGCGGTGG - Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134410654 16:14000854-14000876 CCTCAGTGGCAGAGCTGGGTTGG - Intergenic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1138555459 16:57768587-57768609 CCACATTGGAAGAGTTGGGTGGG + Intronic
1139464258 16:67145758-67145780 CCTAATGTGCAGAGTGGGGCAGG - Intronic
1139662408 16:68430048-68430070 CCAAATCTGCAGAGTGGGGTTGG + Intronic
1141735557 16:85850050-85850072 CCTCATCTGCAGAACAGAGTCGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1142051447 16:87960628-87960650 GCTCATCTGCTGAGTTGGCCGGG - Intronic
1142117479 16:88367310-88367332 CCTCATCTGTAAAGTGGGCTTGG - Intergenic
1142592591 17:1012874-1012896 CCTCATTTGCAGTCTTGGGGAGG - Intronic
1143726491 17:8850442-8850464 CCCCATCTGCAGAACTGGGGAGG - Intronic
1144777468 17:17791979-17792001 CCTCACCTGCTGAGGTGGGGAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1146315603 17:31804666-31804688 GCTCATCTGAAGGTTTGGGTGGG + Intergenic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1147021349 17:37536406-37536428 CCTCATCTGTGAAGTTGGGATGG + Intronic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1147590859 17:41682588-41682610 ACTCAACTGCCGAGGTGGGTGGG - Intergenic
1150605989 17:66691523-66691545 CCTCAGCTGCAGGGTAGGGGTGG - Intronic
1152149338 17:78589227-78589249 CCCCATCTGCAGGGTGGTGTTGG - Intergenic
1152510798 17:80786108-80786130 CCGCTTCTGCACAGTGGGGTGGG + Intronic
1152613141 17:81325441-81325463 CCACCTCTGCACAGTCGGGTGGG - Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1152925010 17:83083177-83083199 CCTCCTGGGCAGAGGTGGGTTGG + Intronic
1153204263 18:2679959-2679981 ACTCATGAGCAGATTTGGGTTGG - Intronic
1153711573 18:7805144-7805166 AGTCATCTGCAGAGATGTGTTGG - Intronic
1155423212 18:25678374-25678396 CCTCATCTGGAGTGGTGGGCGGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157728383 18:49983054-49983076 CCTAGTCTCCAGAGTTGGGCAGG - Intronic
1160291789 18:77601177-77601199 CCTCACCTGCCGGGCTGGGTGGG + Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1163522445 19:17799570-17799592 CCTCCTCTGCAAAGCTGGGATGG - Intronic
1163768042 19:19174241-19174263 CCCCATCTGCAGATCAGGGTTGG + Intronic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165293384 19:34906675-34906697 CCTCATCTGCAGATTTTTTTGGG + Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
924985412 2:265039-265061 CGTCCTCTGGAGAGTTGGATCGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
927862113 2:26566557-26566579 CCTTAATTGCAGAGTTGGGGAGG + Intronic
928399109 2:30965307-30965329 CCTCAGCTGCAGAGGTGAGGAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932305866 2:70703998-70704020 CCTCATCTGTGGAGTCAGGTTGG + Intronic
932798194 2:74715744-74715766 CCTCGCCTGCAGACCTGGGTCGG - Intergenic
933820528 2:86107016-86107038 CCTCATCTGCAGACTAGAGTTGG + Intronic
933840277 2:86280969-86280991 CCTCATCTGAACAGTGGGGTGGG - Intronic
934682312 2:96293368-96293390 CTACATCTTCATAGTTGGGTAGG + Exonic
934771482 2:96910341-96910363 CCTCCTCTGCACAGTGAGGTTGG + Intronic
937275572 2:120681855-120681877 CCTGAGCTGTAGAGTGGGGTTGG - Intergenic
937931250 2:127206754-127206776 CTTGCTCTGCAGAGTTGGCTTGG - Intronic
938750977 2:134329791-134329813 CCTTATCTGAAGAGCTGTGTAGG - Intronic
945484010 2:210372990-210373012 ACTCATCTGCAGACTTGACTGGG + Intergenic
947717621 2:232349824-232349846 CCACACCTGCAGAGTCGGGTCGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
1169049799 20:2566121-2566143 CCACATCTGGAGACTTTGGTTGG + Intronic
1169896137 20:10507268-10507290 CGTCATGTGTAGAGTTAGGTGGG + Intronic
1172787093 20:37475591-37475613 CCAGAGCTGCAGAGTTGGGGTGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175161087 20:57008470-57008492 AGTCAGCTGCAGAGGTGGGTGGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1175969647 20:62677960-62677982 CCACACCTGCAGATTTGGGAAGG + Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180708204 22:17822541-17822563 CCTCAGCTGTGGAGTTGGGGTGG - Intronic
1181312575 22:21953053-21953075 TCTCTTCTGCAGCTTTGGGTGGG + Intergenic
1181833924 22:25586605-25586627 TCACCTCTGCAGAGTTGGGGAGG + Intronic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182347228 22:29674754-29674776 CCTCCTCTGCAGGGGTGGGGTGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184310434 22:43637731-43637753 GCTCCTCTGCAGAGCTGGGCCGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1185203091 22:49520542-49520564 CCTCATCTGGAGGCTTGGCTGGG + Intronic
949904185 3:8844691-8844713 CCTTATCTGCAGGGTTGCGTGGG - Intronic
950442658 3:13019070-13019092 CCTCGCCTGTAGAGTTGGGGGGG - Intronic
950502913 3:13375888-13375910 CCCCATCTGTAAAGTTGGGGGGG - Intronic
950877368 3:16288427-16288449 CCTCATTCTCAGAGTTTGGTAGG - Intronic
951650160 3:24942407-24942429 CCTCATCTGAAGAGGTGGCTTGG + Intergenic
952767521 3:36967671-36967693 GCACACCTTCAGAGTTGGGTGGG + Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954989005 3:54822541-54822563 CCTCAAGTGCAAAGTTGGATAGG - Intronic
955917858 3:63924699-63924721 CTTAATCTGGAGAGTTGGGGAGG + Intronic
956523029 3:70126517-70126539 CCTCACCAGAAGAGTTCGGTCGG + Intergenic
956852008 3:73237452-73237474 CCTTCTCTGCTCAGTTGGGTTGG + Intergenic
960009630 3:112819494-112819516 CCACATCTTCAGAATTTGGTGGG - Intronic
962208424 3:133455340-133455362 TCTCATCTTCAGAGTTTGTTCGG + Intronic
963487474 3:145953454-145953476 CGTCATCTGCAGAGAGGGTTGGG - Intergenic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
968124455 3:196148320-196148342 ACTCAACTGGAGATTTGGGTGGG - Intergenic
968586462 4:1418998-1419020 CCACATCTGCCGTGTTGGGGAGG - Intergenic
968629990 4:1645359-1645381 TCTCTTCTGCAGGGTTGGGAGGG - Intronic
969192160 4:5531067-5531089 GCTCCTCTGCAAAGTTGGGAGGG - Intergenic
969476285 4:7424256-7424278 CCTCGTCTGAAGGGTAGGGTGGG + Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
971454281 4:26829509-26829531 ACTCATCTTCAGTCTTGGGTAGG + Intergenic
973857944 4:55032415-55032437 CCTCACCGGCAGAGCTGGGATGG + Intergenic
975189993 4:71449365-71449387 CTTTATCTGCACAGTTGGCTGGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976380111 4:84389448-84389470 TCTCAGCTGGAGAGTTGGGCAGG - Intergenic
980628401 4:135405583-135405605 CCTGATCTTAAGAGTTGGGATGG + Intergenic
985745571 5:1644971-1644993 CCTCTGCTGCAGAGTTTGCTGGG + Intergenic
985851259 5:2390603-2390625 GCTCAACTGCACAGTTAGGTCGG + Intergenic
989497617 5:42127085-42127107 CCTCATCTGCAAAGTAGAGGTGG - Intergenic
992612142 5:78517020-78517042 CCTCTCCTCCAGAGTTGGGCTGG + Intronic
992838671 5:80666169-80666191 CCTCATCTGCAGGCTAAGGTGGG - Intronic
994472824 5:100230998-100231020 TCTCATATCCAAAGTTGGGTTGG - Intergenic
995584670 5:113636001-113636023 TTTCATCTTCAGGGTTGGGTTGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997655110 5:135548695-135548717 CCTCAGCTGTGGAGGTGGGTAGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998516605 5:142761076-142761098 CCTCAACAGCAGAGTTGAGTAGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999277958 5:150344558-150344580 CATCATCGGCAGAGCTGGGCTGG - Intergenic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1000703093 5:164477467-164477489 CCTCATCTTCAACGTTGAGTAGG + Intergenic
1000925652 5:167190741-167190763 TCTCATCTGCAGTGTTGAGGGGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001387367 5:171351027-171351049 GCTAATATGCAGAGTTGGGGAGG - Intergenic
1001474970 5:172044133-172044155 CCTCTTCTGCCCAGGTGGGTTGG - Exonic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001626392 5:173138940-173138962 CCTCTTTTGCATAGTTGCGTAGG + Exonic
1004651939 6:17618450-17618472 CATCCACTGGAGAGTTGGGTGGG + Intronic
1005831093 6:29671710-29671732 CCCCATCTCCAGGTTTGGGTTGG - Exonic
1006668756 6:35716685-35716707 CCAGATCTCAAGAGTTGGGTAGG - Intronic
1006694465 6:35920186-35920208 CCTCCTCTGTGGAGTTGGGGAGG + Intronic
1007731494 6:43950349-43950371 CGTCTTCTCCAGAGCTGGGTTGG - Intergenic
1010046875 6:71454902-71454924 GCTCATCTTCAGAGTTGTCTTGG + Intergenic
1010167297 6:72931749-72931771 CCTCGCATGCAGAGTTGGGAAGG - Intronic
1011242298 6:85285983-85286005 CCTCAACAGCTGAGTTGGGGAGG - Intergenic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1015999568 6:139029213-139029235 CCAGTTCTGCAGAGCTGGGTGGG + Intronic
1017753918 6:157513812-157513834 CCTCATCTTCAGAGTCCGGAAGG - Intronic
1019171067 6:170133459-170133481 TCTCATCTGCCTATTTGGGTAGG + Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1022891950 7:34710215-34710237 CCAAATCTGAAAAGTTGGGTAGG + Intronic
1023339918 7:39209363-39209385 CATCATCTTCAGAAGTGGGTTGG + Intronic
1024142965 7:46480694-46480716 CCTCAGCTGCAGGTTGGGGTTGG + Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1030033505 7:105389061-105389083 CCACTTCTGCACAGGTGGGTGGG - Intronic
1033194828 7:139318946-139318968 TCTCGACTGCAGTGTTGGGTGGG - Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034290884 7:149930745-149930767 GCTCATGTGCTGAGTTTGGTGGG - Intergenic
1034815302 7:154167027-154167049 GCTCATGTGCTGAGTTTGGTGGG + Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1038245279 8:25849287-25849309 CATCATCTCCAGTGTTGGGATGG + Intronic
1040092223 8:43409880-43409902 TGTCTTCTGCAGAGATGGGTAGG + Intergenic
1040387033 8:46920812-46920834 CCTCACCAGCAGGGATGGGTGGG + Intergenic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044524977 8:93241664-93241686 CCTCATCTTCAGTTTGGGGTGGG - Intergenic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1046090685 8:109499900-109499922 CCACATCTGGTGAGGTGGGTAGG + Intronic
1047351951 8:124082592-124082614 CCACATCAGCAGAGCTGGCTTGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049098001 8:140560209-140560231 TCTCACCTGCAGTGTTGGGTGGG - Intronic
1049212348 8:141392473-141392495 CCTCAGCTGCACAGTTTGGGGGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1052438860 9:28466946-28466968 TCTCATCAGCAGAGTTAGTTTGG - Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058141202 9:101358175-101358197 CCACCTCTGCAGATTTGGGTGGG + Intergenic
1058799057 9:108527069-108527091 CCTAGTCTGCAGAATTGAGTAGG + Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060396710 9:123321408-123321430 CCTCCTCTGCAGAGTTCTGAGGG + Intergenic
1060526520 9:124324086-124324108 CCTCACCTGCAGAGCTGGCTCGG + Intronic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1061404052 9:130383911-130383933 CCACAGCTGCAAAGCTGGGTGGG - Intronic
1061501882 9:131008929-131008951 CCTCGTCTGTGGAGTGGGGTCGG - Intergenic
1061809917 9:133156205-133156227 GCTCCTCTGTAGAGTCGGGTGGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062166246 9:135108969-135108991 CCTGCTCTGCATAGTGGGGTGGG - Intronic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1062369735 9:136231790-136231812 CCTCATCTGCCAAGTAGGGGCGG - Intronic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186225993 X:7399709-7399731 TCTCATCTGAAGACTTGGCTGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196031986 X:111101596-111101618 CCTCATCCCCAGAGATGGGCAGG + Intronic
1199114979 X:143981205-143981227 CCTAGTCTGCTGAGTTGGGTGGG + Intergenic