ID: 1001493161

View in Genome Browser
Species Human (GRCh38)
Location 5:172169561-172169583
Sequence GAGTTGGCAGGGGCATGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001493161 Original CRISPR GAGTTGGCAGGGGCATGAAT GGG Intronic
902974862 1:20081295-20081317 GAGGTGGCAGAGGCATGGAGTGG - Intronic
902989098 1:20173643-20173665 GAGTTGGCTGGGGGCTGGATGGG + Intronic
903369398 1:22825555-22825577 AAGTTGGAAGGGGCAGGAAGAGG + Intronic
904283956 1:29442245-29442267 GAGTTTGCAGGGGAAGGGATTGG - Intergenic
904700503 1:32355166-32355188 GGGTTGGCAGGGGCATGGGTTGG - Intronic
905874857 1:41426263-41426285 GAGTTGGGAGGGGCTTGGACAGG + Intergenic
906578830 1:46917555-46917577 GAGGTGGCAGGGGGGTGAAGTGG + Intergenic
907297951 1:53467533-53467555 GGGTTGGCAGGAGCCTGAGTTGG + Intergenic
907366696 1:53966931-53966953 GGGGTGGCACGGGCAGGAATAGG + Intronic
910919236 1:92326358-92326380 GAGATGGCAGGGGGGTGAAATGG + Intronic
913244529 1:116860051-116860073 GAGCTGGGTGGGGCATGAATTGG - Intergenic
913253874 1:116936995-116937017 AATTTGGCAGGAGCAAGAATGGG + Intronic
913463804 1:119117683-119117705 GAGGTGGCAGGGGAGTGAAGTGG - Intronic
916277809 1:163014007-163014029 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
916573957 1:166050883-166050905 GAGCTGGTAGGTGGATGAATTGG + Intergenic
918155031 1:181836332-181836354 GAGATGGCAGGGGAGTGAAATGG - Intergenic
922355590 1:224772228-224772250 GAGTTGGCAGCGGCTTGGATGGG + Intergenic
923174098 1:231446437-231446459 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
924321367 1:242854549-242854571 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
924691538 1:246356082-246356104 GAGGTAGCAGGGGCGTGAAGTGG - Intronic
1062929977 10:1346469-1346491 TTGTTGACAGGGGCATGAACTGG + Intronic
1063005138 10:1963434-1963456 GAGATGTCATGGGCATGAGTGGG - Intergenic
1063523400 10:6761115-6761137 GAGTTGGAAGGGGGATGGAGTGG - Intergenic
1065077614 10:22097385-22097407 GTCTTGGCAGGGGCATGTCTAGG + Intergenic
1067669183 10:48304269-48304291 GAGTGGGCTGGGAAATGAATGGG - Intergenic
1068174789 10:53444388-53444410 GAGTTGGCAGGGGAAGGAGAAGG + Intergenic
1068925010 10:62527140-62527162 GAGTTGGCAGGGGAGTGAAATGG + Intronic
1069289511 10:66760341-66760363 AAGTTGGCAGGAGCATGAGATGG - Intronic
1069959362 10:72070546-72070568 GGGTGGGCAGGGGCAGGAAGGGG - Intronic
1071024140 10:81092630-81092652 GAGGTGACAGGGGGATGAAATGG + Intergenic
1071678956 10:87685085-87685107 GACATGGCAGGTGAATGAATGGG - Intronic
1071910686 10:90229594-90229616 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1072444656 10:95488575-95488597 GAGTTGGCTGGGGCTGGAAATGG - Intronic
1073522998 10:104152381-104152403 GAGTTGGCAGAGGCATGAGGAGG + Intronic
1074237411 10:111599787-111599809 GAGTTGGCAAGAGTAAGAATGGG + Intergenic
1075116279 10:119629827-119629849 GATGTGGCTGGGGCAAGAATGGG - Intergenic
1075196222 10:120361473-120361495 CAGTTGTCAGGGGAATGAGTAGG + Intergenic
1076375921 10:129984626-129984648 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
1078145746 11:8720920-8720942 GATTCAGCAGGGGCATGAATGGG + Intronic
1079132586 11:17756265-17756287 GAGCTGACAGGGGCATCAAGGGG - Intronic
1079945311 11:26733743-26733765 GATTTGGGAGGGGCAAGAAGTGG + Intergenic
1080309415 11:30872110-30872132 GAGCTTGAAGGGGCATGCATGGG - Intronic
1080660954 11:34295551-34295573 GAGCTGGCTAGGGAATGAATGGG + Intronic
1084410854 11:69005241-69005263 GAGGAGGCAGGGGCAGGAAGCGG - Exonic
1086772269 11:90781275-90781297 GATTTGGCAGGTGAAAGAATAGG + Intergenic
1087615976 11:100487003-100487025 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1087623153 11:100565381-100565403 GAGTTACCAGAGGCATGAAGAGG + Intergenic
1088239579 11:107759293-107759315 GAGGTGGCAGGGGGTTGAAATGG - Intergenic
1088951209 11:114571994-114572016 GAGTTAGCAGGGGAGTGAAGTGG - Intronic
1089844888 11:121450994-121451016 GAGTGGGCCGGGGTAGGAATCGG + Intergenic
1091750510 12:3018961-3018983 GAGTCGGCAGGGGCGGGAGTAGG + Intronic
1092677808 12:10942118-10942140 GAGGTGGCAGGGGGGTGAAATGG + Intronic
1093104933 12:15074988-15075010 GAGGTGGCAGGGAGATGAAATGG - Intergenic
1093469132 12:19482305-19482327 GAGGTGGCAGGGGAGTGAAGTGG + Intronic
1093691705 12:22116192-22116214 GAGTTGGCAGGGGGATGGAGTGG + Intronic
1093948430 12:25136154-25136176 GAGGTAGCAGGGGAATGAAGTGG - Intronic
1094053979 12:26249806-26249828 GAGCTGGAAGGGGCAAGAAGTGG + Intronic
1094447311 12:30545922-30545944 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
1095115332 12:38345155-38345177 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1095501075 12:42839384-42839406 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1096347928 12:50866724-50866746 GAGATGGCAGGGGGTTGAAATGG - Intronic
1096974893 12:55694336-55694358 GAGTGGGCAGGGGCAAGTATGGG + Intronic
1097183452 12:57183976-57183998 GAGTTGGCGGGAGCAGGAAGAGG + Intronic
1097187162 12:57202115-57202137 GCGTGGGCAGGGGCAGGGATAGG - Intronic
1098074513 12:66714841-66714863 GAGTTGGTAGGGGGGTGGATTGG - Intronic
1099154435 12:79157113-79157135 GAGGTGGCAGGAGCAGGGATGGG - Intronic
1099477115 12:83121551-83121573 GAGGTGGCAGGGGGGTGAAATGG + Intronic
1100203550 12:92325148-92325170 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1100453141 12:94727034-94727056 GGGTTGGCAGCGGAATGAAGAGG - Intergenic
1101654942 12:106711995-106712017 GAGTTGATAGGGGCATGGAGTGG - Intronic
1102572619 12:113836235-113836257 CAGTGGGCAGGGGCAGGAAGAGG + Intronic
1103369097 12:120404626-120404648 GACATGGCAAGGACATGAATTGG + Intergenic
1107407285 13:40126777-40126799 GAGTGGGGATGGGCATGACTGGG - Intergenic
1107708320 13:43128662-43128684 GAGCTGACAGGGGCATGGAGGGG - Intergenic
1107992109 13:45827779-45827801 GAGGTGGCAGGGGCCTGGAAGGG - Intronic
1108825591 13:54408507-54408529 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1109201275 13:59434580-59434602 GAGGTAGCAGGGGAATGAAATGG + Intergenic
1109496510 13:63178741-63178763 GATTTGGCAGGGGCCAGAATTGG + Intergenic
1109534615 13:63700033-63700055 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1112087043 13:96042116-96042138 GAGGTGGCAGGGGGGTGAAATGG - Intronic
1113240301 13:108329216-108329238 GAGGTGGCAGGGGAATGAAATGG - Intergenic
1115299297 14:31865889-31865911 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1116048988 14:39780920-39780942 GAGGTGGCAGGGGTGTGAAATGG + Intergenic
1116369031 14:44106631-44106653 TTGTTGGCAGGAGCATGGATTGG + Intergenic
1116643531 14:47496881-47496903 GTGTTGGCAGGGGGATGGTTTGG + Intronic
1117768524 14:59108089-59108111 GAGATGGCAGGGGAGTGAAATGG - Intergenic
1117897352 14:60501469-60501491 AAGCTGGAAGGGGCATGAAGAGG + Intronic
1118165646 14:63332866-63332888 GAGGTGGCAGAGGGATGAAATGG - Intergenic
1120062937 14:80005734-80005756 AAGTTGCCAGGGGCTTGAAAGGG + Intergenic
1120489647 14:85161251-85161273 GAGGTGGCAGGGGGTTGAAATGG - Intergenic
1120605388 14:86570104-86570126 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1121503426 14:94458408-94458430 GAGATGGCAGGGGGGTGAAATGG + Intergenic
1121573823 14:94967204-94967226 AAGTTGGCAGCAGCAGGAATGGG - Intergenic
1122518764 14:102327620-102327642 GAGCAGGCAGGGGCAGGAACTGG - Intronic
1123143797 14:106108643-106108665 GAGTGGGGAGGGGCAAGAAGAGG - Intergenic
1123192178 14:106581863-106581885 GTGTGGGCAGGGGCATGCACAGG + Intergenic
1123941017 15:25216715-25216737 GAGTTGGGCAGGGCATGGATGGG + Intergenic
1124667952 15:31609814-31609836 GAGGTGGCAGGGGGGTGAAATGG - Intronic
1125787202 15:42330466-42330488 CAGTAGGCAGGAGCATGAAATGG - Intronic
1127352770 15:58169471-58169493 GCTTTGGCAGGTGCAGGAATAGG + Intronic
1127393268 15:58523515-58523537 GAGTTCTCTGGGGCATGAAGGGG + Intronic
1128818144 15:70629417-70629439 GGGTTGGCAGCGGTATGGATGGG - Intergenic
1129097557 15:73225201-73225223 GAGGTGGCAGGGGGGTGAAATGG + Intronic
1129562722 15:76589114-76589136 GAGATGGCAAGGGAATGAAATGG + Intronic
1129608794 15:77037557-77037579 GATGTGGCAGGGGCAAGAAGGGG + Intergenic
1129631729 15:77267455-77267477 GAGGTAGCAGGGGCATGAAGTGG - Intronic
1129813727 15:78533146-78533168 GAAATGGAAGGGGAATGAATTGG + Intronic
1130948048 15:88563976-88563998 GAGATGGCAGTGGCTTGGATTGG + Intergenic
1131326795 15:91455915-91455937 GAGTTGGCAGGGGGGTGAAATGG + Intergenic
1131419549 15:92293295-92293317 GAGTTTGCAAGGGCATCAAATGG + Intergenic
1132062367 15:98703001-98703023 GAGTTGGGAGGGGCAGGCAGGGG - Intronic
1133356954 16:5143616-5143638 GGGGTGGCAGGGGCAGGGATGGG + Intergenic
1133437141 16:5789449-5789471 GAGTGTGCATGGGCATGTATGGG + Intergenic
1133438873 16:5803940-5803962 AAGTAGGGAAGGGCATGAATTGG - Intergenic
1133979145 16:10620572-10620594 GAGGTGACAGGGGCCTGAGTCGG + Intergenic
1134190685 16:12118886-12118908 GAGTTGGAAGGGGCCTGAGATGG - Intronic
1134314962 16:13110267-13110289 GGGTTGGCTGTGGCAGGAATGGG - Intronic
1134787147 16:16954902-16954924 GTGCTGGCAAGGGTATGAATTGG + Intergenic
1135009936 16:18866763-18866785 GCGTTTTCAGGGGAATGAATTGG - Exonic
1135316818 16:21454229-21454251 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1135369741 16:21886472-21886494 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1135442073 16:22484652-22484674 GCGTTTTCAGGGGAATGAATTGG + Intronic
1135522944 16:23191221-23191243 GAGGTGGCTGGGGCATGGAGAGG - Intronic
1136313645 16:29434404-29434426 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1136327087 16:29536170-29536192 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1136441778 16:30276155-30276177 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1138547669 16:57729360-57729382 GAGTGGGCAGATGGATGAATGGG + Intronic
1138554802 16:57764983-57765005 GAGTGGGCAGGGCCATGCAGTGG + Intronic
1138881070 16:61015143-61015165 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1139888573 16:70229880-70229902 GCGTTTTCAGGGGAATGAATTGG - Intergenic
1140535268 16:75704070-75704092 GAATTGGCGGGGGCAAGAAGTGG - Intronic
1143142326 17:4748095-4748117 GAGTTGACAGGGGAAGGAAATGG - Intergenic
1144777930 17:17794118-17794140 GATTGAGCAGGGGCATGAAGTGG - Exonic
1147141831 17:38464719-38464741 CAGTTGGCAGGGGCAAGGAGTGG + Intronic
1148094378 17:45042216-45042238 GAGATGGCAGGGGCATCATTTGG - Intronic
1148330468 17:46811072-46811094 GAGTTGGCAGGGGTCAGGATGGG - Intronic
1148813205 17:50307991-50308013 GAGTTGTCAGGGGCCTGCCTGGG - Intergenic
1149332808 17:55604135-55604157 GAGTTTGGAAGGGGATGAATGGG + Intergenic
1150285098 17:63949876-63949898 GAGGGGGCAGGGGTATGAAAAGG + Intronic
1150476899 17:65482465-65482487 GAGATGGCAGAGGAAGGAATGGG + Intergenic
1151809531 17:76429779-76429801 GAGCAGGCAGGGGCATGGCTGGG + Intronic
1153396335 18:4625592-4625614 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1153428187 18:4988778-4988800 GAGGAGGCAGGGGGCTGAATTGG + Intergenic
1154297928 18:13166269-13166291 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
1158343362 18:56489861-56489883 GAGTTTGCAGGGTCAAGAAAGGG + Intergenic
1158844300 18:61425414-61425436 GAGGGGGCAGAGGCATGAGTAGG + Intronic
1159078293 18:63706437-63706459 GTATTGGCAGGGGTATGTATTGG + Intronic
1160219711 18:76965782-76965804 GAGATGGCAGGGGGGTGAAATGG + Intronic
1160896150 19:1402816-1402838 GAGGTGGCAGGGGCATGTGGAGG - Intergenic
1161319553 19:3634630-3634652 GAGCTGGCAGAGGCATGGGTTGG - Intronic
1161558586 19:4958099-4958121 GAGATGCCATGGGCATGACTGGG - Intronic
1161630397 19:5352086-5352108 GAGGTGGCAGGGGCAAAAAGTGG - Intergenic
1162935999 19:13981914-13981936 GAGCTGGCAGGGCCAGGAATTGG + Intronic
1163191007 19:15676516-15676538 GAGTGGGCAGAGGAATGAGTGGG - Intronic
1163421039 19:17213732-17213754 CAGTTGGGAGGGGCATGGCTGGG + Intronic
1163490249 19:17613547-17613569 GAGTTAACAAGGGCAAGAATGGG - Intronic
1164839866 19:31384960-31384982 CAGATGTCAGCGGCATGAATGGG + Intergenic
1165037087 19:33041515-33041537 GGGTTGGCAGGGGCAGGAGTGGG - Intronic
1165381093 19:35480929-35480951 CAGTTTGCAGGGGGATGAAAAGG - Intergenic
1165885213 19:39073177-39073199 GAGATGGCAGAGGGATGAATCGG + Intergenic
1166364345 19:42270914-42270936 GAGCAGGCAGGGGCATGTCTGGG - Intronic
1166698293 19:44866825-44866847 GTGTTGGGAGGGGAAAGAATGGG + Intronic
1166927542 19:46279216-46279238 GAGGTGGCTGGGGTATGAACTGG - Intergenic
1166990969 19:46692526-46692548 GAGTAGGAAGGGGCAGGATTGGG - Intronic
1167026056 19:46919169-46919191 ATGTTAGCAGGGGCATGAATAGG + Exonic
1167906470 19:52664789-52664811 GGGTTCGCAGGGGAATGAAGGGG + Intronic
1168686606 19:58352907-58352929 AAGTGAGCCGGGGCATGAATTGG - Exonic
925343364 2:3151751-3151773 GAGGTGGCAGGGGGGTGAAAAGG - Intergenic
925479113 2:4250817-4250839 GAGATGGCAGGGGGGTGAAATGG - Intergenic
925753289 2:7109331-7109353 GAGGTGGCAGTGGCATGTGTGGG - Intergenic
925817708 2:7769331-7769353 CAGCTGGCAGGGGCACAAATGGG + Intergenic
926060129 2:9800040-9800062 GAGATGGCAGGGGAATGGAAGGG - Intergenic
932164665 2:69495063-69495085 GAGTTGGTAGGGGCAACAATGGG + Intronic
932270421 2:70404039-70404061 GAAGTGGCAGGGGGATGAAATGG - Intergenic
933437247 2:82263280-82263302 GAGCTGGAAGGGGCATGGAGTGG + Intergenic
934149681 2:89134494-89134516 GAGCTGACAGGACCATGAATGGG + Intergenic
934217616 2:90047534-90047556 GAGCTGACAGGACCATGAATGGG - Intergenic
935007176 2:99090006-99090028 GAGGTGGCAGGGGAGTGAAATGG - Intronic
936406614 2:112210173-112210195 GTGGTGGCAGGGGCATGGCTCGG + Intergenic
937663071 2:124452636-124452658 GAGGTTGCAGGGGCCTGAAGTGG - Intronic
937699386 2:124846969-124846991 GAGGTAGCAGGGGAATGAAGTGG + Intronic
938564192 2:132503468-132503490 GAGGTAGCAGGGGAATGAAGTGG + Intronic
938599489 2:132822300-132822322 GAGGTGGCAGGGGAGTGAAGTGG - Intronic
939219395 2:139282013-139282035 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
940217577 2:151316098-151316120 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
940709346 2:157143722-157143744 GAGGTGGCAGGGGTGTGAAATGG + Intergenic
940762439 2:157752048-157752070 GATATGGCAGGGGAATGAAATGG - Intronic
940784931 2:157971385-157971407 GAGGTGGCAGGGGTATCAAATGG + Intronic
940796756 2:158088878-158088900 GAGGTGGCAGGGGAGTGAAGTGG + Intronic
944626133 2:201570670-201570692 GAGTTGGCAGGGGCAAGATACGG - Intronic
945482539 2:210360590-210360612 GAGTTGGCAGGGGGGTGAAATGG + Intergenic
945783410 2:214204421-214204443 GAGGTGGCAGGGGAATGAAGTGG - Intronic
946457282 2:219837747-219837769 GAAATGGCAAGGGCTTGAATGGG - Intergenic
948714024 2:239847365-239847387 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
1168908885 20:1429227-1429249 GAGTTGGGAGGGGTCTAAATGGG + Intergenic
1169401366 20:5283232-5283254 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1170161959 20:13322405-13322427 GAGTTGGCAGGTGGAAGAGTTGG - Intergenic
1172010631 20:31844056-31844078 GACTGGGCAGGGGCAAGACTGGG - Intergenic
1172405526 20:34686063-34686085 GAGTTGGCAGTGGTATGTATTGG + Intergenic
1172485358 20:35294513-35294535 GAGGTGGCAGGGCCATCATTAGG + Intergenic
1173320220 20:41981019-41981041 GAGTTGATAGGGGCCTGAACTGG + Intergenic
1174075464 20:47932309-47932331 GAGGTGGCAGGGCCAGGACTGGG - Intergenic
1174761418 20:53210414-53210436 GAGTTGGGAGGGGGATGGAGTGG + Intronic
1175332371 20:58174287-58174309 TGGTTGGGAGGGGCATGAAGGGG + Intergenic
1177195530 21:17900587-17900609 GAGGTGGCAGGGGTGTGAAATGG + Intergenic
1178732920 21:35121050-35121072 GAGGTAGCAGGGGAATGAAGTGG - Intronic
1179287493 21:39990746-39990768 GAGTTGGAAGGGGCAAATATTGG - Intergenic
1180250748 21:46585808-46585830 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1180934062 22:19612499-19612521 GAATAGACAGGGGGATGAATAGG - Intergenic
1182303392 22:29351406-29351428 GAGCTGGCAGGTGCCTGAAAAGG + Intronic
1183115126 22:35685967-35685989 GAGCTCTCAGGGTCATGAATCGG - Intergenic
1184671080 22:46012628-46012650 GCGTAGGCAGGGGCAGCAATTGG + Intergenic
949597328 3:5561884-5561906 GAGTAGGCAGGGGAAGGATTGGG + Intergenic
950653755 3:14424061-14424083 GAGCTGGCAGGGGTTTGAAAAGG - Intronic
951554061 3:23903025-23903047 GATCTGGCAGGGGCATTTATTGG - Intronic
951669038 3:25159939-25159961 GAGTTGGGAGGAGAAAGAATGGG - Intergenic
951727233 3:25774012-25774034 GAGGTGGCAGGGGAGTGAAGTGG + Intronic
951770746 3:26254546-26254568 GAGTGGGCAGGGGGAGGAAATGG - Intergenic
953356373 3:42259701-42259723 GAGTGAGCAGGGACATGAAGAGG + Intronic
954515842 3:51175642-51175664 CAGTTGGGAGGGGCTAGAATTGG + Intronic
955916250 3:63911852-63911874 GAGTTGTCAAAAGCATGAATGGG - Intronic
957392761 3:79599001-79599023 GAGGTGGCAGGGGAGTGAAGTGG - Intronic
958480741 3:94643151-94643173 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
958584589 3:96069586-96069608 GAGCTGGCAGGGTCAGGAACAGG - Intergenic
958969894 3:100600367-100600389 GAAGTGGCAGGGGAATGAAATGG + Intergenic
960756513 3:121019513-121019535 GAGATGGCAGGGGAGTGAAGTGG - Intronic
961978038 3:131047672-131047694 GAGGTGGCAGGGGAGTGAAGTGG + Intronic
962401800 3:135067087-135067109 GAGGTGGCAGGGGGGTGAAATGG + Intronic
963623027 3:147635614-147635636 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
964136578 3:153351537-153351559 GAGTTGGAAGGGGGATGGAGTGG + Intergenic
964226512 3:154408972-154408994 GAAGTAGCAGGGGCATGAAGTGG - Intronic
964643875 3:158937228-158937250 GAGGTGGCAGGGGTGTGAAATGG - Intergenic
966269788 3:178090863-178090885 GAGTTCTCAGAGGGATGAATGGG + Intergenic
966347695 3:178997534-178997556 GAGCTGGAAGGGGGATGAAGTGG - Intergenic
967257474 3:187608730-187608752 CAGGTGGCAGGGGGATGAAATGG + Intergenic
968657118 4:1783470-1783492 GGGTGGGCAGGGGCAGGGATGGG + Intergenic
970375199 4:15450216-15450238 GTGTTGGCTGAGGAATGAATTGG - Intergenic
970967758 4:21948402-21948424 GAGGTGGGAGCGGCAGGAATGGG - Intronic
971152004 4:24043297-24043319 GAGTTGGAAGGGGGATGATCAGG - Intergenic
971560472 4:28073840-28073862 GAGTTGGACGGGGGATGCATAGG + Intergenic
972097277 4:35364143-35364165 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
972189028 4:36568339-36568361 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
972450223 4:39190283-39190305 GAGTAGGCAGGGCCATGGATTGG + Intronic
973179529 4:47251343-47251365 GAGGTGGCAGGGGGATGCATTGG + Intronic
974801773 4:66827863-66827885 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
976562727 4:86521009-86521031 GAGGTGGCAAGGGAATGAAGTGG + Intronic
976963064 4:91003145-91003167 GAGGTGGCAGGGGGGTGAAATGG + Intronic
978761888 4:112361831-112361853 GAGGTAGCAGGGGAATGAAGTGG - Intronic
979844099 4:125486496-125486518 GTGTTGGCAGGGGGATGCAGTGG - Intronic
981582429 4:146263122-146263144 GAGTTGGGTGGGTCATGAATGGG - Intronic
982218723 4:153106811-153106833 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
983544884 4:168952813-168952835 GAGGTGGCAGGGGGGTGAAATGG + Intronic
984245933 4:177275328-177275350 GAGCTGGAAGGGGGATGGATTGG - Intergenic
985730230 5:1543415-1543437 GAATGGGAAGGGGAATGAATGGG + Intergenic
985837342 5:2280868-2280890 GAGTGGGCAGGTGGATGAGTGGG + Intergenic
986753447 5:10811562-10811584 GAGTGGGGAGGGTAATGAATTGG + Intergenic
986870280 5:12037059-12037081 GAGGTGGCAGGGGGTTGAAATGG - Intergenic
988723507 5:33903065-33903087 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
989584104 5:43061190-43061212 AGGTGGGCAGGGGCATGAAAGGG + Intergenic
990742843 5:58929885-58929907 GAAATGTCAGGGGCATGACTAGG - Intergenic
993027313 5:82661671-82661693 GAGAGGGCATAGGCATGAATAGG + Intergenic
993034573 5:82742957-82742979 TTGTTGACAGGGGCATAAATTGG + Intergenic
993243758 5:85425285-85425307 GTGTTGGCAGGGGGAGGAAGAGG - Intergenic
993613768 5:90085184-90085206 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
993974005 5:94454927-94454949 GAGTTGGTGATGGCATGAATGGG + Intronic
994220771 5:97192690-97192712 GAGGTAGCAGGGGAGTGAATTGG + Intergenic
995398932 5:111718908-111718930 GAACTGGCAGGGGCAGGAACAGG - Intronic
995694550 5:114865259-114865281 GAGTTGGCAGGGGAGTGAAATGG + Intergenic
995955368 5:117770180-117770202 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
996565141 5:124872306-124872328 TATTTAGCCGGGGCATGAATGGG - Intergenic
998492113 5:142556183-142556205 GAGTTGGCAGGAACATAAAAAGG - Intergenic
999001389 5:147927073-147927095 GAGTGGGCAGGGACATAAATGGG - Intergenic
999254205 5:150200805-150200827 GAGTTTGCAGGGGCAGGGAGTGG + Intronic
1000394697 5:160761291-160761313 GAGTTGGCAGGGGAGCGAAGTGG - Intronic
1000867955 5:166538424-166538446 GAGTTGGAAGGGGGATGGAGTGG - Intergenic
1001452396 5:171836665-171836687 GTGCTGGCAGGGGCAGGAGTAGG + Intergenic
1001493161 5:172169561-172169583 GAGTTGGCAGGGGCATGAATGGG + Intronic
1002063275 5:176639260-176639282 GAGTTGGGAGGGAGAGGAATGGG + Intronic
1004888584 6:20075178-20075200 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
1005691467 6:28311101-28311123 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1008148211 6:47917965-47917987 GAGGTGGCGGGGGGATGGATGGG + Intronic
1008250847 6:49238056-49238078 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1008250863 6:49238138-49238160 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1008528568 6:52433574-52433596 GAGGTGGCAGGGGGGTGAAACGG + Intronic
1009644393 6:66378568-66378590 GAGGTAGCAGGGGAATGAAGTGG - Intergenic
1010008909 6:71027935-71027957 GAGGTGGTAGGGGGATGAAATGG + Intergenic
1010633626 6:78230730-78230752 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1011620364 6:89237128-89237150 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1013221272 6:108080047-108080069 GAGGTGGCAGGGGGGTGAAATGG + Intronic
1013368127 6:109449799-109449821 TAAGGGGCAGGGGCATGAATGGG + Intronic
1014333811 6:120105878-120105900 GAGTTGGGGGAGGCATGAATTGG - Intergenic
1014659207 6:124146414-124146436 GAGTTGACAGGGATTTGAATTGG + Intronic
1014785416 6:125613120-125613142 GAGTTGACAGGGACAAGAAAAGG - Intergenic
1015347877 6:132180638-132180660 GAGATGGCAGGGGAGTGAAGTGG - Intergenic
1015362313 6:132354551-132354573 GAGGTGGCAGGGAGATGAAATGG + Intronic
1016078881 6:139831554-139831576 GAGTTTGATGGGGCTTGAATGGG + Intergenic
1016765566 6:147789388-147789410 GAGATGGCAGAAGCATGAATAGG - Intergenic
1017215373 6:151900840-151900862 GAGGTGGCAGGGGAGTGAAATGG + Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018009457 6:159656032-159656054 GAGGTGGCAGGGGGCTGAAATGG - Intergenic
1020211246 7:6159599-6159621 GAGTTGGCAGAGCCATGGAGAGG + Intronic
1023144434 7:37135471-37135493 GAGTTAGCAGGGGAGTGAAGTGG - Intronic
1023318980 7:38973457-38973479 GAGTTGAGAGGGGCTTGACTTGG - Intergenic
1024367254 7:48535406-48535428 GAGGTAGCAGGGGAATGAAGTGG + Intronic
1024586970 7:50850230-50850252 GAGTTGGCAGGGGAAGGAGAGGG - Intergenic
1024745313 7:52399686-52399708 GAGGTGGCAGGGGGCTGAAATGG + Intergenic
1026405298 7:70059167-70059189 GTTTTGGTAGGGGGATGAATAGG - Intronic
1026538387 7:71259447-71259469 GAGTTAGCAGGGGCAGATATAGG + Intronic
1027888313 7:83937802-83937824 GAGTTGGGAGGGGAATGGAGTGG - Intergenic
1027963811 7:84980741-84980763 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
1030325256 7:108211991-108212013 GAGGTGGCAGGGGGTTGAAATGG - Intronic
1030390403 7:108920743-108920765 GAGGTGGCAGGGGGGTGAAATGG + Intergenic
1030533516 7:110737801-110737823 GAGTTAGCAGGGGAATGGAGTGG - Intronic
1031138913 7:117919503-117919525 GAGGTGGCAGGGGTATGAAATGG - Intergenic
1031493927 7:122423329-122423351 CAGATGGCAGGGACAGGAATGGG - Intronic
1031799340 7:126223158-126223180 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1032784236 7:135187927-135187949 GAGCTGGCAGGGGCAGAGATGGG - Intronic
1033538163 7:142331218-142331240 GAGGAGGCTGGGGCATCAATGGG + Intergenic
1033540575 7:142352431-142352453 GAGGAGGCTGGGGCATGAATGGG + Intergenic
1033544026 7:142383941-142383963 GAGGAGGCTGGGGCATCAATGGG + Intergenic
1033551842 7:142454739-142454761 GAGGAGGCTGGGGCATGAATGGG + Intergenic
1033554122 7:142473672-142473694 GAGGAGGCTGGGGCATAAATGGG + Intergenic
1033556384 7:142491735-142491757 GAGGAGGCTGGAGCATGAATGGG + Intergenic
1033653979 7:143361607-143361629 GAGTTGGAAAGGGGAAGAATGGG + Intronic
1034247824 7:149662335-149662357 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1034705438 7:153139208-153139230 GAGGTGGCAGGGGAGTGAAAAGG + Intergenic
1035591434 8:817861-817883 GAGGGGGCAGGGGAATGAAATGG + Intergenic
1036052407 8:5215091-5215113 GAGTTGTTAGGGGCATAAAAAGG + Intergenic
1037320766 8:17640668-17640690 GAGGTGGCAGGGGAGTGAAATGG + Intronic
1039000947 8:32979628-32979650 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1039018248 8:33177066-33177088 CAGTTGGCAGAGGCATGATGTGG - Intergenic
1039095500 8:33880622-33880644 GAGTTGGCAGAGGAGTGAAATGG + Intergenic
1039401595 8:37274560-37274582 GAGTTGGTAGGGGAATGGAAGGG + Intergenic
1039571880 8:38593299-38593321 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1039826947 8:41182818-41182840 GAGCAGGTGGGGGCATGAATGGG - Intergenic
1040561154 8:48524392-48524414 GAGTTGGCTGGGGCATGGCGTGG + Intergenic
1040811239 8:51456030-51456052 GAGTTGGTGGTGGCATGGATAGG - Intronic
1041763604 8:61393803-61393825 GAGGTGGCAGGGGAGTGAAGTGG + Intronic
1041837415 8:62232170-62232192 GAGCTGGGAAGGGCATGAATTGG - Intergenic
1042768373 8:72352386-72352408 GAGTTAGCAGGGGAGTGAAGTGG + Intergenic
1043040835 8:75259923-75259945 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1043987861 8:86715288-86715310 GAGATAGCAGGGGAATGAAGTGG - Intronic
1045438506 8:102187701-102187723 GAGTAGGTGAGGGCATGAATGGG + Intergenic
1045994239 8:108343588-108343610 GAGGTGGCAGGGGGATGAAATGG - Intronic
1046037991 8:108867245-108867267 CAGGTGTCTGGGGCATGAATAGG - Intergenic
1048018939 8:130520499-130520521 GAGCTGGGAGGGGCTTGCATCGG + Intergenic
1048155772 8:131948917-131948939 GAGTTGGCATTAGCATGAAGAGG - Intronic
1048474791 8:134733454-134733476 GAGATGGAATGGGGATGAATGGG + Intergenic
1048648700 8:136450950-136450972 GAGTTGGAAGGGGGATGGAGTGG + Intergenic
1049200385 8:141337192-141337214 GGGTGGGCAGGGACATGTATGGG - Intergenic
1049869731 8:144965367-144965389 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1050655546 9:7824552-7824574 AAGTTGGCAGGGACATCAGTAGG + Intronic
1051044314 9:12855257-12855279 GAGGTGGAAGGGGCAAGTATAGG - Intergenic
1051687642 9:19675251-19675273 GAGGTGGCAGGGGAGTGAAATGG + Intronic
1052459119 9:28740968-28740990 GACTTGGCAGGGGCATGGCCAGG + Intergenic
1052894642 9:33735531-33735553 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1053231673 9:36415710-36415732 GAGGTAGCAGGGGAATGAAGTGG + Intronic
1056252159 9:84760744-84760766 GAGGTGGAAAGGGCAGGAATGGG + Intronic
1056309502 9:85324756-85324778 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
1057251498 9:93507118-93507140 GAGTGGGCAAGGGCAGGTATAGG + Intronic
1058396276 9:104557505-104557527 GAGGTGTCAGGGGAATGAAGTGG - Intergenic
1058595734 9:106613506-106613528 GAGCTGGCAGGTGCTTGAAAGGG + Intergenic
1058784506 9:108374142-108374164 GAGGTGGCAGGGGCATAAAGTGG + Intergenic
1059025212 9:110620180-110620202 GAGATGGGAGGGAGATGAATGGG - Intergenic
1060498403 9:124134638-124134660 GAGATGGGAGTGGCATGGATGGG + Intergenic
1061512250 9:131068397-131068419 GGGCTGGCAGGAGCATGAGTCGG - Intronic
1061877762 9:133553484-133553506 GAGTTGGCTGGGGCAGGGGTAGG - Intronic
1186677345 X:11832568-11832590 GGGTTGGAAGGGGCTTGAAGAGG + Intergenic
1187750289 X:22456197-22456219 CAGGTGGCATGGCCATGAATAGG - Intergenic
1188032188 X:25276431-25276453 GTATTGTGAGGGGCATGAATAGG + Intergenic
1190444660 X:50511939-50511961 GAGTTGGAGGGGGCATGGGTTGG - Intergenic
1191080692 X:56506361-56506383 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1192297237 X:69864195-69864217 GAGTTAGCAGGGGAGTGAAGTGG - Intronic
1192316158 X:70053340-70053362 GAGCTCTCAGGGGCAGGAATTGG + Intergenic
1192900097 X:75487273-75487295 GAGGTGGCAGGGGAGTGAAGTGG - Intronic
1192929624 X:75792154-75792176 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1192968134 X:76202076-76202098 GAGGTGGCAGGGGGTTGAAATGG + Intergenic
1193950754 X:87795371-87795393 GAGGTGGCAGGGGAGTGAAATGG - Intergenic
1194237247 X:91399523-91399545 GAGGTGGCAGGGGGGTGAAATGG - Intergenic
1194299036 X:92162731-92162753 GAGGTGGCAGGGGAATGAAATGG + Intronic
1194439017 X:93906327-93906349 GAGGTGGCAGGGGAGTGAAGTGG + Intergenic
1194701443 X:97119450-97119472 GAGGTGGCAGGGGGGTGAAATGG + Intronic
1195066804 X:101244752-101244774 GATGTGGCAAGGGCATGAACAGG - Intronic
1196948227 X:120849987-120850009 GAGGTGGCAGGGGTGTGAAATGG + Intergenic
1197055445 X:122113492-122113514 GAGGTGGCAGGGGAGTGAAATGG + Intergenic
1197708454 X:129650226-129650248 GAGCTGCCAGGGGTATGATTGGG - Intronic
1197765164 X:130055445-130055467 GGGTTGGCAGGGGCGGGAGTCGG + Intronic
1198550363 X:137738652-137738674 GAGTTGGAAGGGCAATGAAGAGG - Intergenic
1198559860 X:137837911-137837933 GAGTTAGCAGGGGAGTGAAGTGG + Intergenic
1199553612 X:149081945-149081967 GAGGTGGCAGGGGAGTGAAGTGG - Intergenic
1199858663 X:151780485-151780507 GAGGTGGCAGGAGAATGAAAGGG + Intergenic
1200616639 Y:5387565-5387587 GAGGTGGCAGGGGAATGAAATGG + Intronic
1200738451 Y:6827388-6827410 GAATTGGCAGGGGAGTGAAGTGG + Intergenic