ID: 1001495304

View in Genome Browser
Species Human (GRCh38)
Location 5:172184101-172184123
Sequence CAATTGGCAGGGAGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001495304_1001495312 12 Left 1001495304 5:172184101-172184123 CCTCCTCAGCTCCCTGCCAATTG 0: 1
1: 0
2: 1
3: 24
4: 326
Right 1001495312 5:172184136-172184158 CCGTGTCAAAATGGAATCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 69
1001495304_1001495310 3 Left 1001495304 5:172184101-172184123 CCTCCTCAGCTCCCTGCCAATTG 0: 1
1: 0
2: 1
3: 24
4: 326
Right 1001495310 5:172184127-172184149 TCTCAGGTGCCGTGTCAAAATGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001495304 Original CRISPR CAATTGGCAGGGAGCTGAGG AGG (reversed) Intronic
901823321 1:11844363-11844385 CTAATGGCAGGGGGTTGAGGTGG - Intergenic
903378206 1:22879593-22879615 CAGCTGGCGAGGAGCTGAGGTGG - Intronic
903995816 1:27304966-27304988 CAAAGGGCAGGGAGGTCAGGTGG - Intronic
904440665 1:30527449-30527471 CAAATGGCAGGTAGGAGAGGAGG - Intergenic
904605520 1:31695812-31695834 GAATGGGCAGGGAGCTCAGGGGG + Intronic
904891456 1:33782631-33782653 GAATTGAGAGGGTGCTGAGGAGG + Intronic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905403269 1:37717837-37717859 CAAGGCACAGGGAGCTGAGGTGG + Exonic
905414272 1:37793981-37794003 CAAGTGGCCGCGAGCCGAGGGGG - Exonic
906032677 1:42733790-42733812 CAAATGGCAGGGAGCTGCTGGGG - Exonic
907409619 1:54274929-54274951 CAATTGGCAGTGAATTGAGGTGG - Intronic
907623724 1:56009042-56009064 CTCTTGGCAGGCAGCTGTGGTGG - Intergenic
911957760 1:104259862-104259884 CAATTGACTGGTAACTGAGGGGG + Intergenic
912233035 1:107817665-107817687 CCATAGGCAGGGGGGTGAGGAGG + Intronic
913047147 1:115083988-115084010 CACTTGGCAGGGAACGGTGGAGG + Intronic
913340901 1:117757381-117757403 CAGATTGCAGGGAGCTGAGGGGG + Intergenic
913533207 1:119747742-119747764 CCATTGGCGGGGAGCAGAGCTGG - Intergenic
913606837 1:120475049-120475071 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
914209596 1:145565093-145565115 CTCAGGGCAGGGAGCTGAGGAGG - Intergenic
914268515 1:146057461-146057483 TCAGGGGCAGGGAGCTGAGGAGG - Intergenic
914368577 1:147003402-147003424 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
915168089 1:153959674-153959696 CAAGTGGCAGGGTGCTGAAATGG + Exonic
915221228 1:154376343-154376365 CAAGTTGCAGTGAGCTGAGATGG - Intergenic
915502368 1:156328056-156328078 CATCTGGCAGGGAGGTGGGGGGG + Intronic
915587620 1:156852643-156852665 CCCAGGGCAGGGAGCTGAGGTGG - Intronic
915655186 1:157353419-157353441 CATTTTGCTGGGAGCTGAGTTGG + Intergenic
917329026 1:173862787-173862809 CACCTGGCTGGGTGCTGAGGTGG - Intergenic
917455593 1:175183154-175183176 GCATTGTCAGGGAGGTGAGGTGG - Intronic
919880639 1:201898441-201898463 CAGTAGGGAGGGAGGTGAGGTGG - Intronic
920200206 1:204255536-204255558 CAAATGGCTGGAAGATGAGGAGG + Intronic
921948792 1:220907678-220907700 CAAGCTTCAGGGAGCTGAGGTGG + Intergenic
922423168 1:225472684-225472706 CAGTTTGCAGGGAGGTGTGGAGG + Intergenic
923002938 1:230022721-230022743 CAACTGGCAGGAAGGGGAGGAGG + Intergenic
1063145866 10:3294728-3294750 CAATTGCCAAGCAGTTGAGGAGG + Intergenic
1063686261 10:8239807-8239829 CAATTGGCCTAGAACTGAGGAGG + Intergenic
1066504404 10:36026441-36026463 CAGTTGGGAGGGGGCAGAGGTGG - Intergenic
1067310271 10:45106340-45106362 CATTATGCAGGGAGCTGAGCAGG + Intergenic
1069653114 10:70065783-70065805 AAATTGGCAGTGGGTTGAGGGGG + Intronic
1069667386 10:70171975-70171997 CAATACTCAGGGAGCTGAGTGGG + Intergenic
1069765132 10:70851039-70851061 CAATTGGAAGGCAAGTGAGGTGG + Intronic
1070776316 10:79111850-79111872 CTATAGGCTGGGAGCTGGGGTGG + Intronic
1070800130 10:79240262-79240284 CAAGTGCCTGTGAGCTGAGGTGG + Intronic
1073540733 10:104314818-104314840 CTATCTGCAGGCAGCTGAGGTGG + Exonic
1073848122 10:107583136-107583158 CCACTTGCAGGGGGCTGAGGTGG - Intergenic
1074080732 10:110166264-110166286 CAATGAGCAGGGAGGAGAGGAGG - Intergenic
1074262430 10:111867677-111867699 CAAGTGGAAGGAAGCTAAGGAGG + Intergenic
1074406060 10:113181138-113181160 AAAATGGCAGGGGGGTGAGGAGG - Intergenic
1074883225 10:117674537-117674559 CAATTGTTAGGAACCTGAGGAGG - Intergenic
1075853075 10:125604274-125604296 CAGGGGGCAGGGAGCTCAGGCGG - Intronic
1077930586 11:6727936-6727958 GAATTGGAAGGGTGGTGAGGGGG + Intergenic
1078113067 11:8415565-8415587 CAATTGGCTGGGAGGAGAGGAGG - Intronic
1079263798 11:18910703-18910725 CAATGGGCAGGCCGCAGAGGAGG + Intergenic
1079402535 11:20117551-20117573 GCCTTGGCAGGGAGGTGAGGGGG - Intronic
1080350166 11:31375340-31375362 GACATGGCAGGGAGCTGGGGAGG - Intronic
1081605539 11:44525084-44525106 CAATTGGAAGGAAGCTTGGGAGG + Intergenic
1081618603 11:44605196-44605218 AAATGGGCAGGCAGCTGCGGAGG - Intronic
1081800094 11:45852556-45852578 CAATAGACAGGGATGTGAGGAGG - Intronic
1081957237 11:47104185-47104207 CAATCGGCAGGGAATTGGGGTGG - Intronic
1083920525 11:65779751-65779773 CAGCTGGCCGGCAGCTGAGGAGG - Exonic
1084502131 11:69540981-69541003 CAATGGGCCGGGGGCTCAGGCGG + Intergenic
1085030825 11:73269920-73269942 CAGCTGGCTGGGAGCAGAGGTGG + Intronic
1086399273 11:86447417-86447439 TAACTGGCAGGGACCTGAGGTGG - Intronic
1087043913 11:93828885-93828907 CAAGTGGCAGGGAGGTGTAGTGG + Intronic
1087753994 11:102036026-102036048 GAAGTTGCAGTGAGCTGAGGTGG - Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091606257 12:1954115-1954137 CAAGTTGCAGTGAGCTGAGATGG + Intronic
1091663063 12:2398931-2398953 CAGTTGCCAGGGCACTGAGGGGG - Intronic
1091766055 12:3120572-3120594 CAATAGGTAGAGAGATGAGGAGG - Intronic
1091885317 12:4012873-4012895 TACTTGGCAGGTAGCTGAAGTGG + Intergenic
1093425292 12:19021987-19022009 CTATTGGCAGGGGGCAGGGGTGG - Intergenic
1093921621 12:24866054-24866076 CAGTTTGCAGGGAGGTGTGGAGG + Intronic
1095738771 12:45585885-45585907 CAATTGACTGGGAAGTGAGGAGG - Intergenic
1097014349 12:55974494-55974516 CCATTTGCCGGGAGGTGAGGAGG + Intronic
1097210005 12:57360507-57360529 CAAGAAGCAGGGAGCTAAGGTGG + Intronic
1097282685 12:57854383-57854405 CATTTGGAAGGGAGAAGAGGAGG + Intergenic
1097552840 12:61098083-61098105 CATTTGGCAGGAAGCAGAAGAGG - Intergenic
1098168334 12:67720100-67720122 AAATAGGCAGGGAGCTGGGAAGG + Intergenic
1099823326 12:87743157-87743179 CAATTTCCAGGGAGCTAAGAAGG - Intergenic
1099930472 12:89068469-89068491 CAGATGGCAAGGAGCAGAGGAGG - Intergenic
1102887539 12:116533408-116533430 CAGAAGGCTGGGAGCTGAGGAGG - Intergenic
1102943101 12:116961358-116961380 CACTGGGCTGGGAGGTGAGGAGG + Intronic
1103602631 12:122063871-122063893 CAGTAGGCAGGGAGGTGGGGTGG + Intergenic
1104323406 12:127773247-127773269 AACTATGCAGGGAGCTGAGGTGG + Intergenic
1105440608 13:20412789-20412811 CCACAGGCTGGGAGCTGAGGAGG - Intronic
1106027725 13:25971293-25971315 CAATTGTGAGGCAGCTTAGGAGG - Intronic
1106704737 13:32268244-32268266 TAATTGGCAGGGGGAGGAGGTGG + Intronic
1107885383 13:44870704-44870726 CATTTGGCAGGCAGGTGTGGAGG + Intergenic
1109141003 13:58714061-58714083 CAGCTGGCAGGGAGGTGTGGAGG + Intergenic
1110346894 13:74458997-74459019 CACTTGGCGGGGGGCTGAGGTGG + Intergenic
1110574107 13:77036652-77036674 CTATTGGAAGGGAGTAGAGGTGG - Intergenic
1111157651 13:84349638-84349660 TACTTGGCAGCCAGCTGAGGTGG + Intergenic
1112584422 13:100705650-100705672 CAGTTGGCTGGGAGCTCAAGTGG - Intergenic
1113350494 13:109524722-109524744 CAATTGGCGGGGGGTTGCGGGGG + Intergenic
1113543996 13:111132020-111132042 CAATTGGCAGGGAACTGAGCGGG + Intronic
1113971874 13:114197505-114197527 CAGTTGGCTGGGAGTTGTGGAGG + Intergenic
1114139624 14:19895165-19895187 CATTTGGCAGAGAGCAGTGGAGG + Intergenic
1116182403 14:41551654-41551676 AAATTAGCAGGGAGATGGGGTGG + Intergenic
1116786365 14:49293323-49293345 CAACTGGAAGGCAGCTGAGGAGG - Intergenic
1116992024 14:51286724-51286746 GAGTGGGCAGGGAGATGAGGAGG - Intergenic
1117102804 14:52367801-52367823 CAAGAGGCAGAGAGCTGATGAGG + Intergenic
1118156283 14:63245543-63245565 TACCTGGCAGGGGGCTGAGGAGG + Intronic
1118293303 14:64546290-64546312 GAGGTTGCAGGGAGCTGAGGAGG - Intergenic
1121604640 14:95231529-95231551 CCATGGACAGGGTGCTGAGGGGG - Intronic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1121935643 14:98016161-98016183 AACTTGACAGGAAGCTGAGGTGG - Intergenic
1122202402 14:100130548-100130570 CAATTGGAAGGCAGCTGGGAGGG - Intronic
1122352401 14:101103689-101103711 CAAGCGGCAGTGAGCTGGGGAGG - Intergenic
1122974653 14:105166123-105166145 CAAGAGGCAGGGAGGTGAGCTGG + Intronic
1202905610 14_GL000194v1_random:70140-70162 GAATTTGCAGTGAGCTGAGATGG + Intergenic
1124308705 15:28601671-28601693 CACTACTCAGGGAGCTGAGGTGG - Intergenic
1124507591 15:30291828-30291850 CAATGGGCAGGGAGCAGGTGGGG - Intergenic
1124735965 15:32246830-32246852 CAATGGGCAGGGAGCAGGTGGGG + Intergenic
1127716839 15:61656494-61656516 CAATAGGCAGGGTGATAAGGAGG - Intergenic
1127903759 15:63360859-63360881 CAATGGGCTGGTAGGTGAGGGGG - Intronic
1128598615 15:68976051-68976073 CAACTTGCAGGGAGGTGTGGAGG - Intronic
1128838521 15:70830925-70830947 CAATTCACAGGGAGATGATGAGG + Exonic
1129270493 15:74417003-74417025 CAATTGGCAGAGCCCTGATGAGG + Intronic
1129788702 15:78326211-78326233 CAATTTGCAGTGAGCTTAGATGG + Intergenic
1130908268 15:88254761-88254783 CAATGGGTAGGCAGCTGAGAAGG - Intronic
1131251572 15:90834248-90834270 CAAATGACTGGGAGCTGAGTGGG + Intergenic
1131509356 15:93041043-93041065 CAAGTGGCATGGAGCAGGGGTGG - Intronic
1131993865 15:98115611-98115633 GAATATGCAGAGAGCTGAGGAGG - Intergenic
1132156650 15:99500491-99500513 CAGTAGGCAGGGAGCTGGAGTGG + Intergenic
1132914731 16:2337751-2337773 CCATTGGCTGAGAGCTGGGGAGG + Intronic
1133023425 16:2976866-2976888 CCCTTGGCAGGGGGCGGAGGTGG + Exonic
1134297206 16:12957479-12957501 CACATGGCAGGGAGCAGAGAGGG + Intronic
1134328079 16:13225386-13225408 CAATAGGTATGGAGCAGAGGAGG + Intronic
1135678475 16:24437222-24437244 GAGTTTGCAGTGAGCTGAGGTGG + Intergenic
1136579251 16:31142184-31142206 CTTTTGGGAGGGAGCTGAGGCGG - Intronic
1137447888 16:48543227-48543249 CATTTGGCAGGGCACTGAGTAGG + Exonic
1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG + Intergenic
1137873517 16:51973305-51973327 GAGATGGCAGGGAGCTGAGCTGG - Intergenic
1141016031 16:80450399-80450421 CATTTGGCAGTGACCGGAGGAGG - Intergenic
1141178120 16:81734054-81734076 GAGTTTGCAGGGAGCTGAGATGG + Intergenic
1141991185 16:87611268-87611290 CACAGGGCAGGGACCTGAGGAGG + Intronic
1142215900 16:88829682-88829704 CAATTACTAGGGAGCAGAGGTGG - Intronic
1142864112 17:2779929-2779951 CAAATGGGAGGGGGATGAGGTGG + Intronic
1143518912 17:7434646-7434668 CAGGTAGCAGTGAGCTGAGGTGG + Intergenic
1146958852 17:36955162-36955184 GAGTTGGAAGGGACCTGAGGAGG + Intronic
1147765353 17:42831848-42831870 CAGTTAGTAAGGAGCTGAGGTGG + Intronic
1148040407 17:44702267-44702289 GAAGTGGCAGTGAGCTGAGATGG - Intergenic
1148077326 17:44945839-44945861 GAGGTTGCAGGGAGCTGAGGTGG + Intronic
1148395391 17:47304137-47304159 CACTTTGCGGGGGGCTGAGGCGG - Intronic
1148474681 17:47920263-47920285 AAATTAGCAGGGCGCAGAGGCGG - Intronic
1149480419 17:56998998-56999020 GAGTTGGTAGGGAGCTGAGTGGG + Intronic
1150486332 17:65546343-65546365 CAATTGGCAGAGTTCTGAAGAGG + Intronic
1150571560 17:66391394-66391416 CATTTGGATGGGAGGTGAGGAGG - Intronic
1151694026 17:75705038-75705060 CAATTGGCGGGGAGGAAAGGGGG - Intronic
1152467513 17:80474513-80474535 CAACTGGCAGGGAGCAGAGCAGG + Intronic
1155142615 18:23056372-23056394 CAATAGGCAGGGATGGGAGGGGG + Intergenic
1155495236 18:26436195-26436217 CAATTGGGAGGGAGAAGAGGCGG - Intergenic
1160222805 18:76989623-76989645 CCATGGGCTGGGAGCGGAGGGGG - Intronic
1160859983 19:1233634-1233656 CAACTGGCAGGGAACAGAGATGG + Exonic
1161050174 19:2159536-2159558 AAATTAGCCGGGAGCTGTGGCGG - Intronic
1161400416 19:4064691-4064713 CAGCTGGCAGGGAGGTGGGGGGG + Intronic
1161753733 19:6116157-6116179 TAATTCACAGGAAGCTGAGGTGG - Intronic
1162271058 19:9615822-9615844 GAAGTTGCAGTGAGCTGAGGTGG + Intronic
1163040995 19:14602400-14602422 TACTTGGTGGGGAGCTGAGGTGG - Intronic
1163190327 19:15672745-15672767 CAGTTGGCAGCCAGCTGAGCTGG - Exonic
1163350361 19:16773062-16773084 CAATTGGCAGGGAGGGTAGAGGG + Intronic
1163437738 19:17305411-17305433 CTCTTGGCAGGAAGCCGAGGAGG - Intronic
1163556465 19:17996191-17996213 AAATTAGCAGGAGGCTGAGGTGG + Intronic
1164975751 19:32571566-32571588 CAGTTTGCAGGGAGGTGTGGAGG + Intergenic
1166943355 19:46382137-46382159 GAGTTGGCAGGGGGCAGAGGCGG + Intronic
1166949622 19:46417838-46417860 CAGGTTGCAGTGAGCTGAGGTGG + Intergenic
1167767920 19:51496647-51496669 CAAGAGGCAGGGAGGTGAGGAGG + Intronic
1168335822 19:55597298-55597320 GTATTGGCAGGGAGATGGGGCGG + Intronic
1168610473 19:57795335-57795357 GAATTTGCAGTGAGCTGAGATGG + Intronic
1202708725 1_KI270714v1_random:4797-4819 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
926317532 2:11722132-11722154 CAATTGGAAAGGGGCTGTGGAGG - Intronic
926538177 2:14140518-14140540 CAATTGGCAAGGAGGTTAGATGG + Intergenic
927662277 2:25003072-25003094 CAATTTCCAGGGATATGAGGGGG - Intergenic
928201166 2:29248396-29248418 GAAGTTGCAGTGAGCTGAGGTGG + Intronic
929201813 2:39244253-39244275 CAGCTTGCAGGGAGCTGTGGAGG + Intergenic
930616915 2:53603111-53603133 CAGTTGGCATGGAGCTGAATCGG + Intronic
931146996 2:59530016-59530038 CATGTGTCAGGGAGCTGAGCTGG - Intergenic
931353447 2:61513170-61513192 CGACTGCCAGGAAGCTGAGGTGG - Intronic
931745095 2:65285051-65285073 GAAGTTGCAGGGAGCTGAGATGG - Intergenic
932692899 2:73928555-73928577 CAATTGGAAAGGCCCTGAGGTGG + Intronic
935108229 2:100066427-100066449 CAAGTGGCAGGGAACAGAAGAGG - Intronic
935249966 2:101252728-101252750 GAATTGGCAGGAAGCGGGGGCGG - Intronic
937027452 2:118711272-118711294 CTGTTGGCAGGGAGAAGAGGAGG - Intergenic
937207289 2:120244935-120244957 CAAAAGTCAGGGAGCTGAGCTGG + Intronic
938170885 2:129075794-129075816 CAATTGGCTAGGTGCTGAGGGGG - Intergenic
939165070 2:138631704-138631726 CAAGTTGCAGTGAGCTGAGATGG + Intergenic
939465082 2:142546039-142546061 CAGCTTGCAGGGAGGTGAGGAGG + Intergenic
940761247 2:157741771-157741793 CACTTGGCAGGGCTCAGAGGAGG + Intronic
940989015 2:160079067-160079089 TAATTGACTGGGAGCTGGGGTGG - Intergenic
942091649 2:172497386-172497408 TACTTGGGAGGCAGCTGAGGTGG + Intronic
942793945 2:179793817-179793839 GAGTTGGCAGGGAGGAGAGGAGG + Intronic
944089234 2:195886859-195886881 CAATTGGAAGAGAGCTGCGTGGG - Intronic
945916547 2:215710550-215710572 AAAATGGGAGGGAGGTGAGGGGG + Intergenic
946130943 2:217606492-217606514 CCATTAACAGGAAGCTGAGGAGG + Intronic
946634243 2:221707022-221707044 AAATTGGTAGGGAGATTAGGGGG - Intergenic
947099183 2:226600964-226600986 CATGTGACAAGGAGCTGAGGGGG + Intergenic
947601452 2:231453261-231453283 CAGTTCTCAGGAAGCTGAGGTGG - Intergenic
1169036948 20:2461721-2461743 AAACAGGCAGGGAGCTGAGGAGG + Exonic
1169092639 20:2871021-2871043 CTACAGGCAGGCAGCTGAGGAGG + Intronic
1169749316 20:8975655-8975677 GAATTTGCAGTGAGCTGAGATGG - Intergenic
1170361284 20:15548888-15548910 CTATTGGCTGGGAGCTCAGCTGG - Intronic
1172162086 20:32875831-32875853 CAAGTGTCTGGGTGCTGAGGGGG - Intronic
1173592746 20:44238198-44238220 CAAGTGACAGGGTACTGAGGTGG - Intergenic
1173970496 20:47148630-47148652 AAAGTGGCAGGGAGCAGGGGAGG - Intronic
1175551659 20:59821868-59821890 CAGCTGGCAGGAAGTTGAGGAGG + Intronic
1175703373 20:61157002-61157024 CAGGTTGCAGGGAGCTGAGATGG - Intergenic
1176283453 20:64328213-64328235 CAAGAGGCAGGGAGGTGGGGAGG - Intergenic
1176287907 21:5028580-5028602 CAAGAGGCAGGGAGCTTGGGTGG - Intronic
1179377643 21:40865066-40865088 CAGTTGGCAGGGGGTAGAGGTGG + Intergenic
1179869274 21:44234895-44234917 CAAGAGGCAGGGAGCTTGGGTGG + Intronic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1182310138 22:29398499-29398521 CAGTTGGAAAGGAGCTGAGCTGG + Intronic
1183111134 22:35649323-35649345 TACTTGGGAGGGTGCTGAGGTGG + Intronic
1183649203 22:39144695-39144717 CAATGGGCAGGGCGGTGTGGAGG - Intronic
1185031582 22:48446289-48446311 CACTTGGCAGGGAGGAGAGAAGG - Intergenic
949300671 3:2580319-2580341 GCAGTGGCAGAGAGCTGAGGAGG + Intronic
950126614 3:10513723-10513745 GAATGTGCAGGGGGCTGAGGGGG + Intronic
950168050 3:10816295-10816317 CAATGGGAAGGCTGCTGAGGAGG + Exonic
950522796 3:13506593-13506615 CACTTGGCAGGGGGGTGGGGTGG + Intergenic
952766636 3:36960021-36960043 TAATTGGCAAGGAGATGGGGAGG - Intergenic
953740261 3:45532704-45532726 GAAGTTGCAGTGAGCTGAGGTGG - Intronic
954620076 3:51990535-51990557 CAGTTCGCAGGGAGGTGTGGAGG + Intergenic
954647970 3:52143051-52143073 CATTGAGCAGGGAGCTCAGGGGG + Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955928356 3:64030457-64030479 CAGTTACTAGGGAGCTGAGGTGG - Intergenic
956334061 3:68143825-68143847 GGATTGGCAGGGATCTTAGGAGG - Intronic
956350653 3:68332011-68332033 AAATTGGCAGGGTGCGGTGGCGG - Intronic
959705260 3:109333275-109333297 CAGGTTGCAGGGAGCTGAGATGG + Intronic
961598631 3:128041645-128041667 CAGAGGGCAGGGAGCTGTGGGGG - Intergenic
961806543 3:129493340-129493362 CAGTGGGCACAGAGCTGAGGAGG + Intronic
962595033 3:136933767-136933789 GAAGTGGCAGTGAGCTGAGATGG - Intronic
964517402 3:157527434-157527456 CTATTGGCAGGATGCTGATGGGG - Intronic
965233519 3:166085069-166085091 CAATTGCAAGGGAACTGTGGAGG + Intergenic
966090005 3:176122266-176122288 GCATTAGCAGGGAGTTGAGGAGG - Intergenic
967278399 3:187798947-187798969 CAACTTGCAGGGAGGTGTGGAGG - Intergenic
967303978 3:188042995-188043017 CATTTGGGAGGGAGATGATGAGG - Intergenic
969524361 4:7696678-7696700 CATTTGGGAGGAAGGTGAGGTGG - Intronic
970362817 4:15327009-15327031 CAAAGGGCAGGTAACTGAGGAGG - Intergenic
970922659 4:21413097-21413119 GAATTGGCAGGGGCCTCAGGTGG + Intronic
971220102 4:24697502-24697524 CCAGAGGCAGGAAGCTGAGGAGG + Intergenic
972399839 4:38690524-38690546 CATATGGCAGAGAGCAGAGGTGG - Intronic
972438054 4:39053903-39053925 CAATTGGGAGGGAGCTAAGTAGG + Intronic
975755834 4:77570643-77570665 CAGTTTGCAGGGAGGTGTGGAGG + Intronic
978107815 4:104925754-104925776 CCAGTGGCAGGGAGCAGGGGTGG + Intergenic
979308274 4:119173764-119173786 CAGCTTGCAGGGAGCTGTGGAGG + Intronic
981214672 4:142150320-142150342 CATGTGGCAGGGAGCTAAGCAGG - Intronic
982217760 4:153096910-153096932 AAACAGGCAGGGAGGTGAGGAGG - Intergenic
984300600 4:177912303-177912325 CAACTGTCAGAGAGCAGAGGAGG - Intronic
985559332 5:574579-574601 AAATTGGCTGGGGGCTGGGGAGG - Intergenic
987357495 5:17077355-17077377 GAGTTGGCAGTGAGCTGAGATGG + Intronic
987370407 5:17187722-17187744 GACTTGGCAGGGAGGTGAGGTGG + Intronic
988916923 5:35903751-35903773 CAATTGGCAGAAAGCAGAGAGGG + Intergenic
989398268 5:40981689-40981711 CAGATGGCTGGGAGTTGAGGAGG - Exonic
989537093 5:42575967-42575989 GAAGTTGCAGTGAGCTGAGGTGG + Intronic
991436038 5:66597402-66597424 CGAGGGGCAGGGAGTTGAGGGGG + Intronic
991548563 5:67811307-67811329 TAAATGGCAGGCAGCTGAGAAGG - Intergenic
991926016 5:71705694-71705716 CAATTGGCAGGAGTCGGAGGAGG - Intergenic
994016706 5:94975230-94975252 AATTTGGCAGGGAGTTGCGGGGG - Intronic
994245460 5:97471388-97471410 AAGTTGGGAGGGGGCTGAGGCGG + Intergenic
994840436 5:104917745-104917767 CAAATGCCAAGGACCTGAGGGGG - Intergenic
997374382 5:133386682-133386704 AATTTGGCAGGGGGCAGAGGTGG + Intronic
997839979 5:137230339-137230361 CATTTTGCAGGAAGCTGATGGGG - Intronic
997859022 5:137399592-137399614 CTCTTGGCTGGGAGCTGTGGTGG - Intronic
998179410 5:139925989-139926011 CATGTGGCAGGGGGCTGAGTTGG - Intronic
998221627 5:140286668-140286690 TAGTTTGCAGTGAGCTGAGGTGG - Intronic
998386491 5:141760149-141760171 CAGGTGGCAGGGGGCTGAGGAGG + Intergenic
999099437 5:149010937-149010959 CTATTGGCATGAAGCTGGGGAGG - Intronic
999567310 5:152878809-152878831 GAAGTTGCAGGGAGCTGAGATGG + Intergenic
1000349782 5:160344199-160344221 CAAGTGACAGGAAACTGAGGAGG + Intronic
1000845952 5:166280434-166280456 CGACTGGCAGAGAGCAGAGGAGG + Intergenic
1001495304 5:172184101-172184123 CAATTGGCAGGGAGCTGAGGAGG - Intronic
1001968725 5:175936638-175936660 CTACTGGGAGGGGGCTGAGGTGG - Intronic
1002248718 5:177907099-177907121 CTACTGGGAGGGGGCTGAGGTGG + Intergenic
1002476336 5:179468686-179468708 CCATGGGCTGGGAGCTGAGCTGG - Intergenic
1004861417 6:19807349-19807371 CAGCTGGCAGGGAGGTGTGGAGG - Intergenic
1005497040 6:26396842-26396864 CACACAGCAGGGAGCTGAGGAGG - Intergenic
1005501841 6:26435645-26435667 CACATAGCAAGGAGCTGAGGTGG - Intergenic
1005938612 6:30544228-30544250 GAATTGACTGGGAGCTGAGGAGG - Exonic
1006271961 6:32971904-32971926 CAATTGGCTTGGAGATGTGGCGG + Exonic
1007018926 6:38499196-38499218 TACTTGGCAGTGTGCTGAGGAGG - Intronic
1008449901 6:51638454-51638476 CATTTGGCAGGGGGTTGAGGAGG + Intronic
1008481739 6:51993177-51993199 CAGGTGGCAGGGAGGTGAGTGGG + Intronic
1008724462 6:54400129-54400151 CCAGTGGCAGGGAGGTGGGGTGG + Intergenic
1009389139 6:63124616-63124638 CATCTGGCAGGGATCTGTGGTGG - Intergenic
1012290879 6:97453913-97453935 AAATTGGCACAGAGCTGAGCAGG + Intergenic
1013309222 6:108878314-108878336 CAATTGTCAGTGAGCTGGGCTGG + Intronic
1013489710 6:110634279-110634301 GAGGTTGCAGGGAGCTGAGGTGG - Intronic
1014240702 6:119015303-119015325 CAACTTGCAGGGAGGTGTGGAGG + Intronic
1014917021 6:127163065-127163087 TAATTGGCAGGGATCTCAGTTGG - Intronic
1016671526 6:146714690-146714712 CAATTAGCAGGTATCTGAGCAGG - Intronic
1016686286 6:146885988-146886010 GAATTAGCAGGGAGGAGAGGTGG - Intergenic
1018452201 6:163919500-163919522 CACGTGGCAGGGAGGGGAGGAGG + Intergenic
1018510120 6:164516133-164516155 CATTTGGCAGGGGTCAGAGGTGG - Intergenic
1019140412 6:169938928-169938950 TAATTTGCAGGGCGCTGAGCCGG + Intergenic
1020496167 7:8855521-8855543 GAAATGGCAGGGAGTTGAGAAGG + Intergenic
1020582757 7:10026196-10026218 TAATTGGAAGGGAGCAGAAGAGG + Intergenic
1021178898 7:17483348-17483370 CACATGGCAGGGTGGTGAGGAGG - Intergenic
1025113276 7:56237087-56237109 AACTTGGCAGTGAGCTGAGATGG + Intergenic
1026795648 7:73364408-73364430 CCATAGGCAGGGGGCCGAGGAGG - Intergenic
1027666891 7:81050715-81050737 GAATTTGCAGTGAGCTGAGATGG + Intergenic
1027686806 7:81288728-81288750 AAATTAGCCGGGAGCTGTGGCGG - Intergenic
1029606421 7:101601894-101601916 CAGTTGGCAGGAGGCTGGGGAGG - Intergenic
1030690591 7:112528622-112528644 AAATTGGCAGGGAGGAGAGCAGG - Intergenic
1031090629 7:117349516-117349538 CACTTGTTCGGGAGCTGAGGAGG - Intergenic
1031770375 7:125833860-125833882 CAGCTGCCAGGGTGCTGAGGTGG + Intergenic
1033099228 7:138456479-138456501 CACTTCTCAGGAAGCTGAGGTGG - Intergenic
1034067512 7:148151136-148151158 CAATTGGCAAGAGGCAGAGGTGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036098818 8:5755406-5755428 CGATGGGCTGGAAGCTGAGGGGG - Intergenic
1036284947 8:7436009-7436031 CAATGGGCTGGCAGCTGAGGTGG + Intergenic
1036336528 8:7875521-7875543 CAATGGGCTGGCAGCTGAGGTGG - Intergenic
1038293447 8:26270210-26270232 GAGTTTGCAGTGAGCTGAGGTGG - Intergenic
1038731045 8:30128004-30128026 CAAATGGGAGGGAGCAGCGGGGG + Intronic
1038789983 8:30659526-30659548 CAATTGGTAGGAAACTGATGAGG + Intergenic
1040469576 8:47726066-47726088 CAATGGGCAGGCACATGAGGAGG - Intronic
1040600913 8:48883210-48883232 CAAGGGGCAGGCAGCTGTGGAGG + Intergenic
1041180502 8:55242729-55242751 CAGTTGGCAGGGAGCCGCAGAGG + Intronic
1042196158 8:66232652-66232674 CATCTGGGAGGGAGGTGAGGTGG + Intergenic
1042667317 8:71221296-71221318 CAAATGGCAGTGAGGTGGGGTGG + Intronic
1043387893 8:79766443-79766465 CAATCCGCAGAGAGCTGGGGTGG + Intronic
1048169993 8:132097078-132097100 CAATAGCCAGAGAGCCGAGGGGG - Intronic
1048763618 8:137824019-137824041 CGACTGGCAAGGATCTGAGGTGG - Intergenic
1048803916 8:138221527-138221549 CAAATTGCAGGGAGTTTAGGTGG + Intronic
1049480062 8:142818351-142818373 CAGTGGGCAGGCAGCAGAGGAGG - Intergenic
1049934704 9:490394-490416 CAGCTAGCTGGGAGCTGAGGTGG + Intronic
1051258143 9:15234341-15234363 CATCTGGCAGGGAGGTGGGGGGG + Intronic
1051853270 9:21533733-21533755 GAATTGGCAGGGTGTTGACGGGG + Intergenic
1056187741 9:84152355-84152377 CAATTTGCAGGAAGAAGAGGAGG + Intergenic
1056519326 9:87385471-87385493 AAATTGGCTGGGAGCGGTGGCGG + Intergenic
1056708739 9:88972993-88973015 CCACCGGCAGGGGGCTGAGGAGG - Intergenic
1057702353 9:97372764-97372786 CGGTTGGGAGGGTGCTGAGGTGG + Intronic
1060496262 9:124121269-124121291 CAATTAGCTGGGAGCGGTGGTGG + Intergenic
1062022236 9:134325228-134325250 TAATGGGGAGGGAGGTGAGGAGG - Intronic
1062519559 9:136952015-136952037 CACTTGGAAGGGGGCTGAAGGGG + Intronic
1203748142 Un_GL000218v1:55352-55374 GAATTTGCAGTGAGCTGAGATGG + Intergenic
1187187192 X:16998134-16998156 CTATTTGCAGAGGGCTGAGGCGG + Intronic
1187822434 X:23302412-23302434 CCATGGGGAGGGTGCTGAGGAGG - Intergenic
1189251156 X:39601511-39601533 CATGTGGCAGGGCGATGAGGGGG + Intergenic
1189958149 X:46297844-46297866 CTATTGGCTGGGAGCTCAGCTGG + Intergenic
1190023869 X:46904095-46904117 CAAGTGGCAGGCAGCTGGGAAGG + Intergenic
1191091162 X:56623651-56623673 CTACTGTCAGGAAGCTGAGGTGG - Intergenic
1192625403 X:72722039-72722061 CAAATGGCAGGGGGCAGGGGAGG - Intergenic
1192682544 X:73267075-73267097 CAAGTGTCTGGGAGCTGAGTGGG + Intergenic
1192689318 X:73345014-73345036 CAATTGTCATGGGGCTGAGGAGG + Intergenic
1192953580 X:76044185-76044207 CATTTGGCAGGGAGTAGTGGAGG + Intergenic
1195469798 X:105219187-105219209 CAGTCGGAAGGCAGCTGAGGCGG + Exonic
1196679471 X:118455969-118455991 GAAGTTGCAGTGAGCTGAGGTGG + Intergenic
1199050276 X:143229073-143229095 CAGCTTGCAGGGAGCTGTGGAGG - Intergenic
1199860210 X:151794672-151794694 CAGATGGCTGGGAGTTGAGGAGG - Intergenic
1199868201 X:151873215-151873237 CAATGGGGAGGCAGATGAGGTGG - Intergenic
1201061643 Y:10051707-10051729 CAATTGGGAGACAGCTTAGGAGG + Intergenic
1201161491 Y:11170320-11170342 GAATTTGCAGTGAGCTGAGATGG + Intergenic