ID: 1001495975

View in Genome Browser
Species Human (GRCh38)
Location 5:172188043-172188065
Sequence GGCCGGGGGCGCGGTGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1116
Summary {0: 1, 1: 1, 2: 9, 3: 150, 4: 955}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001495975 Original CRISPR GGCCGGGGGCGCGGTGGCGC CGG Exonic