ID: 1001499709

View in Genome Browser
Species Human (GRCh38)
Location 5:172220898-172220920
Sequence CCTAATAAGCAATTATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 34, 2: 98, 3: 153, 4: 381}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001499709 Original CRISPR CCTAATAAGCAATTATAGCA AGG Intronic
900723024 1:4191150-4191172 ACAAATAAGCAATTATAACAAGG - Intergenic
902206565 1:14872717-14872739 CCCAGTAAGAAATTATTGCATGG + Intronic
904308393 1:29606363-29606385 CCTAATAAGCAATCTTATAAAGG - Intergenic
904854177 1:33484063-33484085 ACTAATAAGCAGTTATAGCAAGG - Intronic
904967485 1:34387946-34387968 ACTAATAAGCAATTATAGCAAGG + Intergenic
904982165 1:34514969-34514991 ACTAATAAACAAGTTTAGCAAGG + Intergenic
905288299 1:36901861-36901883 ATTAATAAGCAATTATAGAAAGG + Intronic
905999012 1:42407775-42407797 CCTAGGAAGCCATTATAACAAGG - Intronic
906455346 1:45991726-45991748 ACTAATAAGCAATTACAACAAGG - Intronic
906951620 1:50339349-50339371 ACTAATAAGCAATTTTAGCAAGG - Intergenic
907258932 1:53201588-53201610 CCTAGGAAGCAAATACAGCATGG + Intronic
907315248 1:53566366-53566388 ACTAATAAGCAATTATAGCAAGG + Intronic
907881979 1:58558408-58558430 ACTAATAAGCAATTAAAGCAAGG + Intergenic
908047858 1:60191079-60191101 ATTAATAAGCAATTATAGCAAGG + Intergenic
909375048 1:74930893-74930915 ATGAATAAGTAATTATAGCAAGG + Intergenic
909645336 1:77910771-77910793 ACTAATAAGTTATTTTAGCAGGG + Intronic
909695254 1:78461333-78461355 CCTGATAAACAACTACAGCAAGG - Intronic
909944044 1:81643216-81643238 ACTAATAAGTGATTATAGCAGGG + Intronic
910161269 1:84275207-84275229 GCTAATAAGTAATTATAGGAAGG - Intergenic
910325835 1:86005844-86005866 ATGAATAAGCAGTTATAGCAAGG + Intronic
911343168 1:96664056-96664078 ATTAATAAGCAATTATAGCAAGG - Intergenic
911806600 1:102217335-102217357 ACTAATAAGTGATTACAGCAAGG + Intergenic
911813179 1:102310356-102310378 AGTAATAAGCAATTATTGTAAGG + Intergenic
911934762 1:103955371-103955393 GCTAATAAGCAGTTATAGAAAGG - Intergenic
912131123 1:106601748-106601770 ACTAATAAGCAATGATATAAAGG + Intergenic
912136842 1:106670675-106670697 ACTAAAAAGTCATTATAGCAAGG + Intergenic
912479348 1:109968030-109968052 AACAATAAGTAATTATAGCAAGG + Intergenic
913028144 1:114867619-114867641 ACTAATAAGCAATTACAGCAAGG - Intronic
915438707 1:155929798-155929820 CCTAACTAGCAATAAAAGCAAGG - Exonic
916602856 1:166310734-166310756 ACTAATAAAAGATTATAGCAAGG - Intergenic
916805489 1:168256196-168256218 ACTAGTAAGCAATTATAGTAAGG - Intergenic
917172740 1:172195286-172195308 ACTAACAAGTAATTAAAGCAAGG - Intronic
917363925 1:174208234-174208256 ACTAATAAGCAAGTACAGTAAGG - Intronic
917568585 1:176238076-176238098 ACTAATAAGTGATTATAGCAAGG - Intergenic
917586113 1:176427758-176427780 ACTTATAAGGAATTATAGTAAGG - Intergenic
917763051 1:178185203-178185225 ACCAAAAAGCAGTTATAGCAAGG - Intronic
917907933 1:179607288-179607310 ACTAATTAGCAATTATAGCAAGG - Intronic
917988102 1:180342129-180342151 CCTAGAAATCAATTAGAGCAAGG + Intronic
918351891 1:183664746-183664768 TATAATAAGCAATTACAGCAAGG - Intronic
918383366 1:183980844-183980866 CTTATTAAGAAAATATAGCATGG + Intronic
918539849 1:185619174-185619196 ACTAATAAGAAATTATAGCAAGG + Intergenic
918665672 1:187147553-187147575 CCTAAGAAGTGATTATAGCAAGG - Intergenic
918948352 1:191100319-191100341 AATAATAAGCAAATATAGAAAGG + Intergenic
918969830 1:191399037-191399059 ATTAATAAGCAATTATAGCAAGG + Intergenic
919577257 1:199326463-199326485 CTTAAAAAGCAATTCCAGCAAGG + Intergenic
921093356 1:211864136-211864158 TCTAATAAACAATTATAGCAAGG - Intergenic
921605492 1:217148733-217148755 TCTAATAAGCAATTATAGCAAGG + Intergenic
922181459 1:223237209-223237231 ACTAATAAGCAATTATAGCAAGG - Intronic
923023092 1:230180967-230180989 ACTAATAAACAATTACAGCAAGG - Intronic
923709122 1:236371284-236371306 ACGAATAAACAATTACAGCAAGG - Intronic
923759025 1:236822696-236822718 ACTAACAAGCAATTATACCAAGG - Intronic
924083385 1:240422605-240422627 GCTAATACACAAATATAGCAAGG - Intronic
1063061292 10:2556438-2556460 CTAAATAAGCAATTATAACAAGG - Intergenic
1063297634 10:4823261-4823283 ACTACTAAGCAATTATAGCAAGG + Intronic
1063807487 10:9662446-9662468 ACTAATAAGCAAATATAGCGAGG - Intergenic
1064234212 10:13558588-13558610 GCTAATAAGTGATTATAGTAAGG + Intergenic
1064525507 10:16251717-16251739 CGTAATAAGTGATTATAACATGG + Intergenic
1065243322 10:23730853-23730875 ACTAACAAGCAATTATAGCAAGG - Intronic
1065277696 10:24102172-24102194 ATGAAGAAGCAATTATAGCAAGG + Intronic
1065469140 10:26059047-26059069 ATGAATAAGCAATTACAGCAAGG - Intronic
1065521053 10:26573171-26573193 ACTAACAAGCAGTTATAGCAAGG - Intergenic
1065526476 10:26626825-26626847 ACTAATAAGCAGTTACAGCAAGG - Intergenic
1065530065 10:26660446-26660468 ACTAATAAGCAGTTATAGCAAGG - Intergenic
1065619241 10:27562618-27562640 ACTAATAAGAAATTATAGCAAGG - Intergenic
1066043136 10:31571912-31571934 ACTACTAAGCAATGATAGCAAGG + Intergenic
1066161534 10:32736776-32736798 TCTAATAGGTCATTATAGCAAGG - Intronic
1066485649 10:35841185-35841207 ACTAATAAGTGATTATAGCCAGG - Intergenic
1066999108 10:42589665-42589687 ATTAATAAGCAATTATAGCAGGG - Exonic
1067320344 10:45213785-45213807 ACTAATAAACAACTACAGCAAGG + Intergenic
1067514294 10:46924051-46924073 CTTAATAAGCAATTACAGCAAGG - Intronic
1067647963 10:48127758-48127780 CTTAATAAGCAATTACAGCAAGG + Intergenic
1068154201 10:53175349-53175371 ACTAATAAGTGATTATAGCAAGG + Intergenic
1069541885 10:69300903-69300925 ACTAATAAACAATTTCAGCAAGG + Intronic
1069586722 10:69610284-69610306 AATAATAAGCCATTATAGCAAGG + Intergenic
1070245479 10:74727589-74727611 ACTAATAGGCAAGTTTAGCAAGG + Intergenic
1070868020 10:79720848-79720870 GCTAATAAACAAATTTAGCAAGG + Intergenic
1071634930 10:87243049-87243071 GCTAATAAACAAATTTAGCAAGG + Intergenic
1071998405 10:91169412-91169434 ACTAATAAGCAATTACAGCAGGG + Intronic
1072018065 10:91369584-91369606 CCTATTAAGCATTTTCAGCAGGG + Intergenic
1072509819 10:96109400-96109422 ACTAATAAGTGATTAGAGCAAGG - Intergenic
1073639141 10:105231375-105231397 ACTAATACATAATTATAGCAAGG - Intronic
1074629685 10:115238587-115238609 ACTAATAAGCTAGCATAGCAAGG - Intronic
1074653918 10:115560016-115560038 ACTAATACACAATTTTAGCAAGG + Intronic
1074804685 10:117037039-117037061 ACTAATAAGCATTTATAGCAAGG + Intronic
1075267568 10:121016175-121016197 ACTAATAAGTAGTTATAGCAAGG + Intergenic
1075361725 10:121843104-121843126 TGAAATAAGCAATTACAGCAAGG + Intronic
1075570808 10:123542207-123542229 ACTAATAAGTTATTTTAGCAAGG - Intergenic
1076575910 10:131467608-131467630 ACTACTAAGTGATTATAGCAAGG - Intergenic
1076635245 10:131877559-131877581 ATTAATAAGTGATTATAGCAAGG + Intergenic
1076991077 11:274872-274894 ACTAATAAGTGATTATAGCAAGG - Intergenic
1077380298 11:2232693-2232715 ACTAAAAAGCAACTATGGCAAGG + Intergenic
1077780256 11:5319986-5320008 ACTGATAAACAATTTTAGCAAGG + Intronic
1077817472 11:5699986-5700008 ACTAATAAGTAATTATAGCAAGG - Intronic
1081137273 11:39453506-39453528 CATAATTAACAATTATAGTAAGG + Intergenic
1081624285 11:44638674-44638696 ACTAATAAACAAATTTAGCAAGG + Intergenic
1081642822 11:44768460-44768482 ACAAATAAGCAATTATACTAAGG - Intronic
1081880753 11:46449315-46449337 ACTATTAAATAATTATAGCAAGG + Intronic
1084015760 11:66379968-66379990 AATAATAAGCAATTATACCAAGG - Intergenic
1084339427 11:68485243-68485265 ACTTATAAGCCATTATACCAAGG - Intronic
1084644841 11:70450355-70450377 ATTAATAAGCAATTATACCAAGG - Intergenic
1085753291 11:79181730-79181752 ACTAATAAGCAATTATAGCAAGG + Intronic
1086037052 11:82428654-82428676 ACTAATAAGCAACCATAGCAAGG + Intergenic
1086172702 11:83854008-83854030 ACTAATAAGCAATTAGAGCAAGG + Intronic
1086187979 11:84042388-84042410 ATTAATGAGCAATAATAGCAAGG - Intronic
1086363370 11:86082547-86082569 ACTAATAAGCTATTATAACAAGG - Intergenic
1087417744 11:97879511-97879533 ATTAATAAGCAAATATAACAAGG + Intergenic
1087438786 11:98156888-98156910 CCTAATAAACAAGTTTAGCAAGG - Intergenic
1087979859 11:104598198-104598220 ACTAATAAGAAATGATAGCAAGG + Intergenic
1088733371 11:112704018-112704040 ACTGATAAACAATTTTAGCATGG + Intergenic
1088929636 11:114338240-114338262 ACTAATAAACAATTATAACAAGG + Intergenic
1088948831 11:114543863-114543885 ACTACTAAGTAAATATAGCAAGG + Intronic
1089369352 11:117943672-117943694 TCTCATAAGTAATTTTAGCAAGG - Intergenic
1089628473 11:119767954-119767976 ACTAATAAGCAAGTTTAGCAAGG - Intergenic
1090030192 11:123199690-123199712 ACCAATAAGCAATTACAACATGG + Intergenic
1090552212 11:127833822-127833844 ACCAATAAGCAATTCTAGCAAGG + Intergenic
1091081776 11:132677029-132677051 ACTAATAAGCAATTATAGCAAGG + Intronic
1091126044 11:133098953-133098975 CCAACTTAGCAATTATAGCAAGG + Intronic
1091263548 11:134253226-134253248 CCTAATTAGCAAGGATAACAAGG - Exonic
1091438338 12:492251-492273 ACTAATAAGCAAGTATAGAAGGG + Intronic
1091454282 12:594229-594251 ACTAATAAGCAAGTATTACAAGG + Intronic
1091462504 12:655396-655418 ACTAATAAGCAATTATAGCAAGG + Intronic
1092977780 12:13762296-13762318 CCTAATAAGAAATGATGGCTGGG - Intronic
1093262279 12:16953468-16953490 CTGAATGAGTAATTATAGCAAGG + Intergenic
1093357555 12:18186770-18186792 ACTAATAAGTGACTATAGCAAGG - Intronic
1093406440 12:18810350-18810372 CCTAGAAAGCTAGTATAGCAGGG + Intergenic
1093595947 12:20959671-20959693 GCTGATAGGCAATTTTAGCAAGG + Intergenic
1093616305 12:21229726-21229748 ACTAATAAGCAATTATTGCAAGG - Intronic
1093900819 12:24629956-24629978 ACTAATAAGCAATTATATTAAGG - Intergenic
1094274940 12:28663105-28663127 ACTAATAAACAATTATAGCAAGG + Intergenic
1094314656 12:29125741-29125763 ACTAATAAGCAATTATAACAAGG - Intergenic
1094394210 12:29988115-29988137 ACTCAAAAGTAATTATAGCAAGG - Intergenic
1094595876 12:31865902-31865924 ACTAATAAATAATTTTAGCAAGG + Intergenic
1094645442 12:32318995-32319017 ACTAATAAGCAAGTATAGCAAGG - Intronic
1094672696 12:32586527-32586549 CCTCAGAAACAATTAAAGCATGG + Intronic
1095460587 12:42440346-42440368 ACTAATATGTGATTATAGCATGG - Intronic
1095835546 12:46634828-46634850 ATTAATAAGTGATTATAGCAAGG - Intergenic
1095887005 12:47199047-47199069 TATAGTAAGTAATTATAGCAAGG + Intronic
1096039835 12:48504820-48504842 ACTAACAAGCAATTATTGCAAGG + Intergenic
1096395879 12:51266310-51266332 TCTACTAAGCGTTTATAGCATGG - Intronic
1097455468 12:59793720-59793742 ACTAATAATCAATTATAGCAAGG - Intergenic
1097777679 12:63667939-63667961 CCTAGTAGGAAATAATAGCAAGG - Intronic
1097778696 12:63678312-63678334 TCTAATAAGTGATTATGGCAAGG - Intergenic
1098348334 12:69529720-69529742 CCTTATGAACACTTATAGCATGG + Intronic
1100017804 12:90032979-90033001 ACTAATAAACAATTAGAGCATGG - Intergenic
1100030500 12:90183527-90183549 ACTAATAAGCTGTTATAGCAAGG + Intergenic
1101096802 12:101350450-101350472 CCTAATAAGAAATTACAGCTGGG - Intronic
1101431822 12:104633280-104633302 CCTATTAAGCAATTAAAAGAAGG + Intronic
1105670179 13:22604856-22604878 ACCAATAAGCAATTATTGCAAGG + Intergenic
1105671397 13:22620488-22620510 ACTAATAGGCAATTACAGCAAGG - Intergenic
1105726334 13:23165904-23165926 ACTAATGAGCAATTATAGCAGGG - Intergenic
1106771660 13:32967150-32967172 AATAATAAACACTTATAGCAAGG - Intergenic
1107257312 13:38443786-38443808 ACTAATAAGCTATCACAGCAAGG - Intergenic
1108448508 13:50534813-50534835 TCTAATAAGCCAGTTTAGCAAGG - Intronic
1108998163 13:56761963-56761985 ACCAGTAATCAATTATAGCAGGG + Intergenic
1109632630 13:65071638-65071660 ATTAATAAGCAATTATAGCAAGG + Intergenic
1110111386 13:71750283-71750305 CAAAAAAAGCAATTATTGCATGG - Intronic
1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1110909282 13:80935006-80935028 ACTAATAAGGGATCATAGCAAGG - Intergenic
1111129156 13:83952161-83952183 AATAATAAGCAATTACAGTAAGG + Intergenic
1111313430 13:86519050-86519072 ACTAATAAACAATTTTACCAAGG + Intergenic
1111405572 13:87800442-87800464 CCTAATGACCATTTATAGAACGG + Intergenic
1111429363 13:88132124-88132146 ACTAATAAGCAATTACGGCAAGG + Intergenic
1111481862 13:88839615-88839637 AATAATGAGTAATTATAGCAAGG + Intergenic
1111689715 13:91548245-91548267 ACTAATAATCAATTATGGCAAGG + Intronic
1112070960 13:95849891-95849913 ACCAATAAGGGATTATAGCAAGG - Intronic
1112263422 13:97899624-97899646 TCTAATAAACAGTTATAGCTTGG - Intergenic
1112535473 13:100249923-100249945 ACTGATAAGCAATTATAGTAAGG - Intronic
1112959716 13:105108476-105108498 ACTAATAAGTAATTATAATAGGG + Intergenic
1113342803 13:109443349-109443371 GCTGATAAGCAACTTTAGCAAGG - Intergenic
1113971151 13:114190429-114190451 AGGAATAAACAATTATAGCAAGG + Intergenic
1114515663 14:23298281-23298303 CCTAATAAGAGATTATAGCAAGG + Exonic
1115064992 14:29248086-29248108 ACTAACAAACAATTTTAGCAAGG - Intergenic
1115588791 14:34842852-34842874 CCAAATAAGCAACTATCACATGG + Intronic
1115639868 14:35327546-35327568 ACTACTAAGCATTTATAGGACGG + Intergenic
1115678336 14:35707204-35707226 ACTAATAAGCAATTATAGCAAGG - Intronic
1115817939 14:37182971-37182993 ACTAATAAGTTATCATAGCAAGG + Intergenic
1116504206 14:45658696-45658718 ACAAATAAGCAATCATAGCAAGG - Intergenic
1116665764 14:47772904-47772926 GCTAATAAGCAATTATAGCAAGG + Intergenic
1116834459 14:49756763-49756785 ACTAATAAGCAATTATAGCAAGG - Intergenic
1118131624 14:62971145-62971167 ACTCATAAGTAATTATAGCAAGG + Intronic
1118268439 14:64318129-64318151 ACTAATAAACAATTACAGCAAGG + Intronic
1118428235 14:65691063-65691085 ACTAATAAGTAACTATATCAAGG - Intronic
1119010004 14:70975187-70975209 TCTAATAAGCAATTATCGGTTGG - Intronic
1119066564 14:71533841-71533863 CCTAATGAGGAATTTTATCAAGG - Intronic
1119277877 14:73376182-73376204 ATTAATAAGCAATTATAGCAAGG + Intronic
1119534210 14:75388472-75388494 ATTATTTAGCAATTATAGCAAGG + Intergenic
1120110755 14:80552758-80552780 CCTAAAAAGCAATTAGAAAAAGG - Intronic
1120837217 14:89051587-89051609 ACTAATCAGCAATTACAGCAAGG + Intergenic
1121094947 14:91210991-91211013 GCTAATAAGTGATTATAGTATGG + Intronic
1122360500 14:101158384-101158406 CATAATAAGCAATTATAGCAAGG - Intergenic
1122536678 14:102469420-102469442 CCCAATAAACAAGTTTAGCAAGG - Intronic
1202942083 14_KI270725v1_random:159757-159779 AATAATAAGCATTTACAGCATGG + Intergenic
1123795989 15:23770669-23770691 ACTAATAGGCAAATATAACAAGG - Intergenic
1123969821 15:25496930-25496952 ACTAATAAGCAATTATAACAAGG + Intergenic
1125135663 15:36338509-36338531 ATTAATAAGCAATTATAGCAAGG - Intergenic
1126291345 15:47083683-47083705 AATAATAAGCATTTACAGCATGG - Intergenic
1126346465 15:47699909-47699931 ACTAATAAGCAATTATAACAAGG + Intronic
1127150545 15:56070261-56070283 ATTAATAAGCAACTCTAGCAAGG + Intergenic
1128598892 15:68978559-68978581 ACTAATAAGCAAGTGTAGTAAGG - Intronic
1129308245 15:74684740-74684762 ACTAATAAGGAAATTTAGCAAGG + Intronic
1129374314 15:75118555-75118577 ACTAATAAGCAAATGTAGCAGGG - Intergenic
1131919291 15:97305527-97305549 ACTAATAGGCAATTATAGCAAGG - Intergenic
1132022912 15:98379620-98379642 ACTAATAAGCAATATTAGCAAGG + Intergenic
1133526160 16:6607803-6607825 CCTAATGAGCGATCATAGAATGG + Intronic
1134321074 16:13163842-13163864 ACTAATAAGTGATTTTAGCAAGG - Intronic
1135274281 16:21098063-21098085 CCAAAGAAGAAATTATAGTAAGG - Intronic
1135433861 16:22411549-22411571 ACTAATAAGCAATTATAACAAGG - Intronic
1136284396 16:29232666-29232688 CCTATTAACCAGTTATAACAAGG + Intergenic
1137473454 16:48784289-48784311 ACTAATAAGTAATTATGACAAGG - Intergenic
1137628563 16:49925028-49925050 GAAATTAAGCAATTATAGCAAGG + Intergenic
1137839107 16:51623412-51623434 GCTATTAAGAAAATATAGCAGGG - Intergenic
1138880571 16:61009213-61009235 TCTAATAAGCAATTCTAAGAGGG - Intergenic
1138906170 16:61337379-61337401 ACTAATAAACAATTTTAGTAAGG + Intergenic
1139184127 16:64784447-64784469 ACTAATAAACAATTGTAGCAAGG - Intergenic
1139309177 16:66013845-66013867 TCTTATAAGTAATTATAGCAGGG + Intergenic
1140243131 16:73222349-73222371 ACTAATAAGTGATTATAGCAAGG + Intergenic
1140616955 16:76676647-76676669 AGCAATAAGCAATTATAGAAAGG + Intergenic
1140623483 16:76764384-76764406 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1143558941 17:7680441-7680463 ACTAATAAATAAATATAGCAGGG - Intronic
1145048649 17:19640699-19640721 ACTAATAAGTGATTATAGCATGG + Intergenic
1149106764 17:52977231-52977253 GCTAGTAAGCAGGTATAGCAAGG - Intergenic
1149194754 17:54106143-54106165 ACTGATAAACGATTATAGCAAGG + Intergenic
1149929339 17:60735181-60735203 ATTGATAAGCAATTACAGCAAGG - Intronic
1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG + Intergenic
1153737537 18:8086812-8086834 CTTTTTAAGCAATTATAACAAGG + Intronic
1153751369 18:8234442-8234464 ACTAATAAGCAAATGTAGCAAGG - Intronic
1154232202 18:12567101-12567123 ACTAATAAGCAATTATAGCAAGG + Intronic
1154250865 18:12743469-12743491 CCTAAGAAACAAATATTGCAGGG - Intergenic
1155593165 18:27452148-27452170 ACTATTAAGGAATTGTAGCAAGG - Intergenic
1155904502 18:31433333-31433355 ACTAATAAGCAATTACAGGAAGG + Intergenic
1156089742 18:33452538-33452560 ACTAATAAATTATTATAGCAAGG + Intergenic
1156594500 18:38532591-38532613 ACTAATAAACAATTATAGCAAGG - Intergenic
1156652819 18:39246016-39246038 ACTTTTAAGCAATTATAGCAAGG + Intergenic
1159150369 18:64515301-64515323 CATAGAAAGCATTTATAGCAGGG - Intergenic
1159296054 18:66490296-66490318 ACAAATAAGAAAGTATAGCAAGG + Intergenic
1159515989 18:69458664-69458686 TCTGATAAACAATTTTAGCAAGG + Intronic
1160173612 18:76574760-76574782 ACTAATAAGTGATTATAGCAAGG + Intergenic
1163240001 19:16055925-16055947 ACTAATAAACAATTTTAGCAAGG - Intergenic
1164253567 19:23507271-23507293 CCTAATAAGCAGTTATCTCCTGG + Intergenic
1164474063 19:28560735-28560757 TGGAATAAGCAATTATAGTAAGG - Intergenic
1164665611 19:30032585-30032607 ACTTATAAGTGATTATAGCAAGG - Intergenic
1164815513 19:31198559-31198581 ACTAATAAATAATTATACCAAGG + Intergenic
1165284023 19:34823662-34823684 ACTAATAAGTGATTATAGTAAGG + Intergenic
1167805010 19:51775776-51775798 AGTAATAAGTGATTATAGCAGGG - Intronic
925701445 2:6642685-6642707 ACTAATAAGCAATTATAGCAAGG + Intergenic
925756311 2:7135443-7135465 CCAAATAAGCAATTCCAGGATGG - Intergenic
926835961 2:17020881-17020903 ACTAATAAATGATTATAGCAAGG - Intergenic
927673485 2:25088616-25088638 GCTATAAAGCACTTATAGCAGGG - Intronic
928369077 2:30726509-30726531 ACTAATAAACAAGTTTAGCAAGG + Intronic
928892959 2:36226690-36226712 ACTAATACACAATTATAGCCAGG + Intergenic
928934702 2:36663480-36663502 CTTTATTAGCAATTATAACATGG + Intergenic
929066962 2:37987096-37987118 GGGATTAAGCAATTATAGCAAGG + Intronic
929421764 2:41798103-41798125 ACTAATAAGGGATTATAGCAAGG - Intergenic
929767806 2:44863742-44863764 ACTAATAAGAGATGATAGCAAGG + Intergenic
930591950 2:53338301-53338323 ACTAATAAACAAGTTTAGCAAGG - Intergenic
930854946 2:56005008-56005030 GGAAATAAGCAATTATAGCACGG - Intergenic
930909098 2:56609005-56609027 ACTAATAAGCAATTGTAGCAAGG - Intergenic
930940657 2:57010548-57010570 ACTGATAAGTGATTATAGCAAGG + Intergenic
930959715 2:57246074-57246096 ACTATTAAGTTATTATAGCAAGG - Intergenic
932470854 2:71955430-71955452 ACTAATTAGCAATTATAGCAAGG - Intergenic
932936134 2:76104221-76104243 CCTAATAAGAGAAAATAGCAAGG - Intergenic
933210618 2:79564367-79564389 ACTAATACGCAGTTATATCATGG - Intronic
933571005 2:84012038-84012060 AATAATAAGCACTTATAGCAAGG + Intergenic
933872745 2:86585196-86585218 GCTAATAAGCAATTATAACAAGG + Intronic
935793794 2:106619434-106619456 CCTAACAAGTGATTATAGCAAGG - Intergenic
935853760 2:107251956-107251978 TTTGAAAAGCAATTATAGCAAGG - Intergenic
936942039 2:117894007-117894029 TATAATAAGTGATTATAGCAGGG - Intergenic
937542672 2:122978162-122978184 ACTAGTAAGCAACTATAGCAAGG + Intergenic
937805255 2:126134061-126134083 ACTAGTAAGTGATTATAGCAAGG - Intergenic
937843336 2:126549879-126549901 AGTAATAAGCAATTATCGCAAGG + Intergenic
938248039 2:129794156-129794178 GCTAATGAGCGATTAAAGCAGGG + Intergenic
938719089 2:134049302-134049324 ACTAATGGGTAATTATAGCAAGG + Intergenic
938970846 2:136430852-136430874 ATTAATAAGCAATTATGGCAAGG - Intergenic
939462074 2:142509957-142509979 CCTAACAAGCAATTGAAGCATGG + Intergenic
939910030 2:147969991-147970013 ATTGAGAAGCAATTATAGCAAGG + Intronic
940163806 2:150744964-150744986 ACCAATAAGCAATTATGGCAAGG + Intergenic
940313137 2:152300290-152300312 ACTAATAAGTAATTATATCAAGG - Intergenic
940383918 2:153048151-153048173 CCTAATAAGCAACAACAGCGTGG + Intergenic
940410169 2:153353312-153353334 ACTAATAAGAGATTATAGCAAGG - Intergenic
940776927 2:157894439-157894461 CTTAAAAAGCAACTATATCAAGG - Intronic
940879003 2:158927436-158927458 ACTAGTAAGCAATTATAGCAAGG - Intergenic
941212506 2:162658832-162658854 ACTAATAAGCAATTATAGTAAGG - Intronic
942149819 2:173063982-173064004 CCTAATTAGCATTTATCCCAAGG + Intergenic
943194851 2:184732886-184732908 ACTAATAGGCAATTACAGCAAGG - Intronic
943445762 2:187985959-187985981 CATAATAAGCAATGATACCATGG + Intergenic
943605522 2:189972844-189972866 GCTGATAAGCAACTTTAGCAAGG - Intronic
943710433 2:191088198-191088220 ACTAATAAGCCATTAGAGTAAGG + Intronic
944028979 2:195209523-195209545 ACTAATAAGTGATTATAGCAAGG - Intergenic
945021500 2:205577151-205577173 ATTAATAAGCAATTATAGCAAGG - Intronic
945153811 2:206816406-206816428 ACTAATAAACTATTATAGCAAGG - Intergenic
945583403 2:211625873-211625895 CAAAATATGCAATTATTGCATGG - Intronic
945660145 2:212675688-212675710 GCTGATAAACAATTTTAGCAAGG - Intergenic
946967976 2:225058815-225058837 AGCAATAAGTAATTATAGCAAGG - Intergenic
1169643838 20:7786963-7786985 ACTAATAAACAACTATAGCAAGG + Intergenic
1169720697 20:8673223-8673245 CCTAATAGGAAATTCTACCAGGG + Intronic
1170636562 20:18110455-18110477 ACTAAGAAGCAATTTTAACAAGG - Intergenic
1170646907 20:18205167-18205189 ATTAATAAGTGATTATAGCAAGG + Intergenic
1170772462 20:19345109-19345131 ACTAATAAGTAATTATAACAAGG + Intronic
1171384508 20:24760922-24760944 ACTAATAAGCAATTACAGCAAGG + Intergenic
1171467894 20:25344322-25344344 ACTAATTAGTGATTATAGCAAGG + Intronic
1171538004 20:25914919-25914941 AATAATAAGCATTTACAGCATGG + Intergenic
1171803144 20:29646530-29646552 AATAATAAGCATTTACAGCATGG - Intergenic
1171840936 20:30210218-30210240 AATAATAAGCATTTACAGCACGG + Intergenic
1172616648 20:36291854-36291876 ATTAATAAGCAATTATAGCAAGG - Intergenic
1172825102 20:37775725-37775747 CCTAATAAGTATTTATTGAAAGG + Intronic
1172866526 20:38103618-38103640 ACTAATAAGCAAGTTCAGCAAGG + Intronic
1173680622 20:44878057-44878079 ACTAGTAAGAAATAATAGCAAGG + Intergenic
1175519841 20:59594293-59594315 ACTAATAAATTATTATAGCAAGG - Intronic
1176581087 21:8527173-8527195 AATAATAAGCATTTACAGCATGG - Intergenic
1177221286 21:18196235-18196257 TCTAATAAGCTCTTATAACATGG + Intronic
1177348611 21:19904489-19904511 ACTAATAAGTGATTATAGCAAGG - Intergenic
1177351329 21:19945746-19945768 GCTAATAAGCAAATTCAGCAAGG - Intergenic
1177621240 21:23597345-23597367 ACTAATAAGTAATTATAGCAAGG + Intergenic
1178481539 21:32983358-32983380 GCAAATAAGCAAATATACCAAGG + Intergenic
1179956508 21:44742557-44742579 TCTCATAAGCAAATATAGCTGGG - Intergenic
1182824277 22:33250381-33250403 ACTAATAAGCAATTAGAGCAAGG - Intronic
1183614061 22:38931684-38931706 ACTAATAAGCAATTATATAAAGG - Intergenic
1184945465 22:47800528-47800550 ATTAATAAGCAATTATAGCAAGG + Intergenic
1184969833 22:48009655-48009677 ACTAATAAGCAATTATAGCAAGG - Intergenic
949196089 3:1309994-1310016 ACTAATAAGTGCTTATAGCAAGG - Intronic
949452947 3:4207206-4207228 CTTAATAAGCAAGTTTAACAAGG - Intronic
950352166 3:12366300-12366322 CCTAGTAAGTGATTATAGCAAGG - Intronic
950958994 3:17085065-17085087 TATAATGAGCAATTATGGCAGGG + Intronic
951821804 3:26822125-26822147 CCTAATAAGCAGATATAGCTAGG - Intergenic
952442947 3:33351297-33351319 ACTAATTAGCAATTATAGTAAGG + Intronic
952635958 3:35531512-35531534 ACTAATAAGCATTTATAGCAAGG + Intergenic
952640272 3:35585654-35585676 ACTAATAGGCAATTGTAGCAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953873818 3:46652380-46652402 ACTACTAAGCAATTATAGCAAGG + Intergenic
954087221 3:48254828-48254850 ACTAATAAGCAAACATAGAAAGG - Intronic
954530855 3:51318915-51318937 ACTAATAAGTAAATTTAGCAAGG - Intronic
954879850 3:53826871-53826893 ACTAATAAGCAATTATAGCAAGG + Intronic
954893004 3:53948821-53948843 ACTAATAAACAAATATAGTAAGG + Intergenic
957331885 3:78776055-78776077 AAAAATAAGCAAATATAGCATGG - Intronic
957400450 3:79706022-79706044 ACTAATAAGCAATTATAGGCAGG - Intronic
957499867 3:81040967-81040989 TCTAACAAGCAATTATATTATGG - Intergenic
957594721 3:82248133-82248155 ACTAATAAGTAAGTTTAGCAAGG - Intergenic
958001719 3:87759054-87759076 ACAACTAAGCAATTATAGTAAGG + Intergenic
958443744 3:94189396-94189418 ACTAACAAGCAATTATAACAAGG - Intergenic
958704584 3:97639058-97639080 TCTACAAAGCAAATATAGCAAGG - Intronic
959046619 3:101481884-101481906 ACCAATAAGCAATTACAGCGAGG + Intronic
959168822 3:102818753-102818775 ACTAATGAACTATTATAGCAAGG - Intergenic
959660464 3:108862734-108862756 CCTAACAAGCTATTATAAGAAGG + Intergenic
959852320 3:111103490-111103512 GCTAATAATCAATTACAGCAAGG - Intronic
960020349 3:112944771-112944793 ACTAATAAGAAATTGCAGCAAGG + Intronic
960597769 3:119422146-119422168 CTCTATAAGCAATTATGGCAAGG - Intergenic
960893265 3:122473984-122474006 ACTAATAAGCAATTATAGCAAGG + Intronic
961025745 3:123555376-123555398 ACTAATAAGCAAGTATAGCAAGG + Intronic
961407962 3:126696202-126696224 GCTAATAAGCAAGTTGAGCAAGG - Intergenic
962516702 3:136158745-136158767 ACCAATAAGCAAATTTAGCAAGG + Intronic
962563756 3:136635753-136635775 ACTAATAAGCTATTATAGCAAGG + Intronic
962697472 3:137964478-137964500 TGAAATAAGCAATGATAGCATGG + Intergenic
962803173 3:138907630-138907652 ACTAATAAATAAATATAGCAAGG - Intergenic
963153067 3:142067251-142067273 ACTGATAAGCAATGACAGCAAGG + Intronic
963330304 3:143906963-143906985 ACTAATAAGCAATTATAGCAAGG - Intergenic
963656062 3:148052051-148052073 ACTAATAAGCAATTATTGTAAGG + Intergenic
963686632 3:148443318-148443340 ACTAGTAAGTGATTATAGCAAGG + Intergenic
963731575 3:148979310-148979332 ACTAATAAGCAATTATAGCAAGG - Intergenic
964264845 3:154883532-154883554 ACTACTAAGCAATTTTAGCAAGG + Intergenic
964267673 3:154918160-154918182 TCTAATAAGCAATTGTAGAAAGG + Intergenic
965054150 3:163693135-163693157 CCAAGTAGTCAATTATAGCAAGG - Intergenic
965131863 3:164711063-164711085 CCTAAGAATCAATTTAAGCAAGG + Intergenic
965451389 3:168842815-168842837 ACTAATAAGTAACTTTAGCAAGG + Intergenic
965458822 3:168935457-168935479 ACTAACAAGCAAATATAGCCAGG + Intergenic
965460996 3:168963143-168963165 AATAATAAGCAATTATATTAAGG - Intergenic
966464866 3:180219299-180219321 ACTAATAAACAATTATAGCAAGG + Intergenic
966545794 3:181146150-181146172 ACTGATAAGCAATTTTAGCAAGG + Intergenic
967430383 3:189377885-189377907 ACAAATAAGCAATTATATCAAGG - Intergenic
967476117 3:189921559-189921581 ACTAAGAAGCAAGTATAGAAAGG + Intergenic
967547955 3:190753974-190753996 ACTGATAAGCAATTATAGCAAGG - Intergenic
967668664 3:192205743-192205765 TCCCATAATCAATTATAGCAGGG - Intronic
967872355 3:194241987-194242009 TCTAATAAGCAATTATAGCAAGG + Intergenic
968290714 3:197537382-197537404 ACTAATAAGTAAGTTTAGCAGGG - Intronic
970545010 4:17119718-17119740 ACTAAAAAGCAATGATAGCAAGG + Intergenic
970721996 4:18998643-18998665 ATTAATAAATAATTATAGCAAGG - Intergenic
971821584 4:31563486-31563508 ATTAATAAGCAATTATAGAAAGG + Intergenic
971991618 4:33904836-33904858 ACCAATAAGCAATTATAGCATGG + Intergenic
972470617 4:39400359-39400381 ACTAATAAGTGATTACAGCAAGG - Intergenic
973313764 4:48738234-48738256 ACCAATAAACAATTATAACAAGG + Intronic
974561138 4:63520786-63520808 ACTAATAAGTGATTATAGCAAGG + Intergenic
974744262 4:66050278-66050300 TGCAATAAACAATTATAGCAGGG + Intergenic
974752167 4:66155253-66155275 CATAATAAGCCTTCATAGCATGG - Intergenic
974854893 4:67449060-67449082 ACTAATAAGCAATTACAGCAAGG + Intergenic
974971182 4:68830032-68830054 CCTAAAAAGGAATTTTATCATGG - Intronic
974984571 4:69005680-69005702 CCTAAAAAGGAATTTTATCATGG + Intronic
974999347 4:69201263-69201285 CCTAAAAAGGAATTTTATCAAGG + Intronic
975006436 4:69293965-69293987 CCTAAAAAGGAATTTTATCATGG - Intronic
975016100 4:69422322-69422344 CCTAAAAAGGAATTTTATCATGG - Intronic
976060348 4:81120655-81120677 ACTAAAAAGCACTTACAGCAAGG - Intronic
976211279 4:82673296-82673318 ACTAATAAGCTATTACAACAAGG + Intronic
976254727 4:83088157-83088179 ACTAATAAGCAGTTATGGCAAGG + Intergenic
977374874 4:96189694-96189716 ACTAATGGGCTATTATAGCAAGG - Intergenic
977377972 4:96232515-96232537 ACTAATAAGCAAATATAGGAAGG + Intergenic
977616563 4:99093410-99093432 ACTAATAAGTGATTATAGCAGGG + Intergenic
977659647 4:99568289-99568311 ACTAATAAGCAATTATAGTAAGG + Intronic
978213533 4:106168617-106168639 GCTAATAAGTAACTACAGCAAGG + Intronic
978255822 4:106691833-106691855 CCTAATCTGCCATTAAAGCAGGG + Intergenic
978346008 4:107770187-107770209 ACTAATAAACAATTATAGTAAGG + Intergenic
978481881 4:109201764-109201786 ACTAATAAGCAATTATGGCAAGG + Intronic
979071334 4:116211085-116211107 ACTAATAAGAAATTATAGCAAGG - Intergenic
979406655 4:120319896-120319918 CCCCATAAGTAATTATATCATGG + Intergenic
979647123 4:123083017-123083039 TCTAATAAGCAATTATAGCAAGG - Intronic
979903341 4:126251973-126251995 ACTAGTAAGCAATTATAACATGG + Intergenic
980176373 4:129350445-129350467 CCTACTAATCAATAATACCATGG - Intergenic
981324574 4:143431222-143431244 CCTAATAAACAGTTATAACTGGG + Intronic
982146433 4:152399585-152399607 AAAAAAAAGCAATTATAGCAAGG + Intronic
982286022 4:153735851-153735873 AATAATAAGTGATTATAGCAAGG - Intronic
982588803 4:157277655-157277677 ACTAATAAATAATTATGGCAAGG + Intronic
982666163 4:158266538-158266560 ATTAATAAGTGATTATAGCAAGG - Intergenic
982799187 4:159681838-159681860 ACTAATAAGTAATTACAGCAAGG + Intergenic
982861471 4:160455947-160455969 ACTAATAAGCAATTATAACAAGG - Intergenic
982885342 4:160773133-160773155 CCTAATAAGCAATGAGAGACAGG + Intergenic
983325287 4:166247056-166247078 CAAAATAACCAATAATAGCATGG + Intergenic
983579737 4:169296147-169296169 ACTACTAAGTGATTATAGCAAGG + Intergenic
984102717 4:175504926-175504948 ACTAATAAGCTATTATAGCAAGG + Intergenic
984754013 4:183308008-183308030 ACTAATAAGTGATTATAACAAGG + Intronic
985193599 4:187404265-187404287 GCTAATAAGCAACTTCAGCAAGG - Intergenic
986035808 5:3936792-3936814 GCTAATGAAGAATTATAGCAAGG - Intergenic
986251657 5:6064269-6064291 ACAAATAAGCCAATATAGCAGGG + Intergenic
986515390 5:8556907-8556929 ACTAATAAATAAATATAGCAAGG - Intergenic
986973450 5:13365673-13365695 ATTAATAAGCAATTATAGCAAGG + Intergenic
986991696 5:13561045-13561067 ACTAATAAGTAAATATAGCAAGG + Intergenic
987539361 5:19234415-19234437 CTTAAAAGGCAATTATGGCAAGG + Intergenic
987839310 5:23201973-23201995 ACTAATATGCAATTATAGCAAGG + Intergenic
987997274 5:25300203-25300225 ACTAGCAAACAATTATAGCAAGG - Intergenic
988094595 5:26588001-26588023 GCTAATAAGTGATTATAGCAAGG - Intergenic
988445925 5:31286140-31286162 ACTAATAGTCAATGATAGCAAGG - Intronic
988635084 5:32974662-32974684 ACTAATAAGCAATTATAGTAAGG - Intergenic
988711673 5:33784475-33784497 CATAACAAGCAAATTTAGCAAGG + Intronic
989490353 5:42045065-42045087 ACTGATAAGTCATTATAGCAAGG + Intergenic
989515244 5:42336005-42336027 ACTAATCAACCATTATAGCAAGG + Intergenic
990066614 5:51723813-51723835 ACTAATAAGAAATTAAAGCAAGG - Intergenic
990244985 5:53855455-53855477 ACTAATAAGTGATTATAGCAAGG + Intergenic
990379018 5:55203347-55203369 ACCAATAAACAATTATAGCAAGG + Intergenic
991119160 5:62991368-62991390 ACTAATAAGCAATTACAGCCAGG - Intergenic
991257092 5:64626579-64626601 TCTAATAAGTAAATTTAGCAAGG + Intergenic
991619214 5:68528020-68528042 ACTAATAAGCAATTAGAGCAAGG - Intergenic
992482120 5:77162061-77162083 ACTAATAAGTAAATTTAGCAAGG + Intergenic
993467018 5:88261057-88261079 ACCAATAAGCAATTATAGCAAGG + Intronic
994601610 5:101912470-101912492 GCTGATAAACAATTTTAGCAAGG - Intergenic
994925341 5:106110573-106110595 CCTAATAAGTGAGCATAGCAAGG - Intergenic
995064815 5:107848512-107848534 ACTAATAAGTAAATTTAGCAAGG + Intergenic
995112929 5:108447329-108447351 ACTAATAAGCAATTATAGCAGGG + Intergenic
995637934 5:114216891-114216913 ACTAATAAGCAATTATAGCAAGG + Intergenic
995656288 5:114430469-114430491 ACTAATAAGTAAGTATTGCAAGG - Intronic
995735024 5:115290841-115290863 ACTAATAAACAAGTACAGCAAGG - Intronic
995950845 5:117711645-117711667 AGTAATAAGCAATTATAGCAAGG - Intergenic
995982733 5:118125071-118125093 ACTAATAAACAATTTCAGCAAGG + Intergenic
996546871 5:124688919-124688941 ACTACTAAGAAATTATAGCAAGG + Intronic
997857564 5:137386010-137386032 GCTAATAAGCAATTACAGCAAGG + Intronic
998962112 5:147499278-147499300 ACTAGTAAGTGATTATAGCAAGG + Intronic
998975294 5:147638735-147638757 CCTAGGAGGCAATTATAGCCTGG + Intronic
999037591 5:148370491-148370513 CCCTATAAGCAATTATATCTTGG - Intergenic
1000054155 5:157589345-157589367 ATTAATATGTAATTATAGCAAGG - Intergenic
1000123861 5:158224618-158224640 CTTAATAAACAATTATTGAATGG + Intergenic
1000493137 5:161940825-161940847 TTTAATAAGCTATTATAGCATGG - Intergenic
1000542957 5:162563580-162563602 ACTAATAAACAATAATAGGAAGG + Intergenic
1001499709 5:172220898-172220920 CCTAATAAGCAATTATAGCAAGG + Intronic
1001538508 5:172518741-172518763 ACTAATAAGCAATTATACCAAGG + Intergenic
1001987995 5:176092127-176092149 CCTAGCAAGAAATTATACCAGGG - Intronic
1001989192 5:176102155-176102177 CCTAGCAAGAAATTATACCAGGG - Intronic
1001990173 5:176110042-176110064 CCTAGCAAGAAATTATACCAGGG - Intronic
1002226698 5:177728097-177728119 CCTAGCAAGAAATTATACCAGGG + Intronic
1002227678 5:177735983-177736005 CCTAGCAAGAAATTATACCAGGG + Intronic
1002228873 5:177746013-177746035 CCTAGCAAGAAATTATACCAGGG + Intronic
1002266473 5:178037770-178037792 CCTAGCAAGAAATTATACCAGGG - Intronic
1002267141 5:178043115-178043137 CCTAGCAAGAAATTATACCAGGG - Intronic
1002892190 6:1344618-1344640 ACTAATAAACAATTACAGCAAGG + Intergenic
1002993736 6:2263182-2263204 CCTTATAAGTAATTATGGCAAGG - Intergenic
1003364835 6:5463322-5463344 ACTAATAAACAACTTTAGCAAGG - Intronic
1003854333 6:10257128-10257150 ACTAATAAGCAATTATAACAAGG + Intergenic
1004033436 6:11896566-11896588 ACTAAAAAGCTATTATAGCAAGG - Intergenic
1004213421 6:13677141-13677163 AAAAATAAGCAATCATAGCAAGG + Intronic
1005210979 6:23462635-23462657 ACTAATAAGCAAGTATAGCAAGG + Intergenic
1005222672 6:23605879-23605901 AATAATAAACAATTATAACAAGG + Intergenic
1005246978 6:23898168-23898190 ACTAATAAGCAATTATAGTAAGG - Intergenic
1005363954 6:25059069-25059091 ACTAATAAGCAGTTACAGCAGGG + Intergenic
1005774141 6:29111615-29111637 CCTAATTAACAAATATAGAAGGG - Intergenic
1006074361 6:31521043-31521065 ACTAACAAGCAATTATAGCAAGG + Intergenic
1008073839 6:47125421-47125443 ATTGATAAGCAATTATAGCAAGG - Intergenic
1008235517 6:49042900-49042922 TCTAATATGCAATTATTGCAAGG - Intergenic
1008744419 6:54652031-54652053 ACTAATAAATGATTATAGCAAGG - Intergenic
1008751677 6:54741333-54741355 TCTAATATACAATTATAACAAGG - Intergenic
1008948267 6:57123878-57123900 ACTAATAAGCAATTATAGCAAGG - Intronic
1009403731 6:63287756-63287778 CATAATAAGCAATTATACATAGG + Intronic
1009516778 6:64629738-64629760 CCTAATAAGCTAGTGTAACAAGG - Intronic
1009873618 6:69478370-69478392 ATTAATATGCAATTATAGCAAGG + Intergenic
1010806378 6:80241836-80241858 CCTCATTAGCAATTACAGAAAGG - Intronic
1010811317 6:80302279-80302301 ACTGATAAACAATTTTAGCAAGG + Intronic
1011081471 6:83494571-83494593 ACAAATAAGCAATTACAGCAAGG - Intergenic
1011094672 6:83647048-83647070 ACTAATAAGCAATTATAGCAAGG - Intronic
1011257702 6:85440525-85440547 ATTAGCAAGCAATTATAGCAGGG - Intergenic
1011265256 6:85511276-85511298 AATAATAAGCAATTTTACCAGGG - Intronic
1011577609 6:88820557-88820579 ACTAATAAGCAATTATAGCCAGG + Intronic
1012025263 6:93981758-93981780 CCTAATAACCAATGTTATCATGG - Intergenic
1012369986 6:98492278-98492300 GTTAATAAGCAATTTTAGTAAGG + Intergenic
1012707459 6:102550227-102550249 CCTAATAACAAAATATATCATGG + Intergenic
1012735639 6:102938290-102938312 ACTAATAAGTGATTATACCAAGG - Intergenic
1012891749 6:104904871-104904893 ACTAATAAGCAATTATAGCAAGG - Intergenic
1013306965 6:108857377-108857399 ACTAATAAGTGATTATAGTAGGG - Intronic
1013404076 6:109827002-109827024 CATAATAAGCCAGTAGAGCAGGG - Intergenic
1013440632 6:110163018-110163040 ACTAGTAAGCAATTACAGCATGG + Intronic
1014228427 6:118874717-118874739 ACTAATAAGTGATTATAGCAAGG + Intronic
1014784627 6:125604168-125604190 ACTAATAAGCAATAGTAGCAAGG + Intergenic
1015314341 6:131801047-131801069 ACTAATAAGCAAGTTTAGCAAGG + Intergenic
1015768237 6:136741774-136741796 ATTAATAAGCAATTATAGCAGGG + Intronic
1016601762 6:145870205-145870227 ACTAATAAGAGATTATAGAAAGG - Intronic
1016726768 6:147379771-147379793 GCTAATAAACAGTTTTAGCAAGG + Intronic
1017397689 6:154021808-154021830 GCTAATAAGCAATTATAACAAGG - Intronic
1017621242 6:156300918-156300940 ACTTATAAGAAATTATAGCAAGG + Intergenic
1018264031 6:162001511-162001533 ACTAGTTAGTAATTATAGCAAGG - Intronic
1018526726 6:164718991-164719013 ACTAATAAGCAATTATGGCAAGG + Intergenic
1018550111 6:164986827-164986849 ACTAGCAAGCAAGTATAGCAAGG - Intergenic
1020075661 7:5256910-5256932 ACTAATAAGCGATTATAGCAAGG + Intergenic
1020587917 7:10094354-10094376 ACTAATAAGCAATTACTACAAGG - Intergenic
1020698636 7:11448688-11448710 CATAACTAGCAATTTTAGCAAGG + Intronic
1020849693 7:13336499-13336521 CATTATAAGCAATTCTGGCAGGG + Intergenic
1020969538 7:14918386-14918408 ACTAATAAACAAATGTAGCAAGG + Intronic
1021341776 7:19472943-19472965 ACTAATGAGCAATTATAGCAAGG + Intergenic
1021349028 7:19567010-19567032 CTTAACAAGTAATTACAGCAAGG - Intergenic
1021353480 7:19625243-19625265 ACTAATAAGCTATTATAGAATGG + Intergenic
1022420655 7:30219556-30219578 ACTAATAAGTGATGATAGCAAGG + Intergenic
1022936611 7:35185602-35185624 CCTAGTAGGAAATAATAGCAAGG - Intergenic
1022937627 7:35195978-35196000 TCTAATAAGTGATTATGGCAAGG - Intergenic
1023096479 7:36665399-36665421 ACTAATAAGCAATTATAGCAAGG - Intronic
1023434083 7:40124362-40124384 ACTAATAAGTGATTACAGCAAGG - Intergenic
1023524734 7:41088495-41088517 ACTAATCAACAATTATAGTAAGG - Intergenic
1023597050 7:41841190-41841212 ACTAATAAGCAATTATAGCAAGG - Intergenic
1023878178 7:44303033-44303055 ACTAATAAATGATTATAGCAAGG + Intronic
1023962635 7:44939811-44939833 GCTAATAAACAATTATAGCAAGG + Intergenic
1024019783 7:45357260-45357282 ACTAATAAGCAGTTATAGTAAGG + Intergenic
1024062083 7:45705835-45705857 ACTAAGAAGCAATTATAGTAAGG + Intronic
1024099897 7:46019650-46019672 ACTAATAACCAAGTTTAGCAAGG + Intergenic
1024768823 7:52693843-52693865 CCTAATAAGAATTTAAAGGAAGG - Intergenic
1024789782 7:52951619-52951641 AATAAAAAGCAATTATAACAAGG + Intergenic
1024793061 7:52988727-52988749 ACTTATAAGTGATTATAGCAAGG + Intergenic
1025203412 7:56976644-56976666 ACTAATAAGCGATTATAGCAAGG - Intergenic
1025289454 7:57701723-57701745 AATAATAAGCATTTACAGCATGG + Intergenic
1025668532 7:63600283-63600305 ACTAATAAGCGATTATAGCAAGG + Intergenic
1026080468 7:67214357-67214379 ACTAACAAGTGATTATAGCAAGG - Intronic
1026277062 7:68889267-68889289 CCTATTAAGCAATTATGACAGGG - Intergenic
1026599471 7:71764769-71764791 GCTAATAAATGATTATAGCAAGG - Intergenic
1027821521 7:83051337-83051359 AATAATAAGTGATTATAGCAAGG + Intronic
1028063964 7:86358008-86358030 AATAGTAAGCAAATATAGCAAGG + Intergenic
1028372501 7:90109618-90109640 TCTAATAAGTGATTATGGCAAGG + Intergenic
1028778134 7:94703727-94703749 ACTAATAAACAATTATAATAAGG + Intergenic
1028805176 7:95018000-95018022 CATAATAAGCTATTGTTGCATGG - Intronic
1028816289 7:95149503-95149525 ATTGATAAGCAATTATAGCAAGG + Intronic
1028926638 7:96364385-96364407 ACTAATAAGCCATTATAACCAGG - Intergenic
1029832845 7:103279715-103279737 CCTAGTAGGAAATAATAGCAAGG - Intergenic
1029833790 7:103288624-103288646 TCTAATAAGTGATTATGGCAAGG - Intergenic
1030423535 7:109340770-109340792 ACTAATTAACAATGATAGCAAGG - Intergenic
1030834919 7:114271139-114271161 ACTAATAAGTAATTACAGCAAGG - Intronic
1031203520 7:118723040-118723062 ACTAATTAGCAATTGTTGCAAGG - Intergenic
1031218353 7:118928031-118928053 AGTAATAAGAAAGTATAGCAAGG + Intergenic
1031616351 7:123886065-123886087 ATTAATAAACAATTATAGCCGGG + Intergenic
1032178608 7:129655299-129655321 ACTAGTAAGTAATTACAGCAAGG - Intronic
1035440693 7:158895983-158896005 AATAATAAGCAATTACAGCAAGG - Intronic
1035450697 7:158975116-158975138 ACTAATAAGCAATTATAGCAAGG + Intergenic
1035595793 8:856506-856528 ACTAATAAACAGTTTTAGCAGGG + Intergenic
1035612325 8:975975-975997 ACCAATAAACAATTATAGCAAGG + Intergenic
1035992979 8:4512564-4512586 ACTAATAAGCAATTATAGCAGGG + Intronic
1036580398 8:10069134-10069156 ACTAATAAGAAATTACAGCAAGG - Intronic
1036737903 8:11335199-11335221 ACTAATAAACAGTTATAGCAAGG + Intergenic
1037016939 8:13919691-13919713 ACTAATAAGCAATTATAGAAAGG - Intergenic
1037105358 8:15100231-15100253 ACTGTTAAGTAATTATAGCAAGG + Intronic
1038752526 8:30309453-30309475 ACTGATAAGTAACTATAGCAAGG - Intergenic
1039140906 8:34386767-34386789 ACTAGTAAGCAACTATAGTAAGG + Intergenic
1039624446 8:39033280-39033302 ACTAAAAAGCAATTACAGTAAGG - Intronic
1040611447 8:48987176-48987198 ACTAATCAGCAATTATAGCAAGG - Intergenic
1040821610 8:51564850-51564872 ACTAATAAGTGATTATAACAAGG - Intronic
1041305679 8:56455960-56455982 ACTAATAAGCAATTATAGCAGGG + Intergenic
1041392326 8:57358199-57358221 CCTAATAAGTAATTAGTCCAGGG - Intergenic
1041613309 8:59876460-59876482 ACTTATAGGCAATTATAACAAGG + Intergenic
1041879131 8:62727476-62727498 ACTAATAAACAATTATAACAAGG + Intronic
1042053893 8:64741633-64741655 ACAAATAATCAATTATAGCAAGG + Intronic
1042076814 8:65005337-65005359 ACTAATAAGAAATTATAGCAAGG + Intergenic
1042366643 8:67944645-67944667 ACTAATGAGTAATTACAGCAAGG + Intergenic
1042383325 8:68144548-68144570 ACTAATAAGCAATTATAGCTAGG - Intronic
1042779380 8:72473832-72473854 ACAAATAAGCTATTATAGTAAGG + Intergenic
1043144555 8:76636689-76636711 ACTAATAAGCAATTATAGGAAGG + Intergenic
1043343993 8:79277508-79277530 ACTAACAAACAATTCTAGCAAGG + Intergenic
1043425546 8:80144925-80144947 CCTAATAAGCCCTTATATCCTGG + Intronic
1043626213 8:82262268-82262290 ACTAATAACTGATTATAGCAAGG - Intergenic
1043648227 8:82550645-82550667 CCTGATAAACAATTATAGACAGG - Intergenic
1044050504 8:87496726-87496748 ACTAATAAGCTATTATAACAAGG - Intronic
1045400749 8:101814736-101814758 ACTAATAAGGGATTATAGCAAGG + Intronic
1045577012 8:103433949-103433971 TCTAATAAGCTATTTTAGCAAGG + Intronic
1046084063 8:109410010-109410032 CCTAATAAGAATTTATATAATGG + Intronic
1046502002 8:115089809-115089831 ACTAATAAGCAAATATAGCAAGG - Intergenic
1046825191 8:118682253-118682275 ACTAATAAGCAAGTTTAGCAAGG - Intergenic
1047218192 8:122896199-122896221 CCTAGTAAGGAACTATAGGAAGG - Intronic
1047651146 8:126923613-126923635 ATGAATAAGCAGTTATAGCAAGG - Intergenic
1050246181 9:3692885-3692907 CCTAAGAAGGAAGAATAGCATGG - Intergenic
1050327552 9:4511850-4511872 ACTAATAAGTGATTTTAGCAGGG + Intronic
1050452289 9:5795863-5795885 TCTAATAAGTGATTATAGCAAGG + Intronic
1050753218 9:8965917-8965939 ACTGATAAACAATTTTAGCAAGG + Intronic
1050854477 9:10334694-10334716 ACTAATCAGCCGTTATAGCAAGG + Intronic
1051116432 9:13699367-13699389 ACTAATAAGCAATTATGGAAAGG - Intergenic
1052007389 9:23364686-23364708 ACTAATAAATAATTTTAGCAAGG + Intergenic
1052257106 9:26470463-26470485 CTGAATAAGCAATAATAGAATGG - Intergenic
1052582436 9:30375589-30375611 AATAATAAGTGATTATAGCAAGG + Intergenic
1052639762 9:31151947-31151969 ACTAAAAGGCAATTATAACAAGG + Intergenic
1055015344 9:71611129-71611151 ACTAGTAAGCAATTATAGCAAGG + Intergenic
1055448494 9:76407983-76408005 ACTAATAAATAAGTATAGCAAGG - Intergenic
1055746529 9:79452279-79452301 ACTAATAAACAAATATAGCAAGG - Intergenic
1055837591 9:80462335-80462357 ACTAATAAACATTTATAGCAAGG + Intergenic
1056857716 9:90149582-90149604 AATAAGAAGCAATTATAGCAAGG - Intergenic
1056996553 9:91467478-91467500 ACTAATAAGTGATTATAGCAAGG - Intergenic
1058205023 9:102093960-102093982 ACTAATAAGCAAGTATACCAAGG + Intergenic
1059488595 9:114647612-114647634 ACTAATAAGAGATTATAGCAAGG - Intergenic
1060162493 9:121378333-121378355 GCTAATAAGCAATGATAACAAGG + Intergenic
1203611101 Un_KI270749v1:5217-5239 AATAATAAGCATTTACAGCATGG - Intergenic
1186033306 X:5393097-5393119 GCTGATAAGAAATTAAAGCAAGG - Intergenic
1187351875 X:18526298-18526320 ACTACTAAACAATTACAGCAAGG - Intronic
1187736488 X:22310059-22310081 ACTAATAAGCAATTAAAGCAAGG - Intergenic
1187800517 X:23057286-23057308 ACTAATAAGCTATTATAGCAAGG - Intergenic
1188032160 X:25276222-25276244 CCTAATACGTAAATATAGAAAGG + Intergenic
1188601164 X:31966234-31966256 CCTAACAATTAATTATAGAAGGG - Intronic
1188740792 X:33778200-33778222 ACTAATAAACAATCATGGCAAGG - Intergenic
1188766512 X:34099440-34099462 ACTAATGAGCAATTTTAGCAAGG + Intergenic
1189574244 X:42334095-42334117 AGTAATAAGCAAGTATAGCAAGG - Intergenic
1189932343 X:46026701-46026723 ACTAATAAGTGAGTATAGCAAGG - Intergenic
1190008807 X:46764837-46764859 CCAAATAAGCGAGTTTAGCAAGG + Intergenic
1190547128 X:51539771-51539793 ACTAATAAGCAATTATAACGAGG - Intergenic
1190551763 X:51589586-51589608 ACTAATAAGCAATTATAGCAAGG + Intergenic
1190749587 X:53349915-53349937 ACTAATAAGCAATTATAGCAAGG + Intergenic
1191159718 X:57316030-57316052 ACTGATAAACAATTTTAGCAAGG + Intronic
1191684354 X:63874001-63874023 ACTAATAAGTGATTATAGCAGGG + Intergenic
1191923545 X:66283634-66283656 ACTAGAAGGCAATTATAGCAAGG + Intergenic
1192187299 X:68957749-68957771 CCTAGCAAACAATTTTAGCAAGG + Intergenic
1192600395 X:72457484-72457506 GCTAATAAGTAAATTTAGCAAGG + Intronic
1192759641 X:74083681-74083703 ACTAATAAGCAAGTTTAACAAGG + Intergenic
1192862516 X:75091708-75091730 ACTAAAAAGCAATTACAGCAAGG + Intronic
1192898054 X:75465084-75465106 GCTAATAAGCAACTTCAGCAAGG + Intronic
1193623314 X:83784455-83784477 ACTACTAAGCTATTATAGCAAGG + Intergenic
1193864120 X:86708414-86708436 ACTAATAAGAGATTATAGTAAGG + Intronic
1194060735 X:89194079-89194101 ATTAATAAGCAAGTGTAGCAAGG - Intergenic
1194171539 X:90590303-90590325 ACTAATAAGCAATTAAAATAAGG - Intergenic
1194184341 X:90754641-90754663 ACTAATAATCAATTATAGCAAGG + Intergenic
1194205996 X:91012078-91012100 CCTGATTAGTGATTATAGCAAGG - Intergenic
1194369367 X:93052588-93052610 ACTAATAAGCAATTATAGCCAGG - Intergenic
1194542933 X:95196946-95196968 ACTAATAAGCAATTATAGCAAGG - Intergenic
1194632852 X:96307707-96307729 ACTAATAAACGATTATAGCAAGG + Intergenic
1195028557 X:100903364-100903386 ACTAATAAACAATTATAGCAGGG + Intergenic
1195826623 X:109008803-109008825 ACTAATAAGAGATTATAGCAAGG + Intergenic
1195846481 X:109234622-109234644 ACTAATAAGTAAATTTAGCAAGG + Intergenic
1195898005 X:109768363-109768385 ACTAATAAACAATTATAGCAAGG + Intergenic
1195974059 X:110506313-110506335 ACTAATAAATGATTATAGCAAGG + Intergenic
1196000546 X:110780035-110780057 ACTAATAAGTGATTATTGCAAGG - Intronic
1196313212 X:114193332-114193354 ACTAATAAGCAATTATAGCAAGG + Intergenic
1196568525 X:117237700-117237722 AGTAATAAGCAAGTTTAGCAAGG - Intergenic
1197030794 X:121812107-121812129 ACTCATAAGAGATTATAGCAAGG - Intergenic
1197071496 X:122303545-122303567 ACAAATAAGTGATTATAGCAAGG - Intergenic
1197539430 X:127738295-127738317 ACTAAAAAGCAAATATAGAAAGG + Intergenic
1198384033 X:136110912-136110934 ACTAATAAGCAAATTAAGCAAGG - Intergenic
1198622925 X:138534029-138534051 CCTAAGAAGCAAGCAAAGCATGG + Intergenic
1199062141 X:143370065-143370087 ACTCATAACCAATTACAGCAAGG + Intergenic
1199276532 X:145950429-145950451 CCTAAAAAGAAATTATAGAAAGG + Intergenic
1199292125 X:146116374-146116396 ACTAATAAGCAATTATAACAAGG - Intergenic
1199702630 X:150394787-150394809 ACCAATAAGTCATTATAGCAAGG - Intronic
1200128012 X:153826361-153826383 CTTAATAAACAATTTTAGTAAGG + Intronic
1200328475 X:155267828-155267850 ACTAATAAGCAAGTTCAGCAAGG - Intergenic
1200517771 Y:4168052-4168074 ACTAATAAGCAATTAAAATAAGG - Intergenic
1200530932 Y:4336566-4336588 ACTAATAATCAATTATAGCAAGG + Intergenic
1200551754 Y:4586886-4586908 CCTGATTAGTGATTATAGCAAGG - Intergenic
1200677557 Y:6168815-6168837 ACTAATAAACAATTGTAGCAAGG - Intergenic