ID: 1001501739

View in Genome Browser
Species Human (GRCh38)
Location 5:172242009-172242031
Sequence GGGCACCAAGCCATTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4389
Summary {0: 151, 1: 509, 2: 875, 3: 1153, 4: 1701}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001501739_1001501741 -7 Left 1001501739 5:172242009-172242031 CCCTCATGAATGGCTTGGTGCCC 0: 151
1: 509
2: 875
3: 1153
4: 1701
Right 1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001501739 Original CRISPR GGGCACCAAGCCATTCATGA GGG (reversed) Intronic
Too many off-targets to display for this crispr