ID: 1001501740

View in Genome Browser
Species Human (GRCh38)
Location 5:172242010-172242032
Sequence AGGGCACCAAGCCATTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4256
Summary {0: 159, 1: 460, 2: 896, 3: 1135, 4: 1606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001501740_1001501741 -8 Left 1001501740 5:172242010-172242032 CCTCATGAATGGCTTGGTGCCCT 0: 159
1: 460
2: 896
3: 1135
4: 1606
Right 1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001501740 Original CRISPR AGGGCACCAAGCCATTCATG AGG (reversed) Intronic
Too many off-targets to display for this crispr