ID: 1001501741

View in Genome Browser
Species Human (GRCh38)
Location 5:172242025-172242047
Sequence GGTGCCCTTCCCATGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001501739_1001501741 -7 Left 1001501739 5:172242009-172242031 CCCTCATGAATGGCTTGGTGCCC 0: 151
1: 509
2: 875
3: 1153
4: 1701
Right 1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG No data
1001501740_1001501741 -8 Left 1001501740 5:172242010-172242032 CCTCATGAATGGCTTGGTGCCCT 0: 159
1: 460
2: 896
3: 1135
4: 1606
Right 1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG No data
1001501736_1001501741 12 Left 1001501736 5:172241990-172242012 CCTGGGCAACAGAGGAAGACCCT 0: 74
1: 4822
2: 27881
3: 88195
4: 176046
Right 1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001501741 Original CRISPR GGTGCCCTTCCCATGAGATC TGG Intronic
No off target data available for this crispr