ID: 1001506378

View in Genome Browser
Species Human (GRCh38)
Location 5:172283734-172283756
Sequence CTCGGCGGTGGCGCCGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 563}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001506378_1001506387 14 Left 1001506378 5:172283734-172283756 CCTCCTCCGGCGCCACCGCCGAG 0: 1
1: 0
2: 3
3: 44
4: 563
Right 1001506387 5:172283771-172283793 GCCGCTCCGCTCGCCCGCCGCGG 0: 1
1: 0
2: 2
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001506378 Original CRISPR CTCGGCGGTGGCGCCGGAGG AGG (reversed) Exonic
900357365 1:2271301-2271323 CTCGGTGGGGGAGCCGCAGGGGG + Intronic
900414672 1:2529505-2529527 CGCGGCGGCGGCGGCGGCGGTGG + Exonic
902137840 1:14326194-14326216 CTCGGCGGTGGGGCGGGGGTAGG - Intergenic
902994487 1:20213105-20213127 CACAGCGGAGGCGCCGGAGGCGG + Intergenic
903115633 1:21176588-21176610 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
903263427 1:22143137-22143159 GGCGGCGGCGGCGGCGGAGGCGG + Intronic
903455429 1:23484004-23484026 GGCGGCGCTGGCGCGGGAGGAGG - Exonic
903475998 1:23619579-23619601 CTCTGCTGTGGCGGCGGCGGCGG - Intronic
904029020 1:27522496-27522518 CAGGGCGGTGGCGGCGGCGGTGG + Intergenic
904641989 1:31938060-31938082 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
904822729 1:33256164-33256186 CCAGGCGGTGGCGGCGGCGGCGG + Intergenic
905137121 1:35808338-35808360 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
905179265 1:36156366-36156388 CTCAGCGGCGGCGGCGGCGGCGG - Exonic
905449284 1:38046641-38046663 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
905632594 1:39526996-39527018 CTCTGCAGTGGGGCAGGAGGGGG - Intergenic
906204396 1:43979336-43979358 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
906365535 1:45206440-45206462 CCCAGCGGTGGCGCCGAGGGGGG + Exonic
906641576 1:47444064-47444086 CGCTGCGGCGGCGCTGGAGGAGG - Intergenic
906960922 1:50419100-50419122 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
907010629 1:50959890-50959912 CCCGGCGGCGGCGGCGGCGGTGG - Exonic
907540854 1:55214839-55214861 CGCGGCGGGAGCACCGGAGGCGG - Exonic
908527582 1:65002686-65002708 CTGGCCGGCGGCGGCGGAGGCGG + Intergenic
910277558 1:85465064-85465086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
910448993 1:87328532-87328554 CTCGGAGGCGGCGGCGGCGGCGG - Exonic
910883308 1:91941710-91941732 GTCGGAGGTGGAGGCGGAGGCGG + Intergenic
911133824 1:94418423-94418445 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
913565558 1:120069421-120069443 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
913632573 1:120724135-120724157 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914286154 1:146228793-146228815 CGCGGCGGCGGCGGCGGAGGAGG - Exonic
914547185 1:148679546-148679568 CCAGGCGGCGGCGGCGGAGGAGG - Intronic
914619323 1:149390815-149390837 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914998564 1:152566022-152566044 ATCGGTGGTGGCGCCTGTGGTGG + Exonic
914999917 1:152579750-152579772 ATCGGTGGTGGCGCCTGTGGTGG + Exonic
915246347 1:154558627-154558649 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
915355779 1:155254692-155254714 CTCGGTGGTGGTGACGGAAGAGG + Exonic
915568211 1:156728592-156728614 AGCGGCAGTGGCGGCGGAGGAGG + Exonic
916065504 1:161132640-161132662 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
916666992 1:166975583-166975605 CGGGGCGGAGGCGCGGGAGGCGG - Intronic
917345176 1:174022136-174022158 CGCGGCGGTGGCGACGGCCGCGG - Exonic
917755400 1:178093805-178093827 CACGGCGGTGGCGGTGGCGGTGG - Intergenic
917869599 1:179229641-179229663 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
917884005 1:179365880-179365902 TTCAGCGGTGCCGGCGGAGGAGG - Exonic
919908838 1:202097448-202097470 GGCGGCGGTGGCGGCGGATGGGG + Intergenic
919916966 1:202144764-202144786 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
920171531 1:204074935-204074957 CTCGGCGCTGGCGCTGGCGCTGG + Intronic
921023765 1:211259435-211259457 GACGGCGGCGGCGGCGGAGGAGG - Exonic
922287548 1:224183261-224183283 CTCAGAGGTGGCGGCGGCGGCGG - Exonic
923141357 1:231163231-231163253 CTCGGCGGCGGTGCGGGAGGTGG + Exonic
924754785 1:246931491-246931513 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1062774716 10:135522-135544 CGCGGCGGCGGCGGCGGTGGAGG + Intronic
1063206946 10:3841278-3841300 CTGGGAGGTGGAGGCGGAGGCGG + Intergenic
1064209077 10:13348111-13348133 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1064230923 10:13528887-13528909 CGCGGCGGCGGCGGCGGAGGCGG + Intronic
1064443173 10:15371243-15371265 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1064645372 10:17454330-17454352 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1065025036 10:21533925-21533947 CTGGGAGGTGGCGGGGGAGGTGG - Intergenic
1065342976 10:24723680-24723702 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1066758087 10:38730408-38730430 GTCGGCTCGGGCGCCGGAGGCGG - Intergenic
1068690159 10:59906306-59906328 GGCGGCGGTGGCGGCGGGGGAGG - Exonic
1068989123 10:63133264-63133286 CTCGGCGGTGGCGCAGGGGGCGG + Intronic
1070257859 10:74826371-74826393 CCCCGGGGTGGTGCCGGAGGGGG + Intronic
1070328206 10:75401349-75401371 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1070570644 10:77637742-77637764 CTCCGCGGCGGCGGCGGCGGCGG - Intronic
1070708202 10:78656961-78656983 ATCAGCGGAGGCGGCGGAGGGGG + Intergenic
1072562231 10:96586896-96586918 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1072719502 10:97771934-97771956 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1074503358 10:114045010-114045032 CGGGGCGGTGGCGGCGGCGGCGG - Exonic
1075430984 10:122380775-122380797 GTCGGCGGTGGTGGGGGAGGTGG + Intronic
1075629317 10:123991684-123991706 CGGGGCGGTGGCGGCGGCGGCGG + Intergenic
1075768925 10:124917195-124917217 CTTGGCGGCGGCGGCGGCGGCGG - Intergenic
1076638914 10:131901019-131901041 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1076638919 10:131901034-131901056 GGCGGCGGCGGCGCCGGCGGTGG + Exonic
1076722086 10:132397162-132397184 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1077214547 11:1389999-1390021 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1078679552 11:13463047-13463069 CTCGGCGGGGGCGGCGCGGGAGG - Intronic
1081611442 11:44565547-44565569 CTCGGGGGCGGGGCCGGCGGAGG + Intronic
1081831474 11:46119884-46119906 CCCGGCGGGGGCGCGGGCGGGGG + Intronic
1082928901 11:58579229-58579251 CTAGGCGGCGGAGGCGGAGGCGG - Exonic
1083281670 11:61630494-61630516 CTCAGCCGTGGAGACGGAGGTGG + Intergenic
1083593844 11:63909827-63909849 CTGGGCGGTGGGGCAGGGGGCGG + Exonic
1083648441 11:64186375-64186397 CTCGGCGCTGGGGCCGGACGGGG + Intronic
1083885742 11:65572684-65572706 CTCGGCAGAGGCGCCGGGCGGGG + Exonic
1084363627 11:68684444-68684466 CTCGGCGAGGGTGCAGGAGGCGG + Intronic
1086112302 11:83212960-83212982 CTCGGCGCTGCCTACGGAGGTGG + Intronic
1087117896 11:94544190-94544212 GTGGGCGGAGGCGCCGCAGGAGG + Exonic
1087672756 11:101127553-101127575 CCCGGCGGCGGCGGCAGAGGCGG + Exonic
1088172967 11:107018276-107018298 CTCGGCGGCGGCGCCGGGCTGGG + Exonic
1091823165 12:3491294-3491316 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1092727678 12:11500713-11500735 CCCGGCGGTGGCGGCGGCAGCGG - Intronic
1095432020 12:42144662-42144684 CGCGGCGGCGGCGGCGAAGGAGG - Exonic
1095752804 12:45729689-45729711 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
1096570407 12:52519956-52519978 TTCGGCGGTGGAGCTGGTGGTGG - Exonic
1096771555 12:53938988-53939010 ATCGGCGGCGGCGGCGGAGGAGG + Exonic
1096774402 12:53955362-53955384 GGCGGCGGTGGCGACGGCGGCGG + Exonic
1096983741 12:55743400-55743422 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1097264422 12:57737515-57737537 CCCGGCGGCGGCGGCGGTGGCGG + Exonic
1098819157 12:75207787-75207809 CTCGGCGGCGGCGACAGTGGAGG + Exonic
1101592899 12:106139194-106139216 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1101605884 12:106247622-106247644 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1102078638 12:110080246-110080268 CTCGGGGGTGGGAGCGGAGGGGG - Intergenic
1102370947 12:112382089-112382111 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1103899227 12:124294984-124295006 CTCGGCGGAGGCGCCGGGCCGGG + Intronic
1103954258 12:124567601-124567623 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1104049564 12:125186489-125186511 CGCGGCGGCGGCGGCGGCGGGGG + Intergenic
1105678068 13:22696592-22696614 GGCGGCGGTGGCGGCGGCGGTGG + Intergenic
1106208404 13:27620499-27620521 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1106498767 13:30307396-30307418 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1106516954 13:30464703-30464725 CGCGGCGGCGGCGGCGCAGGCGG - Intronic
1106735859 13:32586994-32587016 CGCGGCGGCGGCGACGGCGGCGG - Intronic
1106781808 13:33066520-33066542 CTAGGCGGCGGCGCTGGAGGCGG + Intergenic
1106841665 13:33690809-33690831 CTGGGCGGTGGGGGGGGAGGTGG + Intergenic
1110119742 13:71866471-71866493 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1110558515 13:76886265-76886287 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1110558523 13:76886289-76886311 CTAGGAGGTGGCGGCGGTGGCGG - Exonic
1112504916 13:99969809-99969831 CTCCGAGGTGGCGGCGGCGGCGG + Intronic
1112505085 13:99970588-99970610 GGCGGCGGCGGCGCCGGGGGCGG + Exonic
1113378406 13:109783948-109783970 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1113656042 13:112068240-112068262 CTCGGTGGCGGCGGCGGCGGCGG + Exonic
1113656113 13:112068540-112068562 CTCGGCCGTGGCGGCGGCGGCGG + Exonic
1113914855 13:113864029-113864051 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1115399158 14:32938862-32938884 ACCGGCGGCGGCGGCGGAGGAGG - Intronic
1115399316 14:32939414-32939436 CTCGGCGGCGGAGGCGGCGGCGG - Intronic
1117119621 14:52553214-52553236 CCCGGCGGGGGCAGCGGAGGCGG + Exonic
1117375888 14:55117923-55117945 CTCCGTGGTTGCGCAGGAGGTGG - Intergenic
1117647166 14:57865269-57865291 CTCGGGGGTGGGGCTGGCGGGGG - Intronic
1117942294 14:60981195-60981217 GTCGTCGGTCGCGCCAGAGGCGG - Exonic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118607702 14:67515406-67515428 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1118627699 14:67674463-67674485 CTCCGAGGAGGCGGCGGAGGAGG + Exonic
1118849480 14:69573086-69573108 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1118971548 14:70642067-70642089 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1120168027 14:81220933-81220955 CTCGGCGGCGGCGGCGGCGGCGG - Intronic
1121283858 14:92719264-92719286 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1121283866 14:92719288-92719310 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1121283869 14:92719297-92719319 GGCGGCGGTGGCGGCGGTGGCGG - Intronic
1121293192 14:92794378-92794400 CTCGGCGGCTGGCCCGGAGGGGG - Exonic
1121482859 14:94291833-94291855 CTGGGCCCTGGCGCTGGAGGCGG - Intronic
1122108763 14:99480800-99480822 CCAGGCGGTGGCGGCGGTGGCGG + Exonic
1122108766 14:99480809-99480831 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1122183499 14:99971992-99972014 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1122444990 14:101761695-101761717 CACGGCGGCGGCGGCGGCGGCGG - Intergenic
1122697401 14:103562735-103562757 CTAGGCGCGGACGCCGGAGGAGG - Intronic
1122905654 14:104800482-104800504 CTCGGGGCGGGGGCCGGAGGGGG - Intergenic
1123024888 14:105419882-105419904 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1202905378 14_GL000194v1_random:68657-68679 CTCTGCGGTGTCCTCGGAGGAGG + Intergenic
1123396644 15:19944001-19944023 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1124109480 15:26773042-26773064 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1124384696 15:29196993-29197015 CTCGAGGGTGGCGCTGGAGTTGG - Intronic
1124469274 15:29968795-29968817 GTCTGCGGCGGCGGCGGAGGCGG - Intronic
1124652504 15:31483999-31484021 CTTGGCCGTGGCGGCGGCGGCGG + Exonic
1124971139 15:34490525-34490547 GGCGGCGGTGGCGGTGGAGGAGG - Intergenic
1125522937 15:40358258-40358280 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1126736661 15:51737677-51737699 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
1126767005 15:52019443-52019465 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1127293678 15:57591880-57591902 CCCGGGGGTGGGGCCGGGGGCGG - Intergenic
1128028577 15:64460591-64460613 CGCGGCGGCGGCGGCGGTGGCGG + Intergenic
1129016719 15:72474865-72474887 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
1129446898 15:75625270-75625292 CGAGGCGGGGGCGCCGGATGGGG - Intronic
1129612331 15:77070819-77070841 CGCGGCGGAGGCGCCCGTGGGGG - Intronic
1130115691 15:81002468-81002490 CTCGGCGCCGGCACCAGAGGAGG - Exonic
1130319710 15:82830896-82830918 GGCGGCGGTGGCGGCGGTGGTGG - Exonic
1130362962 15:83207686-83207708 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1130908600 15:88256346-88256368 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1131827014 15:96330399-96330421 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1132368657 15:101277420-101277442 CTGGGCGGCGGCGGCGGCGGCGG - Exonic
1132398290 15:101489760-101489782 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1132641877 16:981781-981803 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1132683532 16:1153246-1153268 CCCGGCGGAGGCGACGGCGGCGG - Exonic
1132805077 16:1771565-1771587 CGGGGCGGTGGCGCCCGGGGCGG + Exonic
1132828935 16:1918283-1918305 CTGGGCGGCGGGGCCGGGGGCGG - Exonic
1132885100 16:2179036-2179058 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1133006252 16:2883326-2883348 CGCGGCGCTGTCGCCGGAGAGGG + Exonic
1133021603 16:2969362-2969384 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
1134615763 16:15650249-15650271 CGCGGCGGCGGCGGCAGAGGCGG - Intronic
1135158477 16:20073681-20073703 CTCGGTGGTGGCGGCGGCGGAGG + Exonic
1135537010 16:23302375-23302397 GTCGGCGGTGGCGGAGGCGGCGG - Exonic
1135607388 16:23836185-23836207 CTCGGCGGCGGCCCCGCAGCCGG - Exonic
1135712498 16:24729683-24729705 GTCGGCGGCGGCGGCGGCGGCGG + Intronic
1135821883 16:25692381-25692403 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1136110889 16:28063194-28063216 CGAGGCGGTGGCGGCGGCGGCGG + Exonic
1136550487 16:30980002-30980024 CGGGGCGGTGGCGGCGGGGGTGG - Exonic
1137236315 16:46621272-46621294 CTGGGCGGTGGAGCAGGAGCTGG - Exonic
1137617263 16:49855506-49855528 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
1138105708 16:54286207-54286229 CTCCGCGGCGGCGACGGCGGCGG + Exonic
1139754637 16:69132542-69132564 CGCGGCGGCGGCGACGGCGGCGG - Exonic
1140187413 16:72787705-72787727 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1140223274 16:73058788-73058810 CTCGGCGGCAGCGGCGGCGGCGG - Intronic
1140225224 16:73071478-73071500 ATCGGCGGCGGCGGCGGCGGCGG - Intergenic
1140927582 16:79599196-79599218 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1141079181 16:81035879-81035901 CTCGGAGGCGGCGGCGGCGGCGG + Exonic
1141460016 16:84172789-84172811 CTGGGCGGTGTCCACGGAGGGGG - Intronic
1141608586 16:85169266-85169288 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1141831161 16:86510603-86510625 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1141972430 16:87492711-87492733 CTGGGCGGAGGCGCGGGCGGCGG - Intergenic
1142188595 16:88706576-88706598 CTGGGCCGCGGCGCCGGGGGCGG - Exonic
1143123774 17:4627487-4627509 GTCGGCGGAGGGGCAGGAGGAGG + Intergenic
1143517310 17:7426369-7426391 AACGGCGGTGGCGGCGGCGGCGG - Exonic
1143539760 17:7562002-7562024 GGCGGCGGTGGCGCTGGTGGCGG + Exonic
1143548524 17:7614615-7614637 CCCGGAGGAGGAGCCGGAGGGGG + Exonic
1144565057 17:16353153-16353175 GTCGGCGGCGGCGGCGGCGGTGG + Exonic
1144786897 17:17837010-17837032 CTGGGCGGTCGAGGCGGAGGCGG + Intergenic
1146132630 17:30291953-30291975 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1146398564 17:32487021-32487043 CTCGGCGGCGGCGACGGCGGCGG - Exonic
1147167337 17:38600595-38600617 CTGGGAGGTGAAGCCGGAGGAGG + Intronic
1147307402 17:39573631-39573653 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1147315430 17:39617965-39617987 CTCGGAGGTGGGGTCGGCGGGGG + Intergenic
1147395663 17:40140654-40140676 TGCAGCGGTAGCGCCGGAGGCGG + Exonic
1147400403 17:40177500-40177522 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1147719825 17:42532206-42532228 CTGGGCGGCGGCGGCGGCGGCGG - Intergenic
1148084147 17:44984259-44984281 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084154 17:44984286-44984308 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084161 17:44984313-44984335 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084168 17:44984340-44984362 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084175 17:44984367-44984389 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084182 17:44984394-44984416 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084189 17:44984421-44984443 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084196 17:44984448-44984470 ATCGGCTGTGGCGGCGGTGGTGG + Intergenic
1148084203 17:44984475-44984497 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084217 17:44984529-44984551 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084224 17:44984556-44984578 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084238 17:44984610-44984632 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084245 17:44984637-44984659 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084252 17:44984664-44984686 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084287 17:44984799-44984821 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084301 17:44984853-44984875 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084308 17:44984880-44984902 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084315 17:44984907-44984929 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148084322 17:44984934-44984956 ATCGGTTGTGGCGGCGGAGGTGG + Intergenic
1148440412 17:47709015-47709037 CCCGGCGGGGGCGGCGGCGGTGG - Exonic
1148551083 17:48551142-48551164 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1149430519 17:56593367-56593389 AGCGGCGGTGGCGGCGGCGGTGG - Intergenic
1150060590 17:62065380-62065402 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1150311099 17:64130038-64130060 CTCGGCCCTGGCTCCGGGGGCGG + Exonic
1152049087 17:77958773-77958795 CGCGGCGGCGGGGCCGGCGGCGG - Intergenic
1152049140 17:77958949-77958971 CTAGGCGGCGGCGGCGGCGGCGG - Intergenic
1152321634 17:79611258-79611280 CGCGGCGGCGGCGCGGGCGGCGG + Intergenic
1152353637 17:79796796-79796818 CGCGGCCGTGGCGGCGGCGGCGG - Intronic
1152660756 17:81540873-81540895 CTGGGCGGTGGCACAGGAGCTGG + Exonic
1152924067 17:83079614-83079636 CTCGGCGGCGGCGGCGGGCGCGG + Intergenic
1153040817 18:812016-812038 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1153515215 18:5895590-5895612 GTGGGGGGGGGCGCCGGAGGAGG - Intronic
1154125541 18:11689450-11689472 CTCAGCGGAGGGGCGGGAGGGGG - Exonic
1154268211 18:12897116-12897138 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1154503666 18:15010462-15010484 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1155199343 18:23503581-23503603 CGCGGCGGGGGCCCCGGGGGCGG - Exonic
1155654340 18:28177067-28177089 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1155928950 18:31685599-31685621 GGCGGCGGTGACGCAGGAGGCGG - Intronic
1156275716 18:35581476-35581498 CTCGGCGGCAGCGGCGGCGGCGG - Intronic
1157384295 18:47248303-47248325 GGCGGCGGTGGCGGCGGCGGCGG + Intronic
1157700741 18:49760297-49760319 CTCTGCGGGGGCGGCGGAAGAGG + Intergenic
1157859391 18:51126859-51126881 CTCAGCGGTGGGTCCGGATGTGG + Intergenic
1157867199 18:51197229-51197251 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1159586749 18:70289285-70289307 CTCGGCGGGTGCGCGGGCGGGGG + Intronic
1159798103 18:72867780-72867802 GGCGGCGGCGGCGCCGGCGGCGG + Exonic
1160152543 18:76406119-76406141 CCGGGCGGTGCCTCCGGAGGAGG - Intronic
1160453342 18:78979744-78979766 CCCGGCGGCGGCGGCGGGGGGGG + Intergenic
1160729070 19:632522-632544 CTTGGCGGCGGGGCCGGGGGGGG + Intronic
1160773641 19:844582-844604 GTCAGGGGAGGCGCCGGAGGAGG - Intronic
1160842892 19:1154368-1154390 CTCCGTGGTGGCGGCGGTGGCGG + Exonic
1160864903 19:1252215-1252237 CTCCTCGGTGGGGGCGGAGGGGG - Intronic
1160873171 19:1286083-1286105 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1160873173 19:1286089-1286111 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
1160930691 19:1568270-1568292 CTCGGCGGCGGCGGCGACGGCGG + Intergenic
1161050981 19:2164030-2164052 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1161124204 19:2546786-2546808 CCCGGCGGTGGGGTCGGCGGGGG + Intronic
1161333821 19:3700405-3700427 GGCGGCGGGGGCGCCCGAGGGGG + Exonic
1161471116 19:4457297-4457319 CTCGGGGGCGGGGCCGCAGGAGG - Intronic
1161583927 19:5094975-5094997 CTCGGGGGCGGCGCCGGGGGCGG + Intronic
1161779197 19:6279890-6279912 ATCGGCGGCGGCGGCGGCGGCGG - Exonic
1162751758 19:12833851-12833873 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1162904936 19:13817792-13817814 CTTGGTGCTGGCGCTGGAGGTGG + Exonic
1163606981 19:18280984-18281006 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1163807253 19:19406451-19406473 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1163824710 19:19516421-19516443 CCCGGCGGTGTGACCGGAGGCGG + Intronic
1165204517 19:34172448-34172470 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165349520 19:35268516-35268538 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165373865 19:35427735-35427757 CTCGGTGGTGGTGTGGGAGGGGG - Intergenic
1166126343 19:40717279-40717301 CCCGGCGGGGCGGCCGGAGGGGG + Exonic
1166331346 19:42079737-42079759 CTCGCCGGTGGGCCAGGAGGAGG - Exonic
1166358577 19:42242239-42242261 CCCGGCGGCAGCGGCGGAGGAGG - Exonic
1166358626 19:42242371-42242393 CCCGGCGGCGGAGGCGGAGGAGG - Exonic
1166361251 19:42253867-42253889 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1167268933 19:48497593-48497615 CTCGGCTGTGCCTCCGGTGGCGG + Exonic
1167268954 19:48497680-48497702 CCCGGCGGCGGCCCCGGAAGCGG - Exonic
1167378996 19:49127921-49127943 CTCGGCGCTGGGCCCGGACGAGG + Exonic
1167643704 19:50695087-50695109 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
925927207 2:8679002-8679024 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
927606506 2:24491254-24491276 GGCGGCGGTGGCGGCCGAGGAGG + Intergenic
927881456 2:26692707-26692729 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
927881458 2:26692710-26692732 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
928549519 2:32357287-32357309 CTCGGCGGCGGGGGCGGGGGCGG + Exonic
929452542 2:42047422-42047444 CTCGCGGGTGGGGCCGGGGGTGG - Intergenic
929778338 2:44942222-44942244 GGCGGCGGCGGCGCGGGAGGCGG + Exonic
930011422 2:46941035-46941057 CGCGGCGGGGGCGGCGGCGGGGG + Intronic
930136091 2:47905530-47905552 GGCGGCGGTGGCGGCGGCGGAGG + Exonic
930136231 2:47906066-47906088 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
930189210 2:48440812-48440834 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
931253508 2:60552420-60552442 TTCGGCGGCGGCGGCGGCGGCGG + Intronic
932345866 2:70994830-70994852 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
933666859 2:84971282-84971304 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
933684711 2:85133694-85133716 CTCGGCGGCGGGGGCGGCGGCGG + Exonic
934031901 2:88055740-88055762 CTCGGCGGCGGAGGCGGCGGTGG - Intergenic
934248170 2:90324633-90324655 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248185 2:90324694-90324716 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248359 2:90325307-90325329 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248370 2:90325345-90325367 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248381 2:90325383-90325405 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248397 2:90325447-90325469 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934304464 2:91809921-91809943 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
934328793 2:92042829-92042851 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935112317 2:100104803-100104825 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
935196647 2:100820246-100820268 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
935301519 2:101697611-101697633 GGCGGCGGCGGCGCTGGAGGAGG - Intronic
935592442 2:104855293-104855315 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592501 2:104855420-104855442 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592697 2:104856100-104856122 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
936279132 2:111122594-111122616 GTCGGCGGTGCCGGCGGCGGCGG + Intronic
936407157 2:112215275-112215297 CTCAGCTGTGGCTCGGGAGGTGG - Exonic
936528394 2:113258035-113258057 GCCAGGGGTGGCGCCGGAGGTGG - Intronic
937271267 2:120654558-120654580 CGCGGCGGTGGGGCAGGGGGCGG + Intergenic
937950999 2:127387914-127387936 CTCAGCGGCGGCGCCTGACGAGG - Intronic
939900454 2:147844420-147844442 CTCGGCGGCAGCGGCGGCGGCGG - Intergenic
940421007 2:153478915-153478937 CGCGGCGGTGCGGCCGGAAGGGG - Intergenic
941119108 2:161507854-161507876 CGCGGCGGCGGCGGCGGCGGGGG - Intronic
942241038 2:173964475-173964497 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
942241117 2:173964683-173964705 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
942302018 2:174571864-174571886 CTGGGAGGTGGCGGCGGAGGTGG + Exonic
942448374 2:176092974-176092996 CTCATCGGTGGCGGCGGCGGCGG + Exonic
942449441 2:176099965-176099987 CTGCGCGGGGGCGCAGGAGGCGG - Exonic
942462001 2:176175112-176175134 GCCGGCGGTGGCGGGGGAGGAGG - Intergenic
943571505 2:189580770-189580792 CACGGCGGCGGCGGCGGCGGCGG - Exonic
943725330 2:191246093-191246115 CCCGGCGGCGGCGGGGGAGGAGG + Intronic
944715904 2:202376172-202376194 GGCGGCGGCGGCGCCGGCGGCGG - Intergenic
944831220 2:203535343-203535365 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
945466016 2:210171321-210171343 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
946311266 2:218883734-218883756 GGCGGCGGTGGGGCGGGAGGGGG - Intronic
946325282 2:218981754-218981776 CGCGGCGGTGGCGGCGGCAGCGG + Exonic
946431020 2:219627526-219627548 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
946776548 2:223148353-223148375 CTTGGCGGCGGCGGGGGAGGGGG + Intronic
946921467 2:224585299-224585321 CTCCGCGATGGCGGCGGCGGCGG + Exonic
949049690 2:241890877-241890899 CTCGGCGGTGAGGCAGGTGGCGG + Intergenic
1170150499 20:13221708-13221730 GGCGGCGGTGACGCCGGGGGAGG - Intergenic
1170756802 20:19212482-19212504 CGCGGCGGGGGCGGCGGGGGCGG - Intergenic
1170890036 20:20368679-20368701 CTCGGAGGGGGCGGCGGCGGCGG + Exonic
1171473564 20:25390620-25390642 CGCGGCGGCCGAGCCGGAGGAGG + Exonic
1172109151 20:32535488-32535510 CTCGGTGGTGGCGGTGGCGGCGG - Intronic
1172474492 20:35226778-35226800 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1173672873 20:44810293-44810315 CTCGGCCGCGGCGGCGGCGGCGG + Intronic
1173672876 20:44810299-44810321 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1173672940 20:44810508-44810530 GGCGGCGGTGGCGGCGGCGGTGG + Intergenic
1175412006 20:58776585-58776607 CTTGGCAGGGGCTCCGGAGGGGG + Intergenic
1175715513 20:61252441-61252463 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1175872799 20:62216451-62216473 CTCGGGGGTGGCGGTGGGGGCGG - Exonic
1175902940 20:62367131-62367153 CGCGGCGCGGGCGCGGGAGGAGG - Exonic
1175975506 20:62708642-62708664 GTGGGGGGTGGCGGCGGAGGAGG - Intergenic
1176549397 21:8214741-8214763 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176557292 21:8258970-8258992 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176568325 21:8397775-8397797 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176576234 21:8442005-8442027 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176624749 21:9083416-9083438 CTCTGCGGTGTCCTCGGAGGAGG + Intergenic
1177011052 21:15730365-15730387 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1178673906 21:34614954-34614976 CGCGGCGGAGGCGGCGGAGGCGG - Exonic
1179842064 21:44083209-44083231 CTCAGGGGTGGCTCTGGAGGAGG + Exonic
1179988073 21:44932194-44932216 CTCAGTGGTGGCCCCGGAGCTGG - Intergenic
1180188918 21:46153582-46153604 CTGGGCGGTGGCGGCAAAGGCGG - Intronic
1180891408 22:19291656-19291678 CTCGGCGGCGGCGGCGGCAGCGG + Exonic
1180908387 22:19431634-19431656 GGCGGCTGTGGCGGCGGAGGGGG - Exonic
1180951448 22:19722348-19722370 GGCGGCGGGGGCGGCGGAGGCGG + Intronic
1180960706 22:19761103-19761125 CTCGGCGGCGGCGCTGGTGGCGG - Exonic
1181007536 22:20021113-20021135 GTCGGCGGCGGTGGCGGAGGCGG + Exonic
1181026852 22:20131824-20131846 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1181934619 22:26429609-26429631 CTCGGCGGGGGCGGCGGCGGCGG - Intronic
1182374724 22:29838208-29838230 GTCGGCGGCGGCGGCGGCGGCGG - Exonic
1182532122 22:30968843-30968865 AGCGGCGGCGGCGGCGGAGGCGG - Intergenic
1182771812 22:32801798-32801820 CTCGGCGCTGGCGCAGGACTCGG - Exonic
1183524932 22:38317287-38317309 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1183720585 22:39559464-39559486 CTCTGCGTTGACGGCGGAGGTGG - Intergenic
1184242991 22:43221209-43221231 CCTGGCTGTGGGGCCGGAGGTGG + Exonic
1185037937 22:48489469-48489491 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
1185374290 22:50474962-50474984 CTCCGCGGCGGCGGCGGCGGCGG + Exonic
1185374292 22:50474965-50474987 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1185409600 22:50674817-50674839 CCCGGCGGAGGCGGCGGGGGAGG - Intergenic
1203238465 22_KI270732v1_random:30912-30934 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1203254284 22_KI270733v1_random:131063-131085 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203255059 22_KI270733v1_random:133695-133717 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203262340 22_KI270733v1_random:176142-176164 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203263115 22_KI270733v1_random:178774-178796 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
950411609 3:12841511-12841533 CTCGGCGCTGCCTACGGAGGTGG - Exonic
950487807 3:13283115-13283137 CCCGGGGGCGGCGCCGGCGGAGG - Intergenic
950779091 3:15375652-15375674 CGCGGCGATGGCGACGGCGGCGG + Intergenic
950829412 3:15859590-15859612 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
951078571 3:18425346-18425368 GGCGGCGGCGGCGGCGGAGGAGG + Intronic
951208326 3:19947271-19947293 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
951907897 3:27721914-27721936 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
951981970 3:28575978-28576000 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
952241229 3:31532948-31532970 CCAGGCGGCGGCGGCGGAGGAGG + Exonic
953801087 3:46023129-46023151 CGCGGCGGCGGCGCAGGGGGCGG + Intronic
953947774 3:47164012-47164034 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
954388799 3:50258358-50258380 GTCGGCGGTGGCCCTGGAGGTGG - Exonic
954539697 3:51385296-51385318 GTCGGCGGCGGCAGCGGAGGAGG + Exonic
954540632 3:51391265-51391287 CGCGGCGGTGGCGGCGGGGCGGG - Exonic
954540655 3:51391340-51391362 CACAGCGGCGGCGGCGGAGGCGG - Exonic
955769238 3:62372525-62372547 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
955911539 3:63863797-63863819 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
955911572 3:63863957-63863979 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
956064159 3:65379383-65379405 ATCGGCAGTGGCGGCGGCGGGGG - Exonic
956659153 3:71582370-71582392 CACGGCGGTGGCGGCGGCGCCGG - Intronic
956678015 3:71753644-71753666 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
956678017 3:71753647-71753669 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
956761271 3:72447119-72447141 CTCGGCGGAGGCGGCGCTGGCGG - Intergenic
956978925 3:74614451-74614473 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
959849679 3:111071819-111071841 CTCGGCAGTGGCGTCGGCGACGG + Exonic
961827175 3:129605300-129605322 CCGGGCGGTGGCGGCGGCGGCGG - Intronic
962793989 3:138835004-138835026 CCCCGCGGTGGCGGCGGCGGCGG + Intergenic
962808824 3:138945459-138945481 CTGGGCGCTGGCTCCAGAGGCGG + Exonic
963252989 3:143119654-143119676 CTCGGCGTTGGGGGCGGGGGCGG + Exonic
966182201 3:177197563-177197585 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
966911421 3:184562257-184562279 CCCGGCGGCGGCGACGGCGGCGG - Exonic
968092837 3:195909183-195909205 CTGGCCTGTGGCGCAGGAGGAGG - Intronic
968434124 4:576242-576264 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
968583193 4:1404327-1404349 CCCGGCGGTGGGGCCGGAGCCGG + Intronic
968701298 4:2059399-2059421 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
970202898 4:13627538-13627560 GGAGGCGGCGGCGCCGGAGGAGG + Exonic
970823944 4:20252003-20252025 GGCGGCGGCGGCGGCGGAGGCGG + Intergenic
972321551 4:37977359-37977381 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
972675584 4:41257154-41257176 CTCGGCGCTCGCGGGGGAGGGGG - Intronic
972960546 4:44447925-44447947 CACGGTGGTGGCGGCGGCGGCGG - Exonic
975342529 4:73258349-73258371 GGCGGCGGTGGAGGCGGAGGTGG - Exonic
975342579 4:73258587-73258609 CCCGGCGGTGGCGGCTGTGGCGG - Exonic
975342629 4:73258764-73258786 CGAGGCGGTGGCGGCGGAGGCGG - Exonic
975485751 4:74933059-74933081 CGCGGCGGCGGCGGCGGAGGCGG + Intergenic
976184351 4:82430001-82430023 CCCGGCGCTGGCGACTGAGGCGG + Exonic
977809919 4:101346883-101346905 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
977810065 4:101347529-101347551 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
978072535 4:104491318-104491340 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
978072574 4:104491423-104491445 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
978072611 4:104491494-104491516 CATGGCGGTGGCGGCGGCGGCGG + Exonic
979674679 4:123398345-123398367 CTGGCCGGTGGCGGCGGGGGCGG + Intronic
981366660 4:143912129-143912151 GGCGGAGGTGGCGGCGGAGGTGG - Intergenic
984668096 4:182449186-182449208 CGCGGCGGTGGCGGTGGCGGTGG + Intronic
984776244 4:183483494-183483516 CTCGGAGGAGGCGGCGGAGGTGG - Intergenic
984811216 4:183797754-183797776 CCCGGCAGAGGCGCCGGCGGGGG + Intergenic
986297119 5:6448809-6448831 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
986813661 5:11385162-11385184 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
987258263 5:16179466-16179488 CCCGGCGGCGGCGTCGGCGGCGG + Exonic
987258270 5:16179478-16179500 GTCGGCGGCGGCGGCGGGGGAGG + Exonic
988437532 5:31193808-31193830 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
988482075 5:31639321-31639343 CGCGGCGGCGGCACCGGTGGTGG + Intergenic
988825300 5:34929660-34929682 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
989812573 5:45695879-45695901 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
989812576 5:45695888-45695910 GACGGCGGTGGCGGCGGTGGCGG - Exonic
989812673 5:45696213-45696235 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
990210770 5:53480148-53480170 CGCGGTGGGGGCGCTGGAGGCGG - Intergenic
990955143 5:61332802-61332824 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
993900975 5:93584315-93584337 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
994367297 5:98929648-98929670 CACGGGCGGGGCGCCGGAGGAGG + Intergenic
997283526 5:132663032-132663054 CTCGGCGGTGGCTGAGGAAGTGG - Intergenic
997470199 5:134113300-134113322 CCCGGAGGTGGCGGGGGAGGGGG + Intergenic
997500728 5:134371472-134371494 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
997633672 5:135389091-135389113 CATGGCGGTGGCCCTGGAGGCGG + Exonic
998130290 5:139648343-139648365 CGCGGCGGCGGCGGCAGAGGCGG + Exonic
998143228 5:139711328-139711350 CTCGGCGGCGGCGGCGGCGGCGG - Intergenic
998963122 5:147509538-147509560 CCCGGCGGGGGCGGGGGAGGCGG + Exonic
999322612 5:150624739-150624761 CTAGGCGGTGGCGGTGGCGGCGG + Intronic
999696346 5:154190998-154191020 GGCGGCGGTGGCGCCGGCGGCGG + Exonic
1001506378 5:172283734-172283756 CTCGGCGGTGGCGCCGGAGGAGG - Exonic
1002927305 6:1611781-1611803 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1002945921 6:1760548-1760570 CTCGGCGGTGGGGACTGCGGGGG - Intronic
1003049429 6:2766096-2766118 CGAGGCGGAGGCGCAGGAGGAGG + Exonic
1003551832 6:7107682-7107704 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1004043934 6:12009112-12009134 CGTGGCGGTGGCGGCGGCGGCGG + Intronic
1004690342 6:17987683-17987705 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1006472664 6:34237337-34237359 CGCGGCGGCGGCGGCGGAGGGGG + Intronic
1006950816 6:37819903-37819925 CTCGGCGGCGGCAGCGGTGGCGG - Exonic
1007739635 6:44002766-44002788 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1008369188 6:50714147-50714169 GGCGGCGGTGGCGGCGGTGGCGG + Intronic
1008369191 6:50714156-50714178 GGCGGCGGTGGCGGCGGCGGTGG + Intronic
1008545172 6:52577262-52577284 CGCGGCGCTGGCGCGGGACGAGG - Intergenic
1012399999 6:98835072-98835094 CACGGCGGCGGCGGCGGGGGCGG + Exonic
1013575850 6:111483137-111483159 CCCGGCGGTGGCGGCAGTGGCGG - Exonic
1013836550 6:114342202-114342224 CCCGGCGGTGGCGGCGCGGGCGG + Exonic
1014029109 6:116681106-116681128 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1014029115 6:116681124-116681146 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1014137545 6:117907203-117907225 CCGGGCGGGGGCGCCGGCGGCGG - Intergenic
1017164160 6:151391557-151391579 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1017672240 6:156778732-156778754 CCCGGCGGCGGCGGCGGAGGCGG - Exonic
1017672287 6:156778857-156778879 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1018156651 6:160991704-160991726 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
1019111923 6:169724003-169724025 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1019140384 6:169938786-169938808 CTCGGCGGTGAAGACGGACGGGG + Intergenic
1019667403 7:2258745-2258767 CTCGGCGGTGGGGGCAGCGGTGG + Intronic
1019989615 7:4682465-4682487 AGCGGCGGTGGCGGCGGCGGCGG - Exonic
1020020168 7:4861755-4861777 TTCGGCGGCGGCGCCGGCTGCGG + Exonic
1020178069 7:5898701-5898723 CGGGGCGGTGGCGACGGAGGCGG + Intergenic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1020304858 7:6826274-6826296 CGGGGCGGTGGCGACGGAGGCGG - Exonic
1021231106 7:18086903-18086925 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1022090048 7:27102141-27102163 TGCGGCGGTGGCGGCGGCGGCGG + Exonic
1023899932 7:44467852-44467874 CTCGGCGCTGCCTACGGAGGTGG + Intronic
1024043861 7:45574559-45574581 CGCGGCGGAGGCGGCGGCGGAGG + Exonic
1024688518 7:51774372-51774394 CTCGGCTGTGGAGCAGGAAGAGG + Intergenic
1025069682 7:55887600-55887622 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1025615710 7:63114427-63114449 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1025916888 7:65873237-65873259 CGCGGCGGCGGCGGCGGCGGTGG + Intergenic
1025916901 7:65873276-65873298 GGCGGCGGTGGCGGCGGTGGCGG + Intronic
1028173722 7:87628860-87628882 CGCGGCGGTGGCGGCGGAGGCGG + Exonic
1028922340 7:96322037-96322059 CCCGGCGGCGGCGGCGGTGGGGG + Exonic
1028985576 7:97006202-97006224 CTCGGCGGCGGCGGCGGCAGCGG + Exonic
1029456215 7:100673839-100673861 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1029896401 7:103989361-103989383 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029996753 7:105014153-105014175 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1030005362 7:105112908-105112930 CTGGAAGGTGGCGGCGGAGGGGG - Exonic
1031886857 7:127252862-127252884 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1032274286 7:130440898-130440920 CTCGGCCGGAGAGCCGGAGGGGG - Intronic
1034306281 7:150047667-150047689 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1034441152 7:151086680-151086702 CGCGGCGGAGGCGGCGGCGGCGG - Intronic
1034469721 7:151248755-151248777 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1034494184 7:151410221-151410243 CCAGGCGGCGGCGGCGGAGGTGG - Intronic
1034911711 7:155003092-155003114 CTCGGCGCGGGCGCGGGCGGGGG - Intergenic
1035010443 7:155711212-155711234 GGCGGCGGTGGCGGTGGAGGGGG - Exonic
1036910928 8:12755894-12755916 CTGGGCGGGGGCGTCGGGGGAGG - Intronic
1037281427 8:17246727-17246749 CTCGGCGGCGGTGGCGGTGGCGG + Exonic
1037535226 8:19817435-19817457 CCCCGCGGTGGCGGCGGCGGCGG + Exonic
1037901765 8:22692960-22692982 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1037901768 8:22692969-22692991 GGCGGCGGTGGCGGCGGTGGCGG - Exonic
1037925161 8:22838666-22838688 CTCGGCGGTGAAGCCAGAGCTGG + Intronic
1038883507 8:31639664-31639686 CGCGGCGGCGGCGCGGGGGGTGG + Intronic
1038883615 8:31640107-31640129 CGCGGCCCTGGCGCCGGGGGCGG + Intronic
1039453884 8:37695807-37695829 AGCGGCGGTGGCGGCGGCGGCGG + Exonic
1041059502 8:54022276-54022298 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1041280996 8:56211308-56211330 GTCGGCGGCGGCGGCGGCGGCGG - Intronic
1041689917 8:60678764-60678786 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1042040222 8:64581388-64581410 CTGGGCGGCGGCGGCGGCGGGGG + Exonic
1043502953 8:80874316-80874338 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
1044115266 8:88327577-88327599 GGCGGCGGCGGCGGCGGAGGAGG - Intronic
1044242464 8:89902731-89902753 CTCGCCGGGGGAGGCGGAGGCGG + Exonic
1045516295 8:102863627-102863649 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1045564362 8:103298789-103298811 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1045674064 8:104588979-104589001 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048980891 8:139703084-139703106 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1049109937 8:140636008-140636030 CCCGGCTGTGCCGCCGGAGCCGG + Intergenic
1049164846 8:141119326-141119348 CTGGGCGGTGGCTCCAGAGTGGG + Intronic
1049292537 8:141812313-141812335 CGCGTCGGTGGTGCCAGAGGTGG + Intergenic
1049310017 8:141928853-141928875 TTGGGTGGTGGCGTCGGAGGTGG - Intergenic
1049471635 8:142777433-142777455 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471654 8:142777485-142777507 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471673 8:142777537-142777559 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471692 8:142777589-142777611 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049761476 8:144333777-144333799 CCCGACGGCGACGCCGGAGGCGG - Exonic
1049828635 8:144685884-144685906 CGCGGGGGCGGAGCCGGAGGCGG - Intergenic
1050744123 9:8857670-8857692 GTTGGCGGCGGCGCGGGAGGCGG - Intronic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1052362158 9:27573214-27573236 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1052888837 9:33677017-33677039 CACGGCGGCGGCGGCGGCGGCGG - Intergenic
1052903987 9:33817735-33817757 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1053152004 9:35749314-35749336 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1053240026 9:36487691-36487713 AGCGGCGGCGGCGGCGGAGGGGG + Intergenic
1053697502 9:40651087-40651109 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054308791 9:63450487-63450509 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054762323 9:69014122-69014144 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054835571 9:69672287-69672309 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1054842669 9:69760056-69760078 CTCGGCGGCGGCCGCGGCGGCGG - Intergenic
1055091116 9:72365282-72365304 CCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1056350231 9:85741924-85741946 TGCGGCGGCGGCGCTGGAGGCGG + Intronic
1057245478 9:93451526-93451548 CCCGGAGGCGGCGGCGGAGGCGG - Intronic
1057489143 9:95508366-95508388 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1057869708 9:98708679-98708701 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1057996128 9:99822744-99822766 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1059234510 9:112750707-112750729 CTCGGGGGCGGGGCCGGAGCGGG + Intergenic
1059283044 9:113150982-113151004 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1059633938 9:116154347-116154369 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1060389813 9:123268280-123268302 GGCGGCGGTGGCGGCCGAGGCGG - Intronic
1060700681 9:125747180-125747202 CGCGGCGGTGGCGGAGGCGGAGG - Intergenic
1060700683 9:125747183-125747205 CTCCGCGGCGGTGGCGGAGGCGG - Intergenic
1060814068 9:126625699-126625721 GGCGGCGGCGGCGGCGGAGGTGG - Intronic
1061453500 9:130681620-130681642 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1061540774 9:131277073-131277095 CTGGGCGGTCTCCCCGGAGGCGG + Intergenic
1061666577 9:132163574-132163596 CTCGGCAGGGGCGGCAGAGGGGG - Intronic
1061828507 9:133275786-133275808 CCCGGCGCGGGCGCCGGAGGGGG - Intergenic
1061889288 9:133609192-133609214 CACGGCGGTGGCGCCTGGTGTGG + Intergenic
1061975826 9:134067714-134067736 GGCGGCGGTGGCGGCGGCGGTGG - Intronic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062499534 9:136846312-136846334 CTCGGCGCTGCCGGCCGAGGCGG - Exonic
1202779847 9_KI270717v1_random:24375-24397 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203774214 EBV:63658-63680 CTCTCCGGCGGCGCCGGGGGTGG + Intergenic
1203792673 EBV:160092-160114 CTCGACAGTGCCCCCGGAGGTGG - Intergenic
1203470685 Un_GL000220v1:114207-114229 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203478506 Un_GL000220v1:158179-158201 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1185457758 X:319238-319260 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1186078205 X:5903304-5903326 GTCGGCGGTGGCCACGGCGGGGG + Exonic
1186107774 X:6226215-6226237 CTCGGGGATGGCGGGGGAGGGGG - Intronic
1187281575 X:17861366-17861388 CTTGGGGGAGGCGGCGGAGGAGG + Intergenic
1187826176 X:23334756-23334778 CGCGGCGGCGGCGACGGCGGCGG - Exonic
1189332317 X:40151719-40151741 CGCAGCGGTGGCGGCGGCGGCGG + Intronic
1190243349 X:48674986-48675008 CTCTGCGCAGGCGCCGTAGGAGG - Intergenic
1190329313 X:49226053-49226075 CTCGGCGGAGGCGGCGGCTGGGG + Exonic
1190713061 X:53083061-53083083 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1192361753 X:70445112-70445134 CCCGGCGGCGGCGGCGGCGGTGG + Exonic
1192924998 X:75747076-75747098 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
1192925001 X:75747085-75747107 CGCGGCGGCGGCGGCGGTGGCGG - Intergenic
1193654990 X:84187988-84188010 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1194977592 X:100409719-100409741 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1198424068 X:136497341-136497363 GTCGGCGGCGGCGGCGGTGGCGG + Exonic
1199445106 X:147912049-147912071 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1199445111 X:147912064-147912086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
1200000275 X:153056556-153056578 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200100663 X:153688036-153688058 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1200155582 X:153972939-153972961 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1201161258 Y:11168838-11168860 CTCTGCGGTGTCCTCGGAGGAGG + Intergenic
1201517137 Y:14830270-14830292 GTCGGCGGTGGCCACGGCGGGGG - Exonic