ID: 1001513609

View in Genome Browser
Species Human (GRCh38)
Location 5:172339767-172339789
Sequence CTGGGTCACCTCGTGGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001513600_1001513609 -10 Left 1001513600 5:172339754-172339776 CCCCCAGCCGGAGCTGGGTCACC 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 169
1001513594_1001513609 18 Left 1001513594 5:172339726-172339748 CCCGTGTTGTTCTCCAGCGCTGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 169
1001513596_1001513609 5 Left 1001513596 5:172339739-172339761 CCAGCGCTGCTGCTTCCCCCAGC 0: 1
1: 0
2: 6
3: 52
4: 457
Right 1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 169
1001513595_1001513609 17 Left 1001513595 5:172339727-172339749 CCGTGTTGTTCTCCAGCGCTGCT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001513609 Original CRISPR CTGGGTCACCTCGTGGGGCA GGG Exonic
900161492 1:1226234-1226256 CTGGAGCATCTCGTGGTGCAGGG + Intronic
900406577 1:2495578-2495600 CGGGGCCTCCCCGTGGGGCAGGG - Intronic
900504418 1:3022207-3022229 CTTGGTGACTGCGTGGGGCAGGG - Exonic
901324969 1:8360480-8360502 CTGGGTCAGCCCGGGGGGCTGGG + Exonic
902067614 1:13700661-13700683 CTGGGGCCCCACGTGGGGCCGGG + Intronic
903060244 1:20664117-20664139 CTGTGCCACCCCATGGGGCAGGG + Exonic
903679685 1:25088664-25088686 CTGGCTCAGCTTGGGGGGCAGGG + Intergenic
907604904 1:55806624-55806646 CTTGGTGTCCTTGTGGGGCAGGG - Intergenic
909864427 1:80649458-80649480 CTGGGTCACCTTGTTTGACATGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915138714 1:153752696-153752718 CTGGCTCACCTCCTGAGCCAAGG - Intronic
1064956875 10:20921324-20921346 CAGGGTCTCCTCCTGGGACATGG - Intronic
1067242662 10:44509299-44509321 CTGGGTGACCTGGTGGGGAGGGG + Intergenic
1068439031 10:57028415-57028437 CTGTGTCACCTCCTGGTGGAGGG - Intergenic
1069949342 10:72008459-72008481 CTGGGTCACGTAGGGGGGCCGGG + Exonic
1071725818 10:88197378-88197400 CTGGGGCACTTCCTGGGGCCCGG + Intergenic
1075720838 10:124586403-124586425 CTGGATCACATGTTGGGGCAGGG - Intronic
1075902928 10:126057632-126057654 CTGGGCCACTTCCTGGGGCCAGG + Intronic
1076400141 10:130177698-130177720 CTGGGTCCCTTGGAGGGGCAGGG + Intronic
1076531636 10:131149054-131149076 CAGGGTCACCTGGTAGGTCAAGG - Intronic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077241571 11:1513092-1513114 CAGTGTCACCTCGTGGGGAGAGG - Intergenic
1081507606 11:43734542-43734564 CTGGGGCAGCTGGAGGGGCACGG - Intronic
1081856590 11:46307987-46308009 CAGGCTCACCTGGTGGGGGATGG - Exonic
1084466585 11:69326765-69326787 CGGGGTCATCTCTGGGGGCAGGG - Intronic
1089508558 11:118980803-118980825 CTGGGTCACACCGTGGGGGTGGG + Intronic
1090952425 11:131485291-131485313 CATGGCCACCTGGTGGGGCAGGG + Intronic
1093149209 12:15601827-15601849 CTGAATCACCACTTGGGGCAGGG + Intergenic
1098985677 12:77009499-77009521 CTCGCTCACCTTGTAGGGCAAGG - Intergenic
1101824701 12:108210986-108211008 CTGGGTCCCCTCCTGGGGACTGG + Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103763348 12:123266385-123266407 CTGCTTCTCCTCCTGGGGCAGGG + Intronic
1104715399 12:131012888-131012910 CTGGGTGACCGCGGGGGGCCCGG + Intronic
1104838865 12:131810785-131810807 CTGGTGTACCTCGTGGGGCCAGG + Intergenic
1104917123 12:132271532-132271554 CGGCGTCACCTCGGGGGACAGGG - Intronic
1108573183 13:51769796-51769818 GTGGGACACCTCGAGGGGCTTGG - Intronic
1108679089 13:52763912-52763934 CAGGGGCTCCTCCTGGGGCATGG + Intergenic
1111868494 13:93799820-93799842 CTGGGGCAGGTAGTGGGGCAGGG + Intronic
1114334312 14:21672106-21672128 CTGAGTCAGATTGTGGGGCAGGG + Intergenic
1116659464 14:47690138-47690160 CTGGGTCACCTAGGGGTGCCAGG + Intergenic
1116826438 14:49677531-49677553 CTGGGTCGCCTAGTCCGGCAGGG - Intronic
1119225431 14:72941405-72941427 CTGGGTCACCACGGGTGGAATGG + Intronic
1119329892 14:73786263-73786285 CTCGGTAGCCTCGTGGCGCAGGG - Intronic
1119460126 14:74794947-74794969 CTGGGTCACCCCATGAGGCAAGG - Intronic
1121464006 14:94102522-94102544 CTGGGACAGCTCTTGGGGCCTGG + Exonic
1121840098 14:97126936-97126958 CTGGGTCAGTTTGTGAGGCAGGG + Intergenic
1122864753 14:104598613-104598635 CTGGGGCACCTCCCGGGGCCAGG - Intronic
1123476734 15:20596260-20596282 CTGGGCCACGTGGTGGGGCTGGG + Intergenic
1123641277 15:22404104-22404126 CTGGGCCACGTGGTGGGGCTGGG - Intergenic
1124416032 15:29473916-29473938 CAAGGTCACCCCGTGGGCCACGG + Intronic
1125956669 15:43795149-43795171 CTGGGCCACCTTCTGGGTCAAGG - Exonic
1127563212 15:60161219-60161241 CTTGGTCAGCACGTGGGGTAGGG - Intergenic
1130025012 15:80263369-80263391 CTGGGTCACCTGGCAGGGAAAGG - Intergenic
1133103625 16:3493729-3493751 CTGGGCCACCCCATGTGGCAGGG + Exonic
1134254443 16:12600190-12600212 ATGGGACACATCGTGGGTCATGG + Intergenic
1135040236 16:19112765-19112787 CTGTGTAACCTTGTGGGGGAGGG + Intergenic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141633495 16:85301712-85301734 CTGGGTCCCCTCCCAGGGCAGGG + Intergenic
1142599898 17:1048528-1048550 CTGGATCACCTCTTGGGCCACGG + Intronic
1142599932 17:1048676-1048698 CTGGATCACCTCCGGGGCCACGG + Intronic
1142954506 17:3512281-3512303 CTGGGTCAGCTGGGAGGGCAGGG + Intronic
1144625635 17:16843121-16843143 TGGGGTCACCTCGTGGGGGAAGG - Intergenic
1144880797 17:18429599-18429621 TGGGGTCACCTCGTGGGGGAAGG + Intergenic
1145151439 17:20514788-20514810 TGGGGTCACCTCGTGGGGGAAGG - Intergenic
1145279065 17:21455316-21455338 CTGGGTCACCATCTGGGGAATGG - Intergenic
1145868541 17:28255993-28256015 CTGGCTCACCTCCTCGGGCCTGG + Intergenic
1145938505 17:28728594-28728616 CTTGGACACTGCGTGGGGCAGGG + Intronic
1147686617 17:42289814-42289836 CTGTGGCACCTCCTTGGGCAAGG - Intronic
1147965737 17:44193387-44193409 CTGGGTCCCTTCCTGGGGCAGGG + Exonic
1148760734 17:49998465-49998487 GTGGGTCACCTGCAGGGGCAGGG + Intergenic
1151572651 17:74935051-74935073 CTCGGGGACCTCCTGGGGCAGGG - Intergenic
1152642833 17:81456346-81456368 CTGGGCCACCCTGTGGGCCACGG - Exonic
1152935172 17:83132534-83132556 CTGGGGAACCTGGTGGGGCGGGG - Intergenic
1152997840 18:424922-424944 CTGGGTCACCTCATGGGTGTGGG + Intronic
1153347993 18:4049353-4049375 CTGGCTCAGCTACTGGGGCAGGG - Intronic
1156484663 18:37457161-37457183 CTGGTTCTCCTCTTGGGACAAGG + Intronic
1157713410 18:49865583-49865605 CTGGGTCCCCTCCTGGCTCAAGG + Intronic
1160014120 18:75127712-75127734 CTGGGGCTCCTGGTGGGGCCTGG - Intergenic
1160914052 19:1488323-1488345 CTGGGGCCCCTCGTGGTTCAGGG + Intronic
1160985416 19:1836388-1836410 CTGGGGCTCCTTGTGGGGCTAGG - Intronic
1161221432 19:3119896-3119918 CTGACACACCCCGTGGGGCAGGG - Intronic
1161769297 19:6222634-6222656 CTTGGTCACCTTGTGTGGCTTGG + Exonic
1162536313 19:11264612-11264634 CGGGGACACTTGGTGGGGCATGG - Intergenic
1163605873 19:18274974-18274996 CTGGATCACCTCCTGGGGCTGGG + Intergenic
1164524059 19:29000597-29000619 CTGGGACACCCCAAGGGGCAGGG + Intergenic
1164765620 19:30764633-30764655 CTGTGTCATCTCATGGGGAAAGG - Intergenic
1165313726 19:35042459-35042481 CTGGCTGACCTCCTGGGCCAGGG - Exonic
1165358543 19:35319194-35319216 CTGGGCCACCACGTGTGGGAGGG + Intergenic
1165458235 19:35927516-35927538 GTGAGCCACCACGTGGGGCAAGG + Intergenic
1165744295 19:38221657-38221679 CTGGGACCCTTGGTGGGGCATGG + Intronic
1166045002 19:40224764-40224786 CGGGGTCACAGCGCGGGGCAGGG + Exonic
926329816 2:11815160-11815182 CTGGGTCAACGAGAGGGGCACGG + Exonic
927674876 2:25097993-25098015 CTGGGTCAGCTCCAGGGCCAGGG - Intronic
931246415 2:60496252-60496274 CTGTGTTGCCTCGTGGGACAAGG - Intronic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
941681457 2:168403802-168403824 CTGGGTCACCTCGTTGGTAATGG - Intergenic
941766924 2:169308376-169308398 CTGGGTCCTGTCGTGGGGTAGGG - Intronic
942064778 2:172260416-172260438 TTGAGTCCCATCGTGGGGCAGGG + Intergenic
944280845 2:197894826-197894848 CTGGGTCACCTCCTGAACCATGG + Intronic
947915359 2:233828876-233828898 CTGCTTCACCTGGAGGGGCATGG - Exonic
948592000 2:239056377-239056399 CTGGAGCACCTCGTGGTGCTGGG + Intronic
1171135707 20:22692745-22692767 CTGGGGCCTGTCGTGGGGCAGGG - Intergenic
1172221828 20:33279527-33279549 CTGGGTCAGTGCGTGGAGCATGG + Intronic
1172274482 20:33672359-33672381 CTGGGTCCCACAGTGGGGCAGGG - Intronic
1173907189 20:46637868-46637890 CTGAATCACCTCCTGGGGGATGG - Intronic
1173932511 20:46832648-46832670 CTGGGTCATCTGCTGGGGCTGGG - Intergenic
1174761648 20:53212529-53212551 CTGGGACACATCGAGGGGGAGGG + Intronic
1175311876 20:58018021-58018043 CTGGGGCACCTCCTGGGGGGAGG - Intergenic
1179115518 21:38488227-38488249 CTGGGTCACCTCATGTTGAAGGG - Intronic
1179684215 21:43044599-43044621 CTGGGTCAGCCCCTGGGTCAGGG - Intergenic
1179821398 21:43939339-43939361 CTGGGAAACCTCCTGGGGCGCGG - Intronic
1179908177 21:44434902-44434924 CGGGGTCACCTGGTGGGGGAAGG - Intronic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184251531 22:43263142-43263164 CTAGGTCAGATTGTGGGGCATGG + Intronic
1184453846 22:44598136-44598158 CTGGGTCACCTCGTGGCCCCAGG - Intergenic
1185338413 22:50281042-50281064 CTGGGGCGCCTCCTGGGGCGGGG - Intronic
950451254 3:13067067-13067089 CAGGGTCACATAGTGAGGCAGGG + Intronic
952611709 3:35217129-35217151 CTGGGTCACCGCGTTGGACATGG + Intergenic
953405549 3:42658009-42658031 CTGGGTCATCTCCTGGGAAATGG - Intronic
953679839 3:45030875-45030897 CAGGGCCACCTCCTGGGCCAGGG - Exonic
956672965 3:71708572-71708594 CTGGGTTATCTCGTGGGGTCAGG + Intronic
957383874 3:79470397-79470419 CTGGGGCCTGTCGTGGGGCATGG + Intronic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
962686914 3:137856799-137856821 CTGGGTCCTGTCGGGGGGCAGGG - Intergenic
965724924 3:171705057-171705079 CTGGCTCACCTCCTGTTGCATGG + Intronic
966182461 3:177199041-177199063 CTGAATGACCTAGTGGGGCAGGG + Intergenic
966698829 3:182822271-182822293 CTGGGGCCTCTCGTGGGGTAGGG - Intronic
968636735 4:1684672-1684694 CTGGGTCACCGCCTGAGCCACGG - Intergenic
974407337 4:61491213-61491235 CTCTGTCACTTCGTAGGGCATGG + Intronic
982320549 4:154072688-154072710 CTGGGTGAGCTTTTGGGGCAGGG + Intergenic
984754664 4:183314028-183314050 CTAGGTCACGTGGTGGAGCAGGG + Intronic
986706507 5:10458361-10458383 CTCGGCAACCTCGTGGGGCTCGG + Intronic
986717926 5:10537624-10537646 CTGGGATGCCTTGTGGGGCATGG - Intergenic
989554564 5:42778326-42778348 CTGGGTCATCTCTTGGGGGGTGG - Intronic
994184794 5:96805780-96805802 CTGGATCCCGTCTTGGGGCAGGG - Intronic
994355877 5:98793338-98793360 CTGGCTCTCCTCGTAGGACATGG - Exonic
995807694 5:116072023-116072045 CTGGGACACCTTGTAGTGCAGGG - Intergenic
997356349 5:133265454-133265476 CTGTGTCACCTCCAGAGGCAGGG - Intronic
999327472 5:150651987-150652009 CTGGGTTCCCCAGTGGGGCAAGG + Exonic
1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG + Exonic
1002541840 5:179911365-179911387 CTGGGCCACCTCCTGGGGACTGG + Intergenic
1002626580 5:180533860-180533882 GTGGGTCACCACCTGGGGCCTGG + Intronic
1003309255 6:4954493-4954515 CTGTGTCTCTACGTGGGGCAGGG - Intronic
1005844839 6:29769266-29769288 CTGGGTCCTCTTGTGGAGCATGG - Intergenic
1007732216 6:43954198-43954220 CTGGGTCTCCTCATGGGGCAGGG + Intergenic
1008885870 6:56431263-56431285 CTGGCTCCCCTGGTGGGGGAGGG - Intergenic
1009399705 6:63239808-63239830 CAGGGTCATCTGTTGGGGCAGGG + Intergenic
1009727824 6:67557962-67557984 CTGGGACAGCACGTGGGGGAAGG - Intergenic
1011216889 6:85014673-85014695 CTGGGTCACTGGGTGGGGGAGGG + Intergenic
1018718635 6:166555467-166555489 CAGGGTGACTTCGTGGGACAGGG - Intronic
1022142960 7:27509148-27509170 CTGGATCAGCTCGAGGGGCTGGG - Intergenic
1023224304 7:37952861-37952883 CTGGGTCACCTCTTGGTGGCAGG + Intronic
1024797540 7:53036516-53036538 CTGGGTGACCTCGAGGGCGAAGG - Exonic
1029845344 7:103406522-103406544 CCGGCTCACCTCATTGGGCATGG - Intronic
1035282667 7:157787461-157787483 CTGGGTCACCCCAGTGGGCAGGG + Intronic
1035707717 8:1689823-1689845 CTGGGTCAGCACGTGGGGCCAGG - Intronic
1036031357 8:4977632-4977654 CTGGGTCTGCACGTGGGGTAAGG - Intronic
1038065272 8:23957301-23957323 ATGGGTCACCTGGTGGGACCTGG - Intergenic
1039424716 8:37476503-37476525 CTGGGGCACCTGGTGGGACCTGG + Intergenic
1042114443 8:65415353-65415375 CTAGGTCACCCTGTGGGGAAGGG + Intergenic
1044607208 8:94057771-94057793 CTGGGGCACATCGTGGGAGATGG + Intergenic
1044842039 8:96344953-96344975 ATTGGGCTCCTCGTGGGGCAAGG - Intergenic
1045716997 8:105058513-105058535 CTGGGGCTTGTCGTGGGGCAGGG + Intronic
1050974176 9:11915680-11915702 GTGGGGCACATGGTGGGGCAGGG + Intergenic
1052820986 9:33137823-33137845 CTGGCTGACCTTGTGGGGAAGGG - Intronic
1057314060 9:93957940-93957962 CTTGGTCAGCTTGTGGGGAAGGG + Intergenic
1060188922 9:121580099-121580121 TAGAGTCACCTGGTGGGGCAGGG - Intronic
1060556856 9:124512433-124512455 CTGGACCACCTCGTGGGGATGGG + Intergenic
1061712829 9:132499408-132499430 CCGGGTCAGCTCGTGGGGGCAGG - Exonic
1061779891 9:132989287-132989309 CTGTGTCACCCCCAGGGGCAGGG - Intronic
1061997448 9:134193659-134193681 CTGGCTCTGCTCATGGGGCAAGG - Intergenic
1062103180 9:134738891-134738913 CTGGGTCACCTCCACAGGCAGGG - Intronic
1062452573 9:136621737-136621759 CTGGGTGGGCTCGTGGGGCTGGG + Intergenic
1062518143 9:136946247-136946269 CTGGGCCACCCCGAGGGGCTGGG + Intronic
1062526127 9:136978723-136978745 CGGGGTCATCTCCTGGGGCGGGG + Intronic
1062526149 9:136978789-136978811 CGGGGTCATCTCCTGGGGCGGGG + Intronic
1062614221 9:137388728-137388750 CTGGCTCTCCTCTTGGGGCCTGG + Intronic
1191902506 X:66054708-66054730 CTGGGCCCCTTCCTGGGGCAGGG + Intergenic
1192161769 X:68793784-68793806 CTGATTCAGATCGTGGGGCAGGG + Intergenic
1199457704 X:148047672-148047694 TTAGGTCACCTCTTGGGGCTGGG - Intergenic
1199968572 X:152841324-152841346 CTGGTTCACCTCGTTGGGACTGG - Intronic