ID: 1001515716

View in Genome Browser
Species Human (GRCh38)
Location 5:172354006-172354028
Sequence CTGTGGGGACAAAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001515710_1001515716 15 Left 1001515710 5:172353968-172353990 CCGAGCTGTGTACGGGTAGATGA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG 0: 1
1: 0
2: 2
3: 44
4: 357
1001515707_1001515716 22 Left 1001515707 5:172353961-172353983 CCTGGTCCCGAGCTGTGTACGGG 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG 0: 1
1: 0
2: 2
3: 44
4: 357
1001515709_1001515716 16 Left 1001515709 5:172353967-172353989 CCCGAGCTGTGTACGGGTAGATG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG 0: 1
1: 0
2: 2
3: 44
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001515716 Original CRISPR CTGTGGGGACAAAAGGAAGC TGG Intronic
900196829 1:1380885-1380907 CTGCGGGGACCAAAGGAAGGAGG - Intergenic
900385280 1:2407769-2407791 CTCTAGGGACAAAAGGAAGGGGG + Intronic
901147084 1:7072611-7072633 CTGTGGAGAAAAAAGAAAGTGGG + Intronic
901880216 1:12189342-12189364 CAGTGGAGGCAACAGGAAGCAGG - Intronic
901892357 1:12277919-12277941 CTGTTGGGTCTGAAGGAAGCCGG + Exonic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
902771536 1:18648037-18648059 CTGTGGGGACAGAAGCCATCAGG - Intronic
903502155 1:23806628-23806650 CTGTGGAGAAAAAATGAAGCAGG - Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
904287186 1:29460328-29460350 CTGAGGAGACAAGAGGAACCAGG + Intergenic
904301361 1:29556777-29556799 CTGTGGGGACAAGTGGAGGGAGG + Intergenic
904339982 1:29828312-29828334 CTGTGGGGACAAGTGGAGGGAGG + Intergenic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
906745996 1:48222584-48222606 CAGTTGGGAGAAAAGGAGGCAGG + Intergenic
907354359 1:53860154-53860176 CTGTGGGGAAAAAAAGACCCAGG + Intronic
907359988 1:53906558-53906580 ATCTGGGTTCAAAAGGAAGCCGG - Intronic
907459746 1:54598371-54598393 TTGAGGGGACAGAAGAAAGCAGG - Intronic
910891036 1:92020476-92020498 ATTTGGGGAAAAAAGAAAGCTGG - Intergenic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
912956620 1:114158202-114158224 CTTTGTGGACAAAAGCAGGCTGG + Intergenic
912998566 1:114556228-114556250 CTGTTGAGAGCAAAGGAAGCAGG - Intergenic
914440207 1:147698976-147698998 TTGTGAGGACAAAAGTGAGCAGG + Intergenic
915138366 1:153750037-153750059 CTGTGGAGTTAAAAGGTAGCAGG + Intronic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916142681 1:161712967-161712989 CTGTGGGGCCCAATGGCAGCAGG - Intronic
917042359 1:170819828-170819850 CTGAGGAGACAAGAGGAATCGGG + Intergenic
918011346 1:180589893-180589915 CTTTGGAGAGAAAAGGATGCTGG - Intergenic
918863989 1:189870861-189870883 CTTTGGGGAGAAAAGGAATAGGG - Intergenic
919079097 1:192848449-192848471 CTGGGGGAGCAAGAGGAAGCTGG + Intergenic
919497282 1:198288729-198288751 CTGTGGTGACAGAAGTAAACAGG - Intronic
919527908 1:198677918-198677940 CTGTGTGGAAAAAAAAAAGCTGG - Intronic
920076715 1:203342495-203342517 CTGTGGGGACAAGAGGAGCACGG + Intronic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924901610 1:248407326-248407348 CTTTGGGGAGAAAAAGAAGCAGG - Intergenic
1063405262 10:5788388-5788410 CTGTGGGGGAAAGAGGAAGGAGG - Intronic
1063619961 10:7637529-7637551 CTGTGGGGACTGAGGGAACCTGG - Intronic
1064165087 10:12978955-12978977 ATTTGGGAACAAAAGGAAGGCGG - Intronic
1064867199 10:19894434-19894456 CTGAGGGGACAAAAGTAGGTTGG + Intronic
1066983621 10:42443009-42443031 CTTTGGGGACACAAGGAAAAGGG + Intergenic
1067203376 10:44193989-44194011 CTGGGGGGCCACAAGGAGGCAGG + Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067455034 10:46413090-46413112 CTGTGGGGTCTAAAAGGAGCAGG - Intergenic
1067632170 10:47971544-47971566 CTGTGGGGTCTAAAAGGAGCAGG + Intergenic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1069809230 10:71146179-71146201 CTGTGGGGAGAATAGGTAGGAGG - Intergenic
1069891457 10:71655097-71655119 TGGAGGGCACAAAAGGAAGCAGG + Intronic
1070495226 10:77015337-77015359 CTGTGGGGTCAAGGGGAAGGAGG - Intronic
1071045775 10:81374658-81374680 ATGTGGACACAAAAGCAAGCAGG - Intergenic
1072173800 10:92895648-92895670 CTGTTCAAACAAAAGGAAGCAGG + Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1073279516 10:102342689-102342711 CTTTAGAGACAAAAGGAAGCAGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073821119 10:107265159-107265181 CTTTGGGGATTAAAGGAAGCAGG - Intergenic
1074435786 10:113433161-113433183 GTGTGTGGACAAATGGAAGCTGG + Intergenic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075210746 10:120489048-120489070 CTGGAGGGACAAAAGGAAGTAGG - Intronic
1075274995 10:121085417-121085439 CTGTTGGTTCACAAGGAAGCAGG + Intergenic
1075301953 10:121332826-121332848 CAGTGGGGGCAAAAGTAGGCAGG + Intergenic
1075495836 10:122917686-122917708 CTGTGGAGATGACAGGAAGCTGG - Intergenic
1075797084 10:125128374-125128396 TTTTGGGGACAAGAGGAAGCAGG + Intronic
1076216506 10:128697986-128698008 CTGTGGGTGCGAGAGGAAGCAGG - Intergenic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077496744 11:2890340-2890362 CTGTGAGGGCACAAGAAAGCAGG + Intronic
1078338800 11:10484660-10484682 CTGACGAGACAAAAGGAAGCAGG + Intronic
1078991652 11:16653605-16653627 CTTTGGGGACTAGGGGAAGCGGG + Intronic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079142767 11:17823767-17823789 TTGTGGGGAATAAAGGAAGCTGG - Intronic
1079789502 11:24718134-24718156 CTGTGGGGAAAAGAGTGAGCGGG + Intronic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081295773 11:41387253-41387275 CTCTGAGGACAAATGGAGGCAGG + Intronic
1081457940 11:43243782-43243804 GTGTGGGGACAAGAGAAGGCAGG + Intergenic
1082029799 11:47595741-47595763 CTGTGGGGAGGACAAGAAGCAGG + Intergenic
1083506086 11:63158854-63158876 ATGGGGGGAAAAAAGGAAGTTGG - Intronic
1083734092 11:64669823-64669845 CTGCAGGGTCAACAGGAAGCTGG + Intronic
1083929129 11:65829783-65829805 CTGTGGCGACTGAAGCAAGCAGG - Intronic
1084091827 11:66883657-66883679 ATGTGGGGACAAAAGAGACCAGG - Intronic
1085043217 11:73338902-73338924 CTGTGGGGATTAAAGGAGCCAGG + Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1088144049 11:106652907-106652929 CTGTGGGGGAAAAGGTAAGCAGG - Intergenic
1088695333 11:112361441-112361463 CTGGGGGAACAAAAAGAAGGAGG + Intergenic
1088983389 11:114884107-114884129 CTAGGGGAAAAAAAGGAAGCTGG + Intergenic
1089447566 11:118565632-118565654 CTTGGGGGAATAAAGGAAGCAGG + Intronic
1089462425 11:118660999-118661021 CTGTGGGGCCCAAGGGCAGCTGG - Intronic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1091933800 12:4418404-4418426 CTGTAGAGAAAAAAGGGAGCAGG + Intergenic
1092728125 12:11504421-11504443 CTGTGGGGAGGACAGGGAGCTGG + Intergenic
1093159696 12:15731865-15731887 GTGTGTAGGCAAAAGGAAGCTGG + Intronic
1093930762 12:24953016-24953038 CAGTGAGGACAAAATGAAGCTGG - Intergenic
1095971108 12:47902582-47902604 CAGCAGGGACAAATGGAAGCTGG + Intronic
1096665886 12:53164562-53164584 CAGTGGGGACTATAAGAAGCGGG + Intronic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1102799151 12:115716459-115716481 CTGTGAAGAATAAAGGAAGCAGG + Intergenic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1103916585 12:124378884-124378906 CTGTGGGGACACAAGGCACGGGG + Intronic
1104010274 12:124925370-124925392 GGGTGGGCACAAGAGGAAGCAGG - Intergenic
1104201001 12:126588745-126588767 TTGTGGTTACAAAAGGAAGGTGG + Intergenic
1104575941 12:129965896-129965918 TTGGGGGAAGAAAAGGAAGCTGG + Intergenic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1108521391 13:51249956-51249978 CACTGGGGACACAAAGAAGCTGG - Intronic
1112628608 13:101135696-101135718 CTGTGGCAACACAAGGAAGCAGG + Intronic
1112759435 13:102677377-102677399 CTGTGTGGAGAACAGGCAGCGGG - Intronic
1113127627 13:106997852-106997874 CTGTGTGTACAAAAGTAAACGGG - Intergenic
1114004557 14:18298668-18298690 CTCTGGGGAAAAAAAAAAGCAGG - Intergenic
1114042511 14:18692060-18692082 ATGGGGGCAAAAAAGGAAGCAGG + Intergenic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1115730271 14:36260956-36260978 ATGTGGGGAGAAATGGAAGGTGG + Intergenic
1118454072 14:65929441-65929463 CTGGGGGGTCGAAAGGGAGCTGG + Intergenic
1119074364 14:71621198-71621220 CTGTTGGGTCAAAAGGAGGCAGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119610313 14:76056326-76056348 CTGTTGGGAGAAAAGGGAGAGGG + Intronic
1122269422 14:100561857-100561879 CTGTGGGGACAAAGGCACCCTGG + Intronic
1122834349 14:104423705-104423727 CCGTGGGGAGAACAGGCAGCGGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1126757171 15:51936071-51936093 CTCAGGGGAGAAAATGAAGCCGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1131994572 15:98121794-98121816 CTGTAGGAGGAAAAGGAAGCTGG - Intergenic
1132697899 16:1210108-1210130 CTGTGGGGAGAAGAGGTAGAGGG - Exonic
1132788122 16:1669506-1669528 TTGAGGGGAGAAAAGGAAACTGG + Intronic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1135330862 16:21558447-21558469 CCGTGGTGGCAAAAGGAAGGGGG + Intergenic
1135995241 16:27243048-27243070 CTGTGGGCACAGCAGGGAGCTGG + Intronic
1136938796 16:34500664-34500686 CAGTGGGGGCAAAAAGCAGCGGG + Intergenic
1136961024 16:34847892-34847914 CAGTGGGGGCAAAAAGCAGCGGG - Intergenic
1138141956 16:54576401-54576423 CTGTGGCGCCAAAAGGAGCCAGG - Intergenic
1138175612 16:54895708-54895730 CTTTGGGGAAACAAGGTAGCAGG + Intergenic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143429307 17:6868218-6868240 CTGGGGGGAAAAAAAGAAGGAGG + Intergenic
1143472896 17:7186996-7187018 GTGTGGGGAGAAGAGGAACCAGG + Intergenic
1144118656 17:12127827-12127849 ATGTGTGCACAAAAGTAAGCAGG - Intronic
1145760877 17:27425086-27425108 TTGTGGGTACCAAGGGAAGCTGG - Intergenic
1146354932 17:32125984-32126006 CTGGGGGGAGAAAAGGGGGCCGG - Intergenic
1147150711 17:38511955-38511977 CTGTGGGGAGAAGAGGGCGCTGG - Exonic
1147536375 17:41325310-41325332 CTGTGGGCACCAAGGGCAGCTGG - Intergenic
1147892743 17:43728902-43728924 CTGAGAGGAAAAGAGGAAGCTGG - Intergenic
1148510837 17:48168292-48168314 CTTTTGGGAAAAAAGGAAGAAGG + Intronic
1148521993 17:48285753-48285775 CTGTGGTGAGAAAAGGAGACAGG + Intronic
1148958006 17:51369960-51369982 CTGTAGGGAAAAAAAGAGGCTGG - Intergenic
1149132659 17:53323941-53323963 CTGAGGAGACAACAGGAAGAAGG + Intergenic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1150180693 17:63117483-63117505 CTCTGGATACAAAAAGAAGCAGG + Intronic
1150649638 17:67001404-67001426 CTGAGGCGGCAAAAGGAGGCTGG - Intronic
1151008802 17:70469600-70469622 CTTTTTGGACAAAAGAAAGCAGG + Intergenic
1151111245 17:71680548-71680570 CTGTCGTTACAATAGGAAGCTGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151452306 17:74205536-74205558 CTGTGGGGACAAATAGCATCTGG + Intronic
1151556950 17:74851506-74851528 CTGTGGGCACAAGAGGAGGCGGG + Intronic
1151565989 17:74898535-74898557 CTGTTGGGAAACACGGAAGCAGG - Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152480754 17:80550749-80550771 CAGTGGAGACAAAATGAAGCAGG - Intronic
1152768471 17:82153476-82153498 CTGTGGGGTCAACAGCAAGAAGG - Intronic
1154294753 18:13138313-13138335 CTGTGGGGCCGAAGGGAAACTGG - Intergenic
1156214023 18:34977697-34977719 GGGTGGGTGCAAAAGGAAGCGGG + Intronic
1156411570 18:36833162-36833184 CTGTGGAGAAAAAATAAAGCAGG + Intronic
1156519318 18:37708294-37708316 GTGTGAGGCCAAAAGGAAGCAGG - Intergenic
1156924886 18:42564188-42564210 CTGTGGGGAACAGAGAAAGCAGG + Intergenic
1157304366 18:46506380-46506402 GTGTGGGTTCAGAAGGAAGCAGG + Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1158939455 18:62393508-62393530 ATGTTGGGAAAAAAGGAATCAGG + Intergenic
1160089094 18:75809076-75809098 ATTTAGGGAAAAAAGGAAGCAGG + Intergenic
1160262545 18:77308365-77308387 CTGTAGGGACAACAGGAAATTGG + Intergenic
1160306763 18:77747403-77747425 CAGTGGGGACAGCAGAAAGCAGG - Intergenic
1161257349 19:3316675-3316697 CTGTGGGGAGAAAGGGTGGCTGG + Intergenic
1161489892 19:4556093-4556115 AGGTGGGGACAGGAGGAAGCGGG + Intronic
1162177333 19:8840727-8840749 CTATGAGGAAAAAAGAAAGCTGG + Intronic
1162660339 19:12163538-12163560 CTGTGGAGAGAAAAGGAACTGGG - Intronic
1164929993 19:32168101-32168123 CTTTGGGCTCAGAAGGAAGCAGG - Intergenic
1165397813 19:35576773-35576795 CTGTGGGGGTAAAGGCAAGCTGG + Intergenic
1165500506 19:36185482-36185504 CAGTGGTGACAAAAACAAGCAGG - Intronic
1165544713 19:36525350-36525372 CTGTGGATATACAAGGAAGCAGG + Exonic
1166236071 19:41457941-41457963 GTTTGGGGAAAAAAGAAAGCAGG - Intergenic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1167684038 19:50944359-50944381 ATGTGTGGACAACAGGAATCTGG - Intronic
1167985536 19:53311708-53311730 CTGTGGGGACAAGAGGTGCCAGG - Intergenic
926914478 2:17878994-17879016 CTCTGGGGACCAGAGGATGCGGG - Intronic
926953075 2:18265168-18265190 AAGTGGGCACCAAAGGAAGCAGG - Intronic
927493652 2:23537623-23537645 CTGCAGGGACTAAAGGAAGTAGG + Intronic
928633298 2:33216216-33216238 CTGTGGGGTAAAAAGGAGGGAGG + Intronic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
931493422 2:62775025-62775047 CTATGGAGAAAAAAGGAAGAGGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931814147 2:65883845-65883867 TTGTGGGCACAAAAAGCAGCTGG - Intergenic
932706218 2:74026908-74026930 GAGTGGGGAGAAAAGCAAGCTGG - Intronic
933851668 2:86372348-86372370 CTGTGGGGGCAGAAGACAGCTGG + Intergenic
934331628 2:92074282-92074304 CGGTGGGGGCAAAAAGCAGCAGG - Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934557374 2:95294586-95294608 CTGTGGGGAGAAACTGAGGCTGG - Intergenic
935266753 2:101401535-101401557 TTGTGGGCACAAAAAGAAGAAGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936258868 2:110940323-110940345 CTGTGGTGATCAAAAGAAGCTGG + Intronic
936572093 2:113625947-113625969 AGGTGGGGACAACTGGAAGCAGG - Intergenic
942336847 2:174897827-174897849 CTGTGGTGAAAAAAAGAGGCAGG + Intronic
942458781 2:176155580-176155602 CTGTGGGCCCAAATGGATGCTGG - Intronic
942528206 2:176878840-176878862 CTGTGGATATAAAAGGATGCTGG - Intergenic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
942718545 2:178922923-178922945 CTGTGGGTATTAAATGAAGCTGG + Intronic
943338407 2:186646663-186646685 CTGTGGGGAAAAAAAGAGGAGGG - Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
947282036 2:228465802-228465824 TCTGGGGGACAAAAGGAAGCAGG - Intergenic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947699179 2:232218106-232218128 CCTTGGGGAGAAAAAGAAGCGGG + Intronic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948381398 2:237552314-237552336 CTTTGGGGAAAACAGGAAGAGGG - Intronic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
948628550 2:239285519-239285541 TGGTGGGGAGAAAACGAAGCTGG + Intronic
1168773592 20:431261-431283 CTGAGAGGTCAAAAGGGAGCAGG - Intergenic
1169261668 20:4143654-4143676 CCTTGGGGAGAAAAAGAAGCAGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169803175 20:9532384-9532406 CTGTGGGCACAAGAGGATGTTGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173642590 20:44614511-44614533 CTGTGGGGACAGAAGGCAAGGGG - Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1177310553 21:19386791-19386813 CTATGGAGAAAAAAGAAAGCAGG - Intergenic
1178507088 21:33171214-33171236 CTGAGGGGACTCCAGGAAGCAGG - Intergenic
1179025895 21:37678083-37678105 CTATGGGGCCAAACAGAAGCCGG + Intronic
1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG + Intronic
1180983565 22:19891033-19891055 GTGTGGTGCCAAGAGGAAGCCGG + Intronic
1181727245 22:24820117-24820139 CTCTGGGGATAGAAGGAGGCTGG + Intronic
1181995318 22:26875769-26875791 GTGTGGGGAAAAAAGAAAGATGG - Intergenic
1183622944 22:38985444-38985466 CCACGGGGACAAGAGGAAGCAGG + Intronic
1183901583 22:41009846-41009868 GGGTGGGGAGAAAAGGGAGCTGG - Intergenic
1184328653 22:43811777-43811799 CTGTGGGCACAAATGAAATCAGG + Intronic
1184617941 22:45650731-45650753 CAGTGGAGAGTAAAGGAAGCGGG + Intergenic
1184631931 22:45788462-45788484 CAGTGGGGACAGAAAGATGCAGG - Intronic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
1185177316 22:49335237-49335259 CTGTGGGGACCGATGGGAGCAGG + Intergenic
949483736 3:4518133-4518155 CTGCGGGCAGACAAGGAAGCTGG - Intronic
950769173 3:15297360-15297382 CTGTGGGTAGAAGAGGAAACAGG - Intronic
951534681 3:23729884-23729906 GGAGGGGGACAAAAGGAAGCAGG - Intergenic
953274153 3:41478438-41478460 CTGTGGGCTCAGAAGGGAGCTGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
953980409 3:47410521-47410543 CGGTGGGGGCACAGGGAAGCAGG - Exonic
954776507 3:53023752-53023774 CTGTAGGAACAAAAGGGAGAAGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
956272423 3:67462206-67462228 CTGTGGGAAGAAAAAGGAGCAGG - Intronic
956908103 3:73788137-73788159 CTATGGAGAAAAAATGAAGCAGG + Intergenic
958053858 3:88384483-88384505 GTGAGGAGAAAAAAGGAAGCTGG + Intergenic
958096774 3:88955814-88955836 CAGAGGGGAAAAAAGGAACCCGG - Intergenic
960923678 3:122774737-122774759 CTGTGGAGACAGACAGAAGCAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961851609 3:129825164-129825186 CAGTGGGGAAGAAATGAAGCGGG - Intronic
962857153 3:139357957-139357979 CTCTGCAGACAAAAGGAAGAGGG + Exonic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964967710 3:162518284-162518306 CTAGGGGTACAGAAGGAAGCTGG - Intergenic
966058216 3:175722984-175723006 CTTTGGAGAACAAAGGAAGCAGG + Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
967365916 3:188686365-188686387 CTGTGGGGACTAACTGAAGTGGG - Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
970173767 4:13315550-13315572 CTGTGGGGAAAAAAGTAGGGTGG - Intergenic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970853164 4:20626029-20626051 CTGGGGTGAGAAAAGGAACCTGG - Intergenic
974466849 4:62268862-62268884 CTGTGAATACAAAAGGAAACAGG + Intergenic
975008234 4:69317681-69317703 CTGTGAGGAGAAAAGGAACATGG - Intronic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
976337291 4:83905062-83905084 CAGTGGGATCAAAATGAAGCAGG - Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976408357 4:84684682-84684704 GTGGGGGGAGAAAAGGAAACTGG + Intronic
977328785 4:95610331-95610353 CTTTGGGGACATAATGAGGCTGG - Intergenic
980485124 4:133447051-133447073 ATGTAGGGACCAAAGCAAGCTGG - Intergenic
980581443 4:134759063-134759085 TTTTGGGGAAAAAAGGAAGGAGG - Intergenic
985477374 5:85737-85759 CTCTGGGGACAAACAGAACCAGG - Intergenic
985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG + Intergenic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
990312422 5:54552834-54552856 CTATGGGGAAAAAACTAAGCGGG + Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
996547757 5:124698428-124698450 CTGTGGTGACAAGAAGGAGCTGG - Intronic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
998833301 5:146181717-146181739 CTGTGGGGAAAAAATAGAGCAGG - Intronic
998988358 5:147787475-147787497 TTGTGGGGTGAAATGGAAGCAGG + Intergenic
999243939 5:150143525-150143547 CTGTGGGGGCAAGAGGCATCTGG + Intronic
999633965 5:153600674-153600696 CTGGGGGGCCAAAGGGAAACTGG + Intronic
999743095 5:154571786-154571808 CTGTGGAAACAAAAGGAACCTGG - Intergenic
1000786713 5:165553916-165553938 CACTGGGGACAAAATGATGCAGG - Intergenic
1001240232 5:170063320-170063342 CTCTGGGAACAGAAGGGAGCAGG + Intronic
1001379525 5:171294472-171294494 GTGTGGGTTCAAGAGGAAGCTGG - Intronic
1001435592 5:171696792-171696814 CTGTGGGGCCACATGGAACCTGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001581902 5:172804697-172804719 CTGTGGTGAGAAAATAAAGCAGG + Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002484400 5:179524431-179524453 CCGTGGGGACACATGGAAGCTGG - Intergenic
1002500175 5:179643057-179643079 CCGTGGGGACACATGGAAGCTGG + Exonic
1002501797 5:179651704-179651726 CCGTGGGGACACATGGAAGCTGG - Intergenic
1003651081 6:7961041-7961063 CTGTGGGGTGAAGAGCAAGCAGG - Intronic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1005836066 6:29710565-29710587 CTGCAGGGCCAAAAGGAACCAGG + Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1006183973 6:32170020-32170042 CTATGGGGACAATGGGAACCTGG + Exonic
1006358004 6:33572113-33572135 CTGTGGAGACATCAGGAAGGGGG + Intergenic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1007091683 6:39188763-39188785 CTGTGGGGAGGTAAGGACGCGGG - Intergenic
1011220254 6:85047617-85047639 CTTTGGGGACTAAAGGAACAGGG + Intergenic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1014017602 6:116551123-116551145 GTCAGGGGACAGAAGGAAGCAGG - Intronic
1015749142 6:136542737-136542759 CTGTGGGGAAAAAAGAATGAAGG + Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016973835 6:149787727-149787749 CTGTGTGGACAAAAGTACACAGG - Intronic
1017421525 6:154277874-154277896 CTGGGCGGACCACAGGAAGCTGG - Intronic
1017569927 6:155732995-155733017 CTGTGGGGACTCAAGGAAACTGG - Intergenic
1017711073 6:157168603-157168625 CTCTGGGGTCCAAAGGAAGACGG - Intronic
1018176713 6:161183844-161183866 CTCTGGGGACATGGGGAAGCAGG + Intronic
1018437943 6:163779965-163779987 CAGTGGGAATAAAAGAAAGCTGG + Intergenic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021578267 7:22125302-22125324 CTGTGGGGACAGGAGTCAGCGGG + Intronic
1021839134 7:24708016-24708038 CTGTAGGGAGAAAAGGAGGCGGG + Intronic
1022957084 7:35390874-35390896 CTGTGGGGACTGAAGGAGCCGGG + Intergenic
1023027203 7:36061632-36061654 CTGCTGGGACATAAGGTAGCAGG - Intergenic
1023264959 7:38394662-38394684 GTTTGGGAACAAAAGGAAGGTGG - Intronic
1023654296 7:42404384-42404406 CTGTGGGGTGCAAAGGAGGCAGG - Intergenic
1023712821 7:43013068-43013090 CTGTGTGGACAAAACCCAGCTGG + Intergenic
1023914677 7:44580146-44580168 GTGTCAGGACAAAAGGAAACGGG + Intronic
1025306979 7:57869121-57869143 CGGCGGGGGCAAAAGGCAGCGGG + Intergenic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1026948001 7:74328374-74328396 CTTTGGGGCCACCAGGAAGCGGG + Intronic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027050799 7:75020018-75020040 CTCTGGGGACCAGAGGCAGCTGG - Exonic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1030580113 7:111344361-111344383 CTGAAGGAAGAAAAGGAAGCAGG - Intronic
1031227554 7:119059986-119060008 CTGTTGTGAAAAAACGAAGCAGG + Intergenic
1032469287 7:132166578-132166600 CTGCCGGCACAAAATGAAGCTGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033899412 7:146116736-146116758 GTGAGGGGAGAAGAGGAAGCGGG + Exonic
1034020705 7:147639083-147639105 CTGTGGGGAGAAAAACAACCAGG - Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1035066042 7:156105689-156105711 CTGTGGAGCCAAAATGATGCGGG - Intergenic
1036384120 8:8263033-8263055 CTGAGGTGGCAAATGGAAGCCGG + Intergenic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038322265 8:26538468-26538490 CTGTGGGGGAAAAAGGGAGCGGG + Intronic
1038436661 8:27541209-27541231 CTTTTGGGACACAAAGAAGCCGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039578329 8:38643547-38643569 GGGAGGGGACAAAAGGAAGGAGG + Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041213800 8:55579684-55579706 ATATTGGGACAAAAGGAAACGGG - Intergenic
1041289342 8:56293991-56294013 GTTTGGGAACAAAAGGAAGGCGG + Intergenic
1041470131 8:58198863-58198885 TTGTAGGGACAAGATGAAGCTGG - Intronic
1042467619 8:69146037-69146059 TTGTGGTGACTAAAGGAAGTGGG + Intergenic
1042705720 8:71664178-71664200 CTGAGGGGTCAAAAAGCAGCAGG - Intergenic
1043338283 8:79204330-79204352 CAGTGGGATCAAAATGAAGCAGG + Intergenic
1043499991 8:80843789-80843811 CTCTGGGGAAAAAAGGAGACTGG - Intronic
1045734388 8:105277907-105277929 CTTCAGGGACAAGAGGAAGCTGG + Intronic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047625575 8:126652754-126652776 CTGTGGGGGCAAGAGAAAGAAGG - Intergenic
1048008408 8:130437769-130437791 CCGTGGGCACAACAGGAAGAAGG - Intronic
1048303269 8:133266737-133266759 CTGCGGGGACAAAGGGGACCTGG - Intronic
1049133129 8:140867238-140867260 CAATGGGGACCAAAGGAAGAAGG + Intronic
1049138138 8:140924319-140924341 CTGTGGGAATAAAATGAAGCAGG - Intronic
1049294050 8:141820676-141820698 CTCTGGGGATCAAAGGAGGCTGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049658426 8:143809026-143809048 CTGTGCGGACAAAAGGGTGAGGG + Intronic
1049814390 8:144591401-144591423 CTGGGGGGACCAAAGGTAGCAGG + Intronic
1051153098 9:14106809-14106831 CTTTGGGAACAAAAGAAAGAAGG + Intronic
1051802346 9:20949858-20949880 CTTTGGGAAAAAAAGAAAGCTGG + Intronic
1052197019 9:25730201-25730223 CTGTGGAGACCCAAGAAAGCAGG + Intergenic
1052295714 9:26894492-26894514 ATGTGGGGACAAGAAGAAGAGGG - Intergenic
1052354680 9:27492203-27492225 CTGTGGGGTAAAAATGAAGGGGG + Intronic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053001002 9:34577391-34577413 CAGTGGGGACAAAAGAAACCAGG + Intronic
1053172185 9:35896042-35896064 CTTTGGGGCCAGAAGGAACCAGG + Intergenic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1055668222 9:78573460-78573482 CTTTGGGGACAAATGCCAGCTGG + Intergenic
1056885960 9:90444097-90444119 CTGTGGTCACACATGGAAGCTGG - Intergenic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1058337006 9:103842403-103842425 CTATGGGGAGAAAAGGAAACTGG - Intergenic
1058909750 9:109509959-109509981 TTGTGGGTACAAAAGAGAGCCGG - Intergenic
1060858235 9:126933103-126933125 GTGAGAGGACAAAAGGAAGGCGG + Intronic
1061082780 9:128382205-128382227 CTCTGGGCACAACAGGAACCAGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061624436 9:131833448-131833470 CTGAGGGAACAAAAAGAGGCTGG - Intergenic
1061681787 9:132246067-132246089 CTGTGGGCGCCAAAGGAGGCAGG - Intergenic
1062172680 9:135144221-135144243 CTGGGGGGACCCTAGGAAGCAGG - Intergenic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1187491728 X:19758462-19758484 CTCTGGGCACCAAAGAAAGCTGG - Intronic
1187770606 X:22691751-22691773 CAGTGGGGACAACAGAAGGCTGG - Intergenic
1189690861 X:43615607-43615629 CTGTGGATAGTAAAGGAAGCCGG + Intergenic
1191133603 X:57040900-57040922 CTGTGGGTGCAGAAGTAAGCAGG + Intergenic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1198148386 X:133882222-133882244 CACTGGTTACAAAAGGAAGCAGG - Intronic
1199142898 X:144333326-144333348 CTATAGGGAGAAAAGGAACCCGG + Intergenic
1199253527 X:145692670-145692692 CTGTGGGGTGAAAAAGAAGAAGG - Intergenic
1200090515 X:153633795-153633817 CTGTGGGGCCAACAGGGAGGAGG + Intergenic