ID: 1001521865

View in Genome Browser
Species Human (GRCh38)
Location 5:172400134-172400156
Sequence GTTTCAAAGGAGAAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 20, 2: 34, 3: 53, 4: 552}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001521865_1001521874 -1 Left 1001521865 5:172400134-172400156 CCTCTCCCTTTCTCCTTTGAAAC 0: 1
1: 20
2: 34
3: 53
4: 552
Right 1001521874 5:172400156-172400178 CAAATGAAAGGGGGAGTACTGGG 0: 1
1: 21
2: 30
3: 17
4: 154
1001521865_1001521873 -2 Left 1001521865 5:172400134-172400156 CCTCTCCCTTTCTCCTTTGAAAC 0: 1
1: 20
2: 34
3: 53
4: 552
Right 1001521873 5:172400155-172400177 ACAAATGAAAGGGGGAGTACTGG No data
1001521865_1001521872 -10 Left 1001521865 5:172400134-172400156 CCTCTCCCTTTCTCCTTTGAAAC 0: 1
1: 20
2: 34
3: 53
4: 552
Right 1001521872 5:172400147-172400169 CCTTTGAAACAAATGAAAGGGGG 0: 1
1: 21
2: 21
3: 39
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001521865 Original CRISPR GTTTCAAAGGAGAAAGGGAG AGG (reversed) Intronic
900811993 1:4811206-4811228 GGTTGAGGGGAGAAAGGGAGAGG + Intergenic
900834425 1:4989346-4989368 GCTTCAGGGGAGAAAGGCAGAGG - Intergenic
900935824 1:5765832-5765854 GTTCCAAAGGATAAAGTTAGAGG + Intergenic
902109436 1:14065769-14065791 ATCTCAAAGCAGAAAGGGAAAGG + Intergenic
902517615 1:16997836-16997858 GTCTCAAAAGAGGAGGGGAGGGG + Intronic
903529975 1:24022673-24022695 TTTTAAAGGGAGAATGGGAGTGG - Intergenic
904458780 1:30663262-30663284 GGATCAAAGGAGGAAAGGAGGGG - Intergenic
904779669 1:32936082-32936104 GCTTCAGAGGAGAGAAGGAGTGG - Intergenic
904797426 1:33067544-33067566 GTTTGTAAGGAGAAAAAGAGAGG - Intronic
904797470 1:33068024-33068046 GTTTTAAAGGAGAAAGTGAGTGG - Intronic
906195194 1:43925934-43925956 GTTTCAAAGGAATAGTGGAGTGG + Intronic
906577690 1:46905520-46905542 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
906633681 1:47393398-47393420 GTTACAGAGGAGGAAGGCAGTGG + Intergenic
906793284 1:48677347-48677369 TTTTCAAAGGATGAAGGAAGAGG + Intronic
907540430 1:55212005-55212027 CTTTCAAAGGAAAAAGGAATGGG - Intronic
907661938 1:56401256-56401278 GAATCAAAGGAGAAAGGCAGAGG + Intergenic
907700457 1:56781827-56781849 ATTTTAAAGGAGAAAGGGGTTGG - Intronic
908732447 1:67240065-67240087 GTCTCAAAGGAGAAAGGGTGGGG - Intronic
908844121 1:68307152-68307174 GCTTCAGGGGAGAAAGGGTGAGG + Intergenic
908994361 1:70133549-70133571 TTCTCAAAGGAGAAAGGAAAGGG - Intronic
909167721 1:72249725-72249747 TTTTGAAAGGAGAAAGAGGGAGG + Intronic
909227257 1:73041650-73041672 GTTTCAAGGGAGAAGGAAAGGGG - Intergenic
909319332 1:74263503-74263525 GTTTCAAAGGAGGTAGGATGAGG + Intronic
909326442 1:74357081-74357103 GTTTCAAAGGATACGGGGACAGG - Intronic
910023088 1:82616683-82616705 ATTTCAAGGGAGAAAAGGAGAGG - Intergenic
911386346 1:97179911-97179933 GTTTCTAAGAAGAAAAGGAAAGG + Intronic
912442179 1:109707644-109707666 GTCTTAAAGGACAAAGGGAGAGG - Intronic
913681330 1:121188594-121188616 GTTTCAGAGTACAGAGGGAGGGG + Intronic
913709615 1:121469571-121469593 GGTTCAAGGGACAAAGGCAGAGG + Intergenic
914033161 1:143976235-143976257 GTTTCAGAGTACAGAGGGAGGGG + Intergenic
914156285 1:145091731-145091753 GTTTCAGAGTACAGAGGGAGGGG - Intronic
915362964 1:155296818-155296840 GGTTCAAGGGAGAATGGGGGAGG - Intronic
916009169 1:160689076-160689098 GTTTTAAAGGAGAAAGGGAGAGG + Intronic
916718378 1:167463449-167463471 TTTTAAAAGGAGAAAGGGAGAGG + Intronic
917154376 1:171980589-171980611 GAGGCAAAGGAGATAGGGAGAGG - Intronic
917642757 1:176998711-176998733 ATTTCAAAGGAGGATGTGAGAGG + Intronic
918086811 1:181252520-181252542 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
918932123 1:190867753-190867775 GTTTCTAAGAATAACGGGAGAGG - Intergenic
919183207 1:194112015-194112037 GGTTCAAAGGAGCAAGCGGGCGG - Intergenic
919940086 1:202280535-202280557 CTATTAAAGGAAAAAGGGAGAGG - Intronic
920189819 1:204186430-204186452 GTTTCAAAAAAAAAAGAGAGTGG - Intergenic
920353352 1:205352346-205352368 GTGCCAGAGGAGAAGGGGAGAGG - Intronic
920468646 1:206207120-206207142 GTTTCAGAGTACAGAGGGAGGGG + Intronic
920503648 1:206501281-206501303 GTGAGAAAGGAGAGAGGGAGGGG + Intergenic
920585182 1:207152240-207152262 CTTTGAGAGGACAAAGGGAGAGG + Intergenic
920770752 1:208882758-208882780 TTGTCAAAGGACAAAGGGATAGG + Intergenic
920831059 1:209466169-209466191 CTTTCAAAGGAGAAACAGAATGG + Intergenic
921090648 1:211838923-211838945 TTTTCACAAGAGAAGGGGAGAGG + Intergenic
921221968 1:212979834-212979856 GTTCGTAAAGAGAAAGGGAGAGG + Intronic
921321323 1:213942555-213942577 ATTGCAAAGGAGATAGGTAGAGG - Intergenic
921417478 1:214907047-214907069 GATACAAAGGAAAAAGGGAAGGG - Intergenic
923924622 1:238610652-238610674 GTTCTAAAGGAGAATGAGAGTGG + Intergenic
924667199 1:246085413-246085435 TTTTCAGGGGAGAAGGGGAGGGG - Intronic
1063186353 10:3655538-3655560 CTTTCATAGCAGAAAGGGAGAGG + Intergenic
1063773192 10:9228087-9228109 GTGTCCTAGAAGAAAGGGAGGGG - Intergenic
1065608469 10:27446156-27446178 ATTTTAAAGGAGAAAGGAAGAGG + Intergenic
1065663028 10:28025917-28025939 ATTCCAAAGGAGAAAGAAAGAGG + Intergenic
1065829589 10:29602683-29602705 TTTTTAAAAAAGAAAGGGAGAGG + Intronic
1068129917 10:52884581-52884603 TTGAAAAAGGAGAAAGGGAGCGG - Intergenic
1068485944 10:57658282-57658304 GTCTCAAAAGAGAAAGAGGGAGG + Intergenic
1068528954 10:58163357-58163379 TTATGAAAGGAGCAAGGGAGAGG + Intergenic
1068898305 10:62233123-62233145 CTTTCATATGAGAAAGTGAGGGG + Intronic
1069162526 10:65108952-65108974 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1069435435 10:68377848-68377870 GTTTTAAGGAAGAAAGGAAGAGG - Intronic
1069684016 10:70305639-70305661 TTTCCAAAGGAAAAAAGGAGGGG - Intronic
1069977986 10:72231127-72231149 GTTTCAATGGAGAAATGGTCTGG - Intronic
1070118578 10:73553088-73553110 GTTTCAGTAGAGAAAGGGAAAGG + Intronic
1070576963 10:77686750-77686772 GTTTCAAAAGAGGAATGGATTGG - Intergenic
1071426603 10:85561678-85561700 GTTTTAAAGAAGCAAGGTAGGGG + Intergenic
1071584747 10:86809290-86809312 GTCTCAAAAAAAAAAGGGAGGGG - Intronic
1071806353 10:89125111-89125133 GTTTGGAAGGAGAAAGTGATAGG + Intergenic
1071908719 10:90205317-90205339 ATTTGAATGGAGAAAGAGAGAGG + Intergenic
1071941090 10:90592702-90592724 TTTTGAATGGAGAAGGGGAGGGG - Intergenic
1072340447 10:94443220-94443242 CCTTCAAAAGGGAAAGGGAGGGG - Intronic
1073354205 10:102840886-102840908 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1073771109 10:106736746-106736768 GTTTCTTAGGCTAAAGGGAGAGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1075515648 10:123105977-123105999 TTTTTATAGGAGAAAGAGAGAGG + Intergenic
1075945853 10:126432530-126432552 GTGTCAAAGGGGGAATGGAGAGG + Intronic
1076334321 10:129694783-129694805 AGCTCAAAGGAGAAAGGGAGGGG + Intronic
1076418350 10:130308732-130308754 GTTTCAAAGGAGTTTTGGAGGGG + Intergenic
1077143672 11:1035629-1035651 GCTTCAAAGGAGAGAAGGGGTGG + Intronic
1078709813 11:13780061-13780083 GTGTCAAAGCAGCAAGGGTGAGG + Intergenic
1078754965 11:14200563-14200585 GATTCATAGGAGAGAGGCAGAGG + Intronic
1078839532 11:15065491-15065513 GTTTTAAAGGAGAAAGGGAGAGG + Intronic
1080110320 11:28559528-28559550 GTTGGAAAGCAGAAAGAGAGGGG - Intergenic
1080173790 11:29338162-29338184 GTACTAAAGGAGAAAGGAAGAGG + Intergenic
1080831502 11:35897354-35897376 GCTACAAAACAGAAAGGGAGAGG + Intergenic
1081301919 11:41463086-41463108 GTTTCAGGGGAGAAGGGAAGAGG - Intergenic
1081419784 11:42862190-42862212 GAGTCAAAGGAGGAATGGAGAGG - Intergenic
1082124597 11:48416933-48416955 GTTTCCAGGGAGAAAAAGAGGGG + Intergenic
1082296388 11:50445464-50445486 GTTTTAAAGGAGATAGGGAGAGG - Intergenic
1082299618 11:50490348-50490370 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1082309734 11:50632030-50632052 GTTTTAAAGGAGAAAGAGAGAGG + Intergenic
1082572834 11:54763656-54763678 GTATTAAAGGAGAAAGGGAGAGG - Intergenic
1082802018 11:57421689-57421711 GTGTCAAGGATGAAAGGGAGAGG - Intronic
1084223988 11:67703617-67703639 GTCTTAAAGGAGAAAGGGAGGGG - Intergenic
1085945596 11:81268038-81268060 GTTTCAAAGGCTATAGGAAGTGG - Intergenic
1086852298 11:91823798-91823820 GTTTTAATGGAGACAGGGATTGG - Intergenic
1087680487 11:101213999-101214021 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1088147451 11:106699262-106699284 TTTTTAATGGAGAAAGGGAAAGG + Intronic
1088234827 11:107711891-107711913 GCTGCAAATGAGAAAGGCAGAGG - Intronic
1088354894 11:108932513-108932535 GATTCAATGGAGAATGGAAGAGG - Intronic
1089121111 11:116136013-116136035 GCTTCAAGGAAGAAAGGCAGTGG - Intergenic
1089173709 11:116533646-116533668 GTTTGGAAAGAGAAAGGGTGAGG + Intergenic
1089787654 11:120919767-120919789 GTTTCAGAGGTAAAAGGGATGGG + Intronic
1089976274 11:122734373-122734395 ATTCCCAAGGAGAAAGGAAGAGG + Intronic
1090445822 11:126763829-126763851 TTTTCAAAGTAGGAAAGGAGAGG - Intronic
1090641077 11:128729195-128729217 GGTTCAAAGAAAAAAGGTAGGGG + Intronic
1091148967 11:133308431-133308453 GATTCAAATAAGAAAAGGAGAGG + Intronic
1091252960 11:134159289-134159311 GTTAAAATGGAGAAAGGGAATGG - Intronic
1091772905 12:3164886-3164908 GTCACAAAGCAGAAATGGAGAGG - Intronic
1091894224 12:4088026-4088048 GTTCCAAAGGAGAATGCCAGGGG - Intergenic
1092386282 12:8038036-8038058 GTTTGACAGGAGAAAAGGGGCGG - Intronic
1093584897 12:20822895-20822917 TTTTAAAAGGAAAAAGGCAGGGG - Intronic
1094499954 12:31012326-31012348 GTTTCCAAGGGGCAGGGGAGAGG - Intergenic
1094641538 12:32280600-32280622 GTTTTTAAGTAGAAAGGGGGAGG + Intronic
1094865744 12:34528412-34528434 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1095851177 12:46808570-46808592 TTTTCAAAGGTGAAAGGCAGAGG - Intronic
1096408873 12:51363049-51363071 GTTTGAAAGGAGGAAAGGATTGG - Intronic
1096447812 12:51710119-51710141 GTTTTTAAGAAGAATGGGAGAGG + Intronic
1096633520 12:52944694-52944716 TTTTCCAAGGATAAAGGAAGAGG - Intronic
1097739432 12:63222032-63222054 GGTTGAAGGGAGGAAGGGAGAGG + Intergenic
1097780632 12:63699946-63699968 GTTGCAAAGGAGAATGTGAGGGG - Intergenic
1098054049 12:66484668-66484690 GTTGGAAAGGAGAAGGGGCGGGG + Intronic
1098340874 12:69449748-69449770 GATTCAAGAGAGAATGGGAGTGG + Intergenic
1098543261 12:71683515-71683537 ATCTCCAAGGATAAAGGGAGTGG - Intronic
1099018774 12:77377795-77377817 GTAACAAGGGAGATAGGGAGTGG + Intergenic
1099186156 12:79517441-79517463 GTTTCCAGAGAGAAAGGGAGAGG + Intergenic
1099555335 12:84102791-84102813 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1100052893 12:90471706-90471728 GCAGCAAAGGAGAAAGGTAGAGG - Intergenic
1100566925 12:95805065-95805087 TCTTCAAAGCAGAGAGGGAGAGG + Intronic
1100608736 12:96172890-96172912 GGTTCAGAGGAGGAAGGGATGGG + Intergenic
1101501893 12:105311889-105311911 GTTTTAAACAAGAAAGGGAGAGG - Intronic
1102053826 12:109881317-109881339 GTTACAAAGTATAAATGGAGAGG - Intergenic
1102198512 12:111041665-111041687 GGTCCAATGGAGAAGGGGAGTGG + Intronic
1102458814 12:113087569-113087591 CCTAGAAAGGAGAAAGGGAGAGG + Intronic
1103179069 12:118891991-118892013 GGTTCCAAGAAGGAAGGGAGAGG - Intergenic
1103907172 12:124333711-124333733 GGGTCAAAAGAGAAAGAGAGGGG - Intronic
1104576920 12:129974384-129974406 GGGTCAAAGGAGACAGGGTGAGG + Intergenic
1105689205 13:22818988-22819010 GATGCCAAGGAGAAATGGAGAGG - Intergenic
1105923930 13:24989278-24989300 GGTTGAAAGGAGCAAGGGTGGGG - Intergenic
1106266772 13:28117768-28117790 GTTTAATAGAAGAAAGAGAGAGG - Intergenic
1106669854 13:31892788-31892810 GTCTCAAATGAGCAAGTGAGAGG - Intergenic
1107403030 13:40087488-40087510 GTGACAAAGCAGAAAGGGAGGGG + Intergenic
1107441572 13:40432339-40432361 ATTTCAGAAGAGAAAGGGAGTGG - Intergenic
1107913538 13:45127059-45127081 GTCTCAAAAGAGGGAGGGAGAGG - Intronic
1109352515 13:61202797-61202819 ATCACAAAGGAGAAAGGCAGTGG + Intergenic
1109529498 13:63623428-63623450 GATTCAAAGGAGAATAGGAATGG + Intergenic
1110841693 13:80151503-80151525 GTTTTAAGAAAGAAAGGGAGTGG + Intergenic
1111386208 13:87531438-87531460 TGTTCAAAGGAGATAGAGAGAGG + Intergenic
1111467999 13:88643047-88643069 GATTCCTAGGAGAAAGGGATGGG + Intergenic
1112343881 13:98575544-98575566 GTTTCAAAAAAAGAAGGGAGAGG + Intronic
1112400807 13:99076953-99076975 GTTTCAAAGGCCAGAGAGAGTGG + Intronic
1112996568 13:105581368-105581390 GTTTCCCAGGAGTAAGGAAGAGG + Intergenic
1113090773 13:106615719-106615741 GTTAAAAAGCAGAAAGGAAGTGG - Intergenic
1114700474 14:24673193-24673215 GTTTCACAGGAGAAGTGGAAAGG + Intergenic
1115613793 14:35073796-35073818 GATTCAAGGCAGAAAGGGATAGG - Intronic
1116466500 14:45239504-45239526 ATTTGAAAGGAGTAAGTGAGAGG + Intronic
1116666131 14:47778005-47778027 TTAACAAATGAGAAAGGGAGAGG - Intergenic
1116859504 14:49982480-49982502 GTGTCTACGGAGAAAAGGAGGGG - Intronic
1116992219 14:51288470-51288492 GCTTAAAGGGAGAAAGAGAGTGG - Intergenic
1117158133 14:52961079-52961101 GTTACAAAGGACAAAGGGTAGGG - Intergenic
1117307540 14:54491009-54491031 GTTACAGAGGAGGAAGGCAGTGG + Intergenic
1117983865 14:61368111-61368133 ATTTCTAAGGAGAAAGTCAGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119372128 14:74155560-74155582 GTCTCCAAGGAAAAGGGGAGGGG - Intronic
1120568092 14:86083899-86083921 GGTTTAAAGGAGAAAGGGAGAGG + Intergenic
1120701764 14:87706015-87706037 GTCTAAAAGGAGCAAGGGAGAGG - Intergenic
1121127284 14:91416668-91416690 GTTTGAGAGTAGAAATGGAGTGG - Intronic
1121723186 14:96126463-96126485 GCTTCAAAGGGAAAAGGAAGGGG + Intergenic
1122424572 14:101598388-101598410 GTGTCAGAGAAGAAAGGAAGTGG + Intergenic
1123820380 15:24023788-24023810 GTTATAGAGGAGAAAGGCAGTGG + Intergenic
1124187111 15:27540982-27541004 GATAAAAAGGAGCAAGGGAGAGG + Exonic
1124887340 15:33699422-33699444 GTTTCCAAGTAGGAAGGGAGTGG - Intronic
1124943187 15:34237352-34237374 GATTCAAGGAAGACAGGGAGAGG + Intronic
1125403139 15:39325531-39325553 GATGCAAAGGGGAACGGGAGAGG - Intergenic
1125567671 15:40689495-40689517 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1126538382 15:49794256-49794278 GTTTCTAATGACAAAGGAAGTGG + Intergenic
1127703479 15:61524921-61524943 CTTTCAAAGGAGGGAGGGAAGGG + Intergenic
1127991086 15:64117957-64117979 GTTTACAAGGAGAAAAGGGGAGG - Intronic
1128003829 15:64219459-64219481 GTCTCAAAAGAAAAAAGGAGAGG - Intronic
1128304641 15:66590038-66590060 GTTTTAAAGGAAAAAAGAAGAGG - Intronic
1128553889 15:68616925-68616947 GTTTCAAAGGAAGAAGGGAAAGG + Intronic
1128579921 15:68802425-68802447 GTTGCAAAGAAGAAACGAAGAGG - Intronic
1129947435 15:79551550-79551572 GTATCAATGAAGAATGGGAGGGG + Intergenic
1130451809 15:84062318-84062340 TTCCAAAAGGAGAAAGGGAGAGG - Intergenic
1130635495 15:85615748-85615770 GTTTCAGAGGAGAAAGAAAAAGG - Intronic
1130909351 15:88260501-88260523 CTAGCAAGGGAGAAAGGGAGTGG + Intergenic
1131017842 15:89072471-89072493 GTCTCAAAAGAGGAAAGGAGGGG + Intergenic
1131292104 15:91115372-91115394 GTTTCAAAAAAAAAAGGAAGGGG - Intronic
1131430399 15:92383617-92383639 GGGTCAAAGGAGAAAGTGAGAGG - Intergenic
1131869221 15:96744347-96744369 GTTTCTAAGGAAAAAGTGAAAGG - Intergenic
1132830758 16:1926912-1926934 TTTTACAAGGAGACAGGGAGTGG + Intergenic
1132994898 16:2817725-2817747 GTTGAAGGGGAGAAAGGGAGAGG + Intronic
1133305075 16:4803381-4803403 GGTTTAAAGAAAAAAGGGAGGGG + Exonic
1133565270 16:6987312-6987334 TTTTCAAAGGAGGAAGTGAGTGG + Intronic
1133859574 16:9581654-9581676 GTTTCAGGGGAGAAAGGAAGGGG + Intergenic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1134428662 16:14179309-14179331 GTTTCAACAGAGAAAAGGAATGG - Intronic
1134461779 16:14435850-14435872 GTTTCAACGGAGAATGGGCTGGG + Exonic
1135408237 16:22213749-22213771 GCTTCAAAGATGGAAGGGAGGGG - Intronic
1137020889 16:35426015-35426037 GTTTCCAGGGAGAAAAAGAGAGG + Intergenic
1137027558 16:35492975-35492997 GTTTCCAGGGAGAAAAAGAGAGG + Intergenic
1138767764 16:59624466-59624488 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1138767810 16:59624934-59624956 GTTTGTAAGGAGAAAGAGAAAGG + Intergenic
1138813555 16:60178418-60178440 GTTTCTAAAGAGAAAGGTGGAGG - Intergenic
1139073100 16:63408021-63408043 GTTTAAAAGGAGCTAGGCAGAGG - Intergenic
1140171542 16:72610103-72610125 GTTTCAGTGGAGAAAGGTTGGGG + Intergenic
1140186771 16:72780597-72780619 GTAACAATGGAGAAAGGCAGCGG - Intergenic
1140801457 16:78492013-78492035 TTCTCAATGGACAAAGGGAGTGG + Intronic
1141380188 16:83569260-83569282 GTTCCAATGGGGAGAGGGAGGGG - Intronic
1142616070 17:1136089-1136111 GTTTCAAAGGACAGAAGGACAGG - Intronic
1142680508 17:1545177-1545199 GCTTCAAGGGAAAAAGAGAGAGG + Intronic
1143485599 17:7251995-7252017 GTGTCAAAGGGGAAGAGGAGGGG - Exonic
1143709560 17:8724997-8725019 GTTTCAAAGGTGAAAGCTAAGGG + Intergenic
1143709677 17:8725669-8725691 GTTTCAAAGGTGAAAGCTAAGGG + Intergenic
1143929911 17:10411557-10411579 GATTCAAAGGTAAAAGGGAAAGG + Intronic
1144461851 17:15464660-15464682 GTTTGAAAGCAGAAGGGGAAGGG - Intronic
1145801487 17:27688763-27688785 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1146015229 17:29227834-29227856 GTTTCGAAAGAGCAAGGAAGGGG - Intergenic
1146674153 17:34761340-34761362 GTTGAAGAGGAGAAAGGGAGAGG + Intergenic
1146759688 17:35466315-35466337 GTTTCCAAGGATTAAGGGAGTGG - Intronic
1147140570 17:38458504-38458526 GCTTCTCAGGAGACAGGGAGGGG + Intronic
1147762247 17:42806505-42806527 GTTTTAAAGGACAAAGGTAGAGG - Intronic
1147762699 17:42810501-42810523 TTTTCAGAGAAGAAAGGGAAAGG + Exonic
1147819324 17:43232250-43232272 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147819914 17:43235281-43235303 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147821227 17:43242679-43242701 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147822030 17:43247168-43247190 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147824490 17:43261657-43261679 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147825634 17:43268127-43268149 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147826765 17:43274594-43274616 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147827654 17:43279472-43279494 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147828761 17:43285633-43285655 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1147829856 17:43291776-43291798 GTTAGGAAGGAGGAAGGGAGAGG - Intergenic
1148028795 17:44606093-44606115 GTGTCGTAGGAGAGAGGGAGAGG + Intergenic
1148096589 17:45056768-45056790 GTCTCAAAGGAAAAAGGGCCAGG - Intronic
1148230231 17:45928312-45928334 GTTAGCAAGGTGAAAGGGAGGGG - Intronic
1148385347 17:47230564-47230586 ATGTCTAAGGAGCAAGGGAGAGG + Intergenic
1148394198 17:47295396-47295418 GTGGAAGAGGAGAAAGGGAGGGG - Intronic
1148566538 17:48636241-48636263 TCTTCAAGGAAGAAAGGGAGTGG - Intergenic
1148718187 17:49730731-49730753 TTTCCAAAGGATAAAGGGAATGG + Intronic
1150156223 17:62855653-62855675 GCCACAAAGGAGAAGGGGAGAGG - Intergenic
1151469327 17:74308220-74308242 ATTGCAATGGAGGAAGGGAGAGG + Intronic
1151904211 17:77037073-77037095 TTTTCAAAAGAGGAAGGCAGCGG + Intergenic
1152422757 17:80202952-80202974 TTTTCAATGGAGCAAGGCAGGGG - Intronic
1153030667 18:710508-710530 GTTTCTAAAGAAAAAAGGAGGGG - Intronic
1153203957 18:2676648-2676670 GTTTCAAAATAAAAAGGGTGGGG - Intronic
1153646974 18:7204220-7204242 CGTGCAAAGGAGAGAGGGAGAGG + Intergenic
1153987742 18:10368401-10368423 TGTCCAGAGGAGAAAGGGAGTGG + Intergenic
1154173119 18:12064728-12064750 GGTTCAAAGTAGAAGGGGTGAGG + Intergenic
1154406176 18:14093295-14093317 GTTTTAAAGGAGAAAGCGGCAGG - Intronic
1156117819 18:33807969-33807991 GGATAAAAGGAGAAAGTGAGAGG - Intergenic
1157756550 18:50222905-50222927 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1157945346 18:51973066-51973088 GTCTCCAAGGAGAAAGGTATGGG + Intergenic
1158268141 18:55682722-55682744 GTTTGAAAGTAGACAGGGTGTGG + Intergenic
1158826832 18:61230602-61230624 GTTGCCAAGGATAAGGGGAGGGG + Intergenic
1158849318 18:61478896-61478918 GTTTCACAGGATCAAGGAAGTGG - Intronic
1159016860 18:63108119-63108141 GCTCCAAAGGAGAAAGGATGAGG - Intergenic
1159562830 18:70013837-70013859 GTGTCCTAGGAGAATGGGAGAGG - Intronic
1160172833 18:76568716-76568738 TTTTCAAATGAGGAGGGGAGTGG + Intergenic
1161831053 19:6604810-6604832 GTTTCATAGGCGAAAGAAAGAGG + Intergenic
1161930162 19:7334040-7334062 GTTTCTTAGGAGAATGGGAGGGG - Intergenic
1162764978 19:12913588-12913610 GTTTCCAGAGAGAAAAGGAGAGG - Intronic
1163941862 19:20502491-20502513 GTCTTAAAGGAGAAAGAGAGAGG + Intergenic
1164288953 19:23849928-23849950 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1164330241 19:24247499-24247521 GTTTTAAAGGATAAAGGGAGAGG - Intergenic
1164377955 19:27705975-27705997 GTTTTAAAGGAGAAAGAGAGAGG + Intergenic
1165290124 19:34876822-34876844 GTTTGAAAAGAAAAAGGGGGCGG + Intergenic
1166107269 19:40603631-40603653 GTTTAGAAGGATAAAGGGACTGG - Intronic
1166839988 19:45691496-45691518 GTTTTAAACGATAACGGGAGTGG - Intronic
1167699691 19:51035205-51035227 CTTGCAGAGGAGAGAGGGAGTGG - Intronic
1168067683 19:53928052-53928074 GATAGAAAGGAGGAAGGGAGGGG + Intronic
1168310915 19:55460309-55460331 GTGCCAAAGAAAAAAGGGAGAGG + Intronic
926564872 2:14457661-14457683 GTATTAAATGAGAAAGGGAAGGG - Intergenic
927304148 2:21550967-21550989 GTTTCTAAGAAGAAATTGAGAGG + Intergenic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
928079917 2:28301720-28301742 GAGTCAAAGGAGACTGGGAGGGG - Intronic
928274237 2:29884938-29884960 GATTCAAGGGAGGAAGGGATAGG + Intronic
928428333 2:31197741-31197763 GTGTCAGAAGAGAAAGGGAGAGG + Intronic
928441878 2:31299062-31299084 GTTTAAATGAAGAAGGGGAGGGG - Intergenic
928579691 2:32695195-32695217 GTTGCAAGGGCTAAAGGGAGGGG - Intronic
928686226 2:33752572-33752594 GTATCACAGGAGAAAGAGAATGG - Intergenic
929670364 2:43872389-43872411 AATTTAAAGGAGAAAGTGAGAGG + Intronic
929920569 2:46168465-46168487 GCATAAAAGGAGAAAGGGAAAGG + Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930646357 2:53913024-53913046 ATTTCACATGAGGAAGGGAGAGG - Intronic
931600124 2:63994670-63994692 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
931781505 2:65582688-65582710 GTTTCGTAGGAAGAAGGGAGTGG + Intergenic
932144132 2:69304307-69304329 GTGTGACAGGAGAAAAGGAGAGG + Intergenic
932236048 2:70121923-70121945 GTGTCAAAGCAGGAAGTGAGAGG + Intergenic
932842123 2:75093100-75093122 AGTGCAAAGGAGAAGGGGAGAGG + Intronic
933045720 2:77534242-77534264 GTTTCAAAGGACAAGTGGACTGG + Intronic
933192036 2:79345482-79345504 GTATGAAAGGAGTAAAGGAGAGG - Intronic
934714192 2:96533829-96533851 TTTTCAAAGGAGAAATGAAGTGG - Intergenic
934968657 2:98745025-98745047 TGATCAAAGGAGAAATGGAGAGG + Intergenic
935142338 2:100364401-100364423 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
935715794 2:105937900-105937922 GTTTCAATGGACACAGGCAGGGG + Intergenic
936952305 2:117990270-117990292 TTTTCAAAGGACATAAGGAGTGG - Intronic
937112355 2:119376492-119376514 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
937630588 2:124097194-124097216 TTTTCAGATGAGAAAGGTAGAGG + Intronic
937971352 2:127551740-127551762 GATACAGAGGAGACAGGGAGGGG + Intronic
937979714 2:127607822-127607844 ATCTCCAAGGTGAAAGGGAGGGG - Intronic
938062668 2:128265163-128265185 ATTTCAAATGACAAAGAGAGTGG - Intronic
938175879 2:129128364-129128386 GTTAGGAAGGAGAAAGGAAGAGG - Intergenic
938549434 2:132366828-132366850 GTATCAAAGGATAAATGGATGGG + Intergenic
939259812 2:139792647-139792669 GATTCTAGGGAGAAAGGTAGAGG + Intergenic
939362691 2:141194141-141194163 GTTTCAAAGTAGAATGGAAGAGG - Intronic
940251275 2:151679326-151679348 GTAACGAAGGAAAAAGGGAGAGG + Intronic
940340386 2:152574553-152574575 GTCTCTAAGGAAAATGGGAGAGG - Intronic
940476108 2:154165086-154165108 ATTTCAAAGGAGAAAAGCACAGG + Intronic
940634450 2:156280969-156280991 GTCCAAAAGGAGACAGGGAGGGG + Intergenic
941411890 2:165167981-165168003 ATTTCAAGGGAGAAAGGATGAGG + Intronic
941424695 2:165327926-165327948 GTTTGTAAAGAGATAGGGAGAGG - Intronic
942158623 2:173158330-173158352 TTTTAAAGGGAGAAAGGGGGAGG + Intronic
942430490 2:175906357-175906379 GTTTCAAGAAAAAAAGGGAGAGG - Intergenic
942746596 2:179241259-179241281 GAAGCAGAGGAGAAAGGGAGGGG + Intronic
942813460 2:180023682-180023704 TTTGCAAAGGAGAAAGGAGGCGG - Intergenic
943030944 2:182684926-182684948 ATTCCCAATGAGAAAGGGAGGGG + Intergenic
943556451 2:189411407-189411429 CTTTTAAAAGAGAAAGGGAAGGG + Intergenic
943566181 2:189519514-189519536 GGTGCAAAGGAGAAGGGGAGGGG + Intergenic
943838522 2:192547583-192547605 TTTTCAAAGAAGAAAATGAGAGG - Intergenic
945523511 2:210859560-210859582 TTCTCAAAAGAGAAAAGGAGAGG + Intergenic
945628468 2:212240264-212240286 GCTTCAAAGGAGAAAGGTGAGGG - Intronic
945723395 2:213446937-213446959 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
945897586 2:215502000-215502022 GTTTTAAGGGAGAGAGGTAGGGG - Intergenic
945911022 2:215649390-215649412 GTCTCTAAGGAGGAAGAGAGAGG + Intergenic
946071089 2:217034971-217034993 GTTTCAAAGACTCAAGGGAGAGG - Intergenic
946115161 2:217455075-217455097 GTTTCATAGGAGACAGGAGGTGG + Intronic
946263162 2:218513792-218513814 ATTTCAAAAGAGAAAGTAAGTGG - Intronic
946866873 2:224048793-224048815 GTTTCCCAGGAGACAGGAAGAGG - Intergenic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
948544302 2:238716058-238716080 TTTGTAAAGGAGAAATGGAGAGG + Intergenic
948682769 2:239647569-239647591 GTTGCATGGGAGAAAGTGAGCGG - Intergenic
1169022680 20:2341190-2341212 GTTTCAATGTCCAAAGGGAGTGG + Intergenic
1169109718 20:3024365-3024387 GGATCAAAGGAGAAATGGACTGG + Intronic
1169588042 20:7108988-7109010 GTGTCAAAAGAGCAAAGGAGTGG - Intergenic
1169742334 20:8908411-8908433 GCTTCAAGGGAGAAGGGTAGGGG + Intronic
1170073936 20:12398504-12398526 TTTTGAATGGAGAGAGGGAGAGG + Intergenic
1170763484 20:19272081-19272103 GTTCTGATGGAGAAAGGGAGAGG - Intronic
1170934701 20:20799546-20799568 GCCTCAAATGAGAAAGAGAGTGG - Intergenic
1171011985 20:21513884-21513906 CTTTCAAAGAAGACAGAGAGAGG - Exonic
1171335915 20:24385256-24385278 GTTTCAAGGGAGAATGGAAAGGG + Intergenic
1173325772 20:42032190-42032212 GGCTCAAAAGAGAAAGGGATGGG + Intergenic
1173872232 20:46349294-46349316 CTCTCAAATGAGGAAGGGAGGGG - Intronic
1174643980 20:52069948-52069970 GTCTCAAAAAAGAAAAGGAGTGG + Intronic
1174926456 20:54765623-54765645 GTTTCAAATCAGAAAGGGCTGGG + Intergenic
1175112728 20:56660082-56660104 AGATAAAAGGAGAAAGGGAGGGG + Intergenic
1175587285 20:60151683-60151705 ATTTCAAAAGTGGAAGGGAGTGG - Intergenic
1175994498 20:62806004-62806026 GGTCCAAAGGGGAAGGGGAGGGG - Intronic
1176980366 21:15375048-15375070 GTTTTAAAAGAGAAAGAGAGAGG - Intergenic
1177319445 21:19501138-19501160 CTGGCAAAGGAGAAAGAGAGAGG + Intergenic
1177475413 21:21614442-21614464 GTTTCCAGGAACAAAGGGAGAGG - Intergenic
1177707927 21:24733441-24733463 ATTACAAATGAGAAAGGGAGGGG - Intergenic
1177900626 21:26910475-26910497 TTTTCATGGGTGAAAGGGAGTGG + Intergenic
1178922876 21:36750484-36750506 TTTTAAAAGGATAAAAGGAGTGG - Intergenic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1180180417 21:46116387-46116409 GCTTCAAAGGAGAGAAGGTGAGG + Exonic
1180991465 22:19939790-19939812 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
1181301065 22:21881569-21881591 GTCTCAAAAGAGAGAGAGAGAGG + Intergenic
1181579024 22:23816684-23816706 GCTTCAAAGAAGAAGGGGTGAGG + Intronic
1182192955 22:28482734-28482756 GTTTCCAGGAACAAAGGGAGAGG - Intronic
1183008011 22:34919307-34919329 GTTTCAGAGAAGAAAGAGAAAGG + Intergenic
1183097440 22:35561726-35561748 GTTTGAAAGGAGGCCGGGAGAGG + Intergenic
1183326874 22:37199177-37199199 TTTTGCAGGGAGAAAGGGAGAGG - Intronic
1183561735 22:38580260-38580282 GTTTCAAGGGAAAAAGAGAGGGG - Intronic
1184380679 22:44143347-44143369 GTGTGAAAGGAGAAAGGCAGGGG - Intronic
1185032835 22:48453756-48453778 GTTTCACATGATAAAGGGTGCGG - Intergenic
1185199274 22:49491811-49491833 GCTTCAGAGGAGGAAGGGATGGG - Intronic
1185270724 22:49928412-49928434 GGTTAGAGGGAGAAAGGGAGAGG - Intergenic
949510054 3:4759613-4759635 GTTTCAATGGCAAGAGGGAGGGG + Intronic
950655181 3:14432128-14432150 GTTTCTATAGAGCAAGGGAGGGG + Intronic
950687504 3:14629013-14629035 GTATCTGAGGGGAAAGGGAGTGG + Intergenic
950975570 3:17239275-17239297 GATTCAAAGCACAAATGGAGAGG - Intronic
951596653 3:24325965-24325987 ATTAAAGAGGAGAAAGGGAGAGG - Intronic
951863198 3:27276903-27276925 GTTGGAGATGAGAAAGGGAGAGG - Intronic
953439018 3:42902189-42902211 GTTGCCTAGGAGAAATGGAGTGG + Intronic
954134202 3:48574671-48574693 GTCCCAAAGGAGACAGGGTGAGG - Exonic
955203704 3:56876185-56876207 GTGTAAAAGGTGGAAGGGAGTGG + Intronic
955474170 3:59318620-59318642 GCATCAAAAGAGAAAGTGAGGGG - Intergenic
955989880 3:64615198-64615220 GAGACAAGGGAGAAAGGGAGAGG + Intronic
956000781 3:64727993-64728015 GTGTAAAAGGAGAAAGGTGGGGG - Intergenic
956543593 3:70373563-70373585 GTTCCAGAAGAGAAAGAGAGTGG - Intergenic
956572269 3:70710061-70710083 GATTAAAAGCAGAAAGGGATAGG - Intergenic
958550967 3:95611428-95611450 ATTTCAAAAGACAAAGGAAGAGG - Intergenic
958894036 3:99810614-99810636 TTTGCCAAGGAGTAAGGGAGAGG + Intergenic
959157289 3:102682367-102682389 GTTTCAAAGGAAAGAAGGAAGGG - Intergenic
959870699 3:111324170-111324192 GGTACAGAGGAGAAATGGAGTGG - Intronic
959888384 3:111527771-111527793 GTCTTAAAGGAGAAAGGGAGAGG - Intronic
959904366 3:111694142-111694164 GAATCAAAGGGGAAAAGGAGAGG - Intronic
960362272 3:116727705-116727727 GTATTGAAGGAGAAATGGAGTGG + Intronic
961921684 3:130432885-130432907 GTTTCTTAGGAGGAAGGGAAGGG - Intronic
961922839 3:130446011-130446033 GTTTTAAAGGAGAAATGGAGAGG + Intronic
962256968 3:133878092-133878114 TCTTCAAAGGATGAAGGGAGAGG + Intronic
962882274 3:139589427-139589449 GTTTCAAAAGAGAAAACCAGAGG + Intronic
963713339 3:148773358-148773380 GTTTCAAAAAAGAAAGCCAGAGG + Intergenic
964335886 3:155653979-155654001 GATTCAAAAGAGAGAGGAAGGGG - Intronic
964364247 3:155931885-155931907 GTTTCACAGGAGCTAGGGTGGGG + Intronic
965033610 3:163405808-163405830 TCTTCATAGGGGAAAGGGAGTGG + Intergenic
966395218 3:179495217-179495239 GTCTCAAAGGAAAAAAAGAGAGG + Intergenic
966622856 3:181984522-181984544 GTTTCAGAGGGGAAAGACAGAGG + Intergenic
966669240 3:182508538-182508560 GTTTTGAGGAAGAAAGGGAGAGG - Intergenic
967442548 3:189525937-189525959 GTGTCAGGGGAGAAAGGGATAGG + Intergenic
967464194 3:189783685-189783707 CATTTAAAGGAGAAAGGCAGAGG + Intronic
967701282 3:192595156-192595178 GGTTCAAAGGAGAAAATGAGAGG - Intronic
969008896 4:4044640-4044662 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
970056599 4:11980371-11980393 TTTTCAGATGAGAAAGTGAGAGG + Intergenic
970544968 4:17119052-17119074 TTTTCAGAGGATAAAGGTAGAGG + Intergenic
971399251 4:26260706-26260728 ATTACAAAGGAGTAAGAGAGTGG - Intronic
972171637 4:36352931-36352953 CTTTGAAATCAGAAAGGGAGGGG - Intergenic
972243121 4:37215504-37215526 GTCTCATAGGATACAGGGAGGGG - Intergenic
972731400 4:41798697-41798719 ATTTCAAGGGGGAAGGGGAGCGG - Intergenic
973558029 4:52105741-52105763 GCTACAAGGGAGAAAGGGATTGG - Intergenic
974605335 4:64143914-64143936 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
975401995 4:73949409-73949431 ATTTTAAAGGAGAAAGGGAGAGG + Intergenic
975682759 4:76893115-76893137 GTTTCAGGAGAGAGAGGGAGAGG - Intergenic
975684809 4:76909216-76909238 GACTCAAGGGAGAAGGGGAGGGG - Intergenic
975827337 4:78333547-78333569 GATTCAAAGTATAGAGGGAGGGG + Intronic
975955050 4:79826909-79826931 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
976031084 4:80754522-80754544 GTTTTCAAGGGGAAAGTGAGAGG + Intronic
976374593 4:84329899-84329921 ATTTCAAAAGAGAAAGGAAACGG - Intergenic
977313577 4:95416444-95416466 GTCTCAAAGAAAAAAGTGAGGGG + Intronic
977371413 4:96141823-96141845 ATGTAGAAGGAGAAAGGGAGAGG - Intergenic
977723596 4:100268277-100268299 GTTTCAAAAGTGAATGGAAGAGG - Intergenic
977748189 4:100576824-100576846 GCTTCAGAAGAGAAAGGGAGTGG + Intronic
978577306 4:110199707-110199729 TTTTTAAAGGAGGAAGGGACCGG + Intergenic
978601614 4:110434007-110434029 CTCTAAAAGGAGAGAGGGAGAGG - Intronic
979602625 4:122603252-122603274 GGGTCAAACAAGAAAGGGAGAGG + Intergenic
979619521 4:122783219-122783241 GTTTCAAAAAGGAAAGGGAAAGG + Intergenic
980948305 4:139345916-139345938 GTATCAAAAAAAAAAGGGAGTGG + Intronic
980978750 4:139635904-139635926 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
981076544 4:140598217-140598239 GTTTAGAAGGAGAAGGGAAGGGG + Intergenic
981679300 4:147376779-147376801 GTTTCAGAAGAGAGAGGCAGAGG + Intergenic
981720311 4:147795357-147795379 GTTTTGTAGGAAAAAGGGAGAGG - Intronic
982239209 4:153281903-153281925 GTGTCAAAGGTGCAAAGGAGAGG + Intronic
982769755 4:159386009-159386031 CTTGCAAAGGAAAATGGGAGTGG - Intergenic
983103931 4:163661773-163661795 GTTGCAAGGGGAAAAGGGAGAGG - Intronic
983190683 4:164750570-164750592 GTCTTAAGGGAGAAAGGGAGAGG - Intergenic
983235661 4:165176634-165176656 GGTTTGAAGGAGAAAGTGAGAGG - Intronic
984055612 4:174925696-174925718 ATTTCAAAGGGAAAAGGAAGTGG + Intronic
984182875 4:176506972-176506994 GCTGCAAAGGAGAGAGAGAGAGG - Intergenic
984447633 4:179857101-179857123 GTTTCAAAAGAGGCAGGGCGTGG + Intergenic
984902286 4:184596017-184596039 GTCTCAAAAGAAAAGGGGAGGGG + Intergenic
985019899 4:185676875-185676897 GTTTCCAAGCAGGAAGGGAAAGG - Intronic
985738566 5:1600535-1600557 GTTTTAGAGGTGAAAGGGACTGG + Intergenic
985788607 5:1913151-1913173 GTTTCACAGCTGGAAGGGAGCGG - Intergenic
985969694 5:3365398-3365420 GTTTCAGGGTAGAAATGGAGGGG + Intergenic
986078513 5:4363824-4363846 GTTTCAATAGAAAAAGAGAGAGG + Intergenic
986233770 5:5888783-5888805 ATTTCAAGAGAGAAAGAGAGAGG - Intergenic
987057751 5:14210888-14210910 GGGTGAAAGGAGGAAGGGAGTGG - Intronic
987505982 5:18772805-18772827 TTTTCAAAGGAAAAAGTGAGTGG - Intergenic
987530618 5:19114353-19114375 GGACCAAAGGAGAAGGGGAGTGG + Intergenic
988399696 5:30746959-30746981 GGTTCAAAGGAGGGAGGGTGTGG - Intergenic
988530708 5:32024850-32024872 CTTTCAAAGTACAAAGGCAGAGG - Intronic
989234724 5:39133424-39133446 GAATGAAAGGAGAAAGGGAATGG + Intronic
989291306 5:39769431-39769453 GTTGGAAAAGTGAAAGGGAGCGG + Intergenic
989318673 5:40110233-40110255 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
989967257 5:50478992-50479014 GGTTCAAGGGACAAAGGCAGAGG - Intergenic
990140255 5:52694945-52694967 TAGTGAAAGGAGAAAGGGAGAGG - Intergenic
990608221 5:57431203-57431225 TATTAAAAGAAGAAAGGGAGAGG + Intergenic
991007102 5:61840167-61840189 GTTTCTAAAAAGAAAGGGGGGGG - Intergenic
991455992 5:66805152-66805174 TTTTCAAAGGAGTAAAGGAGCGG + Intronic
991658417 5:68926417-68926439 GTTTCAGAGGAAAAGGGAAGGGG + Intergenic
992306318 5:75442745-75442767 TTTTGAAAGGAGAGAGGGAGGGG + Intronic
992457907 5:76933133-76933155 GATTCAAAGGAGAGAGAAAGAGG + Intergenic
993012406 5:82498570-82498592 GTCTCAAAAGGGAAGGGGAGGGG - Intergenic
993503256 5:88684850-88684872 TATTCAGAGGAGAGAGGGAGGGG + Intergenic
994865174 5:105259469-105259491 GTTAGAAAGGAGGAAGAGAGGGG + Intergenic
995076558 5:107991500-107991522 GTCTCAACTGAGAAAGGGAATGG - Intronic
995107428 5:108390371-108390393 TTTTCAACTGAGAATGGGAGAGG - Intergenic
996190168 5:120530749-120530771 AGTTCAAAGGAGAAAGGTAAAGG + Intronic
996545217 5:124670917-124670939 TTTCCAAAGGAGAAGGGGAGGGG - Intronic
998527739 5:142858006-142858028 GTCTCCAAAGAGAGAGGGAGAGG + Intronic
999082119 5:148854636-148854658 CTTTCAAAGGAAATGGGGAGTGG + Intergenic
999503623 5:152172033-152172055 GCTGCAAGGGAGGAAGGGAGAGG + Intergenic
1000109367 5:158093324-158093346 GGTTTAAAAGAGAAAGGAAGGGG - Intergenic
1000418448 5:161009592-161009614 TTTTCAAAGGGAAAAGAGAGAGG + Intergenic
1000515052 5:162228990-162229012 GTTTAAAATGGGACAGGGAGTGG + Intergenic
1000726183 5:164773809-164773831 GTTCCAAAGGAGAAAGAGAGAGG - Intergenic
1001002604 5:168021867-168021889 ATTTCAAAAAAGAAAGGGAAGGG + Intronic
1001101129 5:168815221-168815243 TTTCCAAAGGAGAAAGAGTGAGG + Intronic
1001161900 5:169325830-169325852 GTTTCAAATTAGAAAAGAAGAGG + Intergenic
1001191557 5:169637237-169637259 GTTTGAAAAGAGGAAGGAAGTGG + Exonic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1001829204 5:174771416-174771438 GATTCAAAGGAGAAATTGAAAGG - Intergenic
1001829385 5:174772995-174773017 GTGACTCAGGAGAAAGGGAGAGG + Intergenic
1001867266 5:175116506-175116528 GCTGGGAAGGAGAAAGGGAGAGG - Intergenic
1002415114 5:179116296-179116318 GTTGGAAAGGGGAAAGGGACAGG - Intronic
1003737336 6:8891304-8891326 GTTGCAGAGGAGAAGAGGAGAGG - Intergenic
1003844678 6:10160802-10160824 GTTTAATGGGAGAAAGGAAGAGG + Intronic
1003956416 6:11169361-11169383 GTTCCACAGTAGAAAGGGAGGGG - Intergenic
1004239970 6:13912189-13912211 GTGTCTAAGGAGGAAGGGAGTGG + Intergenic
1004875211 6:19944534-19944556 GTGGCAAAGCAGGAAGGGAGCGG - Intergenic
1005824217 6:29622871-29622893 ATTACAGAGGAGAGAGGGAGAGG - Intronic
1006142780 6:31940690-31940712 GATGCTAAGGAGGAAGGGAGTGG - Intronic
1006749406 6:36367116-36367138 GTTTGGAAGGAAAAAGGCAGGGG + Intronic
1007399121 6:41593809-41593831 GTTGGAAGGGAGAGAGGGAGAGG + Intronic
1007578565 6:42941485-42941507 GTTCCAAAAAAGAAAGGTAGGGG - Intergenic
1008013152 6:46490597-46490619 GTTTGAAAAGTGAAATGGAGCGG - Intronic
1008449317 6:51631886-51631908 CTTTTAAAGGAGAAGAGGAGAGG + Intronic
1008827231 6:55711416-55711438 TTCTCAAAGGAGAAAAGAAGAGG + Intergenic
1009319333 6:62267091-62267113 GTTGCAAAGGAGAACAGGACTGG - Intronic
1009533306 6:64848589-64848611 GTTTCCAATGAGAATGGGAGGGG + Intronic
1010042622 6:71404354-71404376 TTTTCATAAGAGAATGGGAGTGG - Intergenic
1010492151 6:76489354-76489376 GTTTTAAAGGAAAAAGGGAGAGG + Intergenic
1012430979 6:99163304-99163326 GGATCAAAGGAGTAAGGAAGTGG - Intergenic
1012665746 6:101966641-101966663 GATTCAATGGATAAAGGAAGAGG + Intronic
1013557145 6:111267816-111267838 GTCTCAAAAAAGAAATGGAGAGG + Exonic
1013644499 6:112123139-112123161 CTTTCAAAGCAGGGAGGGAGTGG + Intronic
1014211292 6:118710994-118711016 GTTTGAAAGAAGGAAGAGAGAGG + Intergenic
1014602026 6:123425075-123425097 ATTTCAAAGGTGAAAGTGAGAGG + Intronic
1015315462 6:131811540-131811562 TTTTTAAAGGAAAAAGGAAGAGG + Intronic
1015479100 6:133688639-133688661 GATACAAGTGAGAAAGGGAGGGG + Intergenic
1015570793 6:134619359-134619381 GGTTCAAGAGAGAAGGGGAGAGG + Intergenic
1016590565 6:145739130-145739152 TTTTCAAAGGAGAAGTGAAGGGG - Intergenic
1017850300 6:158299484-158299506 GTCTTAAAGGAGAAAGGGAGAGG + Intronic
1018148393 6:160915311-160915333 GTCAGAAAGGATAAAGGGAGTGG - Intergenic
1018782469 6:167080636-167080658 ATTTCAACTGAGAAAGGGTGAGG - Intergenic
1019190996 6:170250709-170250731 GTTTCAAGGGGGAAAAGGAAAGG + Intergenic
1019550347 7:1599278-1599300 CTTGCACAGGAGAAAGGGTGGGG + Intergenic
1019973093 7:4557939-4557961 GTTTCAAAGAAAAAAGGGTGAGG - Intergenic
1020334266 7:7049863-7049885 CTTACAAAGGAGAAAGGTAAAGG + Intergenic
1021420983 7:20444385-20444407 TTTACAAAGGAGGAAAGGAGGGG - Intergenic
1021459217 7:20866467-20866489 GTTTGAAAGGAGAAAGGCCCAGG - Intergenic
1022121547 7:27313263-27313285 GTTTTAAAGGAAAAATGAAGAGG + Intergenic
1022416544 7:30182700-30182722 GTTTAAAAGAAGAAAGTAAGTGG + Intergenic
1022866231 7:34423987-34424009 TTTTCAAAGGAGAAAAAGGGAGG - Intergenic
1022939216 7:35215992-35216014 GTTGCAAAGGAGAATGTGAGGGG - Intronic
1023573790 7:41602460-41602482 GCTTCAAAAGACAAAGGAAGTGG + Intergenic
1023707387 7:42955332-42955354 GTTTCAAAAGAAGAAGGCAGTGG + Intergenic
1024049450 7:45609573-45609595 TTTTCAAAGCAGAGTGGGAGGGG + Intronic
1024553273 7:50581487-50581509 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1024675409 7:51633751-51633773 GTCTAAAATGAGAAAGGCAGGGG + Intergenic
1025148987 7:56531698-56531720 GTTTGAGAGGAAGAAGGGAGTGG + Intergenic
1025939914 7:66068314-66068336 GTTCCAAAGGAGAAGGGGGGTGG - Intergenic
1026392047 7:69911923-69911945 GTTTCAGGGCAGAAAGGGACAGG - Intronic
1026924730 7:74182796-74182818 GTGTCAAAGGAGACTGAGAGAGG - Intronic
1027358314 7:77382058-77382080 GTTTCAAGTTAGAGAGGGAGAGG - Intronic
1029247694 7:99214623-99214645 GTTTCAAAGGAAAGAGGGGAGGG + Intergenic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030797192 7:113803389-113803411 GTTTTAAAGGAGAGTGGGGGAGG + Intergenic
1031506698 7:122593771-122593793 ATGGCAAAGGAGAAAGAGAGAGG + Intronic
1031866718 7:127044994-127045016 GTTTCTGAGGAGAAACAGAGAGG - Intronic
1032756317 7:134893868-134893890 GATTTAAAGGGGAAAGGGTGGGG + Intronic
1033300683 7:140182293-140182315 ACCACAAAGGAGAAAGGGAGAGG - Intergenic
1033322138 7:140349524-140349546 GCATCAAAGGAAAAAGGGGGGGG + Intronic
1033327548 7:140392106-140392128 GTTGGGAAAGAGAAAGGGAGGGG - Intronic
1035483693 7:159206142-159206164 GGTGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483703 7:159206201-159206223 GCTGCAAAGGAGAGAGAGAGAGG + Intergenic
1035483729 7:159206355-159206377 GGTGCAAAGGAGAGAGAGAGAGG + Intergenic
1035483735 7:159206387-159206409 GATGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483764 7:159206602-159206624 GGTGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483779 7:159206691-159206713 GGTGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483811 7:159206875-159206897 GGTGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483822 7:159206940-159206962 GATGCAAAGGAGAGAGAGAGGGG + Intergenic
1035483851 7:159207095-159207117 GGTGCAAAGGAGAGAGAGAGGGG + Intergenic
1036051989 8:5209302-5209324 TTTCCAAAGGAGAGAGGGAAGGG + Intergenic
1036250167 8:7155305-7155327 GTTGTAAAGGAGAAAGGGAGAGG + Intergenic
1036367321 8:8132145-8132167 GTTGTAAAGGAGAAAGGGAGAGG - Intergenic
1036883561 8:12533517-12533539 GTTGTAAAGGAGAAAGGGAGAGG + Intergenic
1037506059 8:19530801-19530823 CTTTCTAATGAGAAAGGGACTGG + Intronic
1037927110 8:22852110-22852132 GTGGCAAAGGAAAGAGGGAGAGG + Intronic
1039182461 8:34881175-34881197 GTATCATAGGAGAAAGACAGTGG - Intergenic
1039377162 8:37045968-37045990 GTTGCAAAAGAGAAAGTGGGAGG - Intergenic
1039433641 8:37545114-37545136 GTCTCAAAAAAGAAAGGAAGGGG + Intergenic
1040045229 8:42956059-42956081 GTTTTAAAGACAAAAGGGAGAGG - Intronic
1040139804 8:43896841-43896863 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
1040353005 8:46587380-46587402 GTCTTAAAGGAGAAAGGGAGAGG - Intergenic
1043087660 8:75855267-75855289 ATTTCAAAACATAAAGGGAGGGG + Intergenic
1043264524 8:78247242-78247264 GTTACAGAGGGGAAAGGTAGTGG - Intergenic
1044072065 8:87773744-87773766 GTTTCAAATTAGAGATGGAGAGG - Intergenic
1044142526 8:88672912-88672934 GTCTTAAAGGAGAAAGGGAGAGG + Intergenic
1044159200 8:88891877-88891899 GTTTAATAGGAGAATGGGGGTGG + Intergenic
1044519076 8:93176889-93176911 GTTTAAGAGGAGAAAGAGAAAGG + Intergenic
1044737120 8:95290307-95290329 CTTTCAAAGGAAAGAAGGAGAGG - Intergenic
1044937744 8:97309297-97309319 GTTGCACAGCAGAAAGTGAGTGG + Intergenic
1045542434 8:103099704-103099726 GGATGAAGGGAGAAAGGGAGAGG - Intergenic
1045652428 8:104353588-104353610 TTTTAATAAGAGAAAGGGAGAGG + Intronic
1045696402 8:104813389-104813411 GTTTCAAAGGAGAGATAGGGCGG + Intronic
1046063359 8:109165924-109165946 GTTTGAGAGGAGAAAGAGTGAGG - Intergenic
1046077363 8:109329270-109329292 TCTTCAAAGGAGAAAAGGAGGGG + Intronic
1046834109 8:118780148-118780170 GATCCAAAAGAGAGAGGGAGAGG - Intergenic
1048584374 8:135759015-135759037 GTTTAAAAGGAATAAGGGAAGGG + Intergenic
1048591900 8:135828113-135828135 GTCTCAAAGGGGGAAGTGAGGGG - Intergenic
1049026039 8:139989592-139989614 GCTTCCAGGGAGAAAGGAAGGGG - Intronic
1049432112 8:142569992-142570014 GTGTGAAAGGAGGCAGGGAGTGG - Intergenic
1050188647 9:3001766-3001788 GATTGGAAGGAGGAAGGGAGAGG - Intergenic
1050260262 9:3834256-3834278 TTTCCAAACTAGAAAGGGAGTGG + Intronic
1050427082 9:5522602-5522624 GTAAGAAAGGACAAAGGGAGAGG + Intronic
1050873869 9:10612406-10612428 GTTTCCAAGGAGGACTGGAGCGG - Intronic
1051506381 9:17831729-17831751 TTCTTATAGGAGAAAGGGAGAGG - Intergenic
1051718973 9:20015704-20015726 GATTCAAAGGAGACAGGAAATGG + Intergenic
1052687942 9:31777908-31777930 GTCTTGAAGGAGAAAGGGAGAGG - Intergenic
1052751080 9:32491541-32491563 TTTTAAAAGGTGAAGGGGAGTGG - Intronic
1053568974 9:39284452-39284474 GTTCAAAAAGAGAAGGGGAGAGG + Intronic
1054090603 9:60843419-60843441 GTTCAAAAAGAGAAGGGGAGAGG + Intergenic
1054112014 9:61118976-61118998 GTTCAAAAAGAGAAGGGGAGAGG + Intergenic
1054128170 9:61334555-61334577 GTTCAAAAAGAGAAGGGGAGAGG - Intergenic
1054595597 9:67062042-67062064 GTTCAAAAAGAGAAGGGGAGAGG - Intergenic
1055381894 9:75716388-75716410 AATGCAAAGGAGAAAGGGTGTGG - Intergenic
1055651064 9:78407574-78407596 ATTTCAGGGGAGAGAGGGAGAGG + Intergenic
1055664686 9:78541631-78541653 AGTTGAAAGGAGAAAGGAAGAGG - Intergenic
1055694409 9:78868268-78868290 TTTTCAAAGTTGAAATGGAGGGG + Intergenic
1056387813 9:86113505-86113527 GTTTCCATGGAGAAATGGTGTGG + Intergenic
1057318896 9:93993875-93993897 GTTTCAAAGATGAAGGGGAGAGG + Intergenic
1057464926 9:95304333-95304355 TTTTCAAACAGGAAAGGGAGGGG + Intronic
1057851243 9:98568445-98568467 GTTTTCAAGGTGAAAAGGAGAGG + Intronic
1058068990 9:100582631-100582653 AGTTTCAAGGAGAAAGGGAGGGG - Intronic
1059198660 9:112394648-112394670 GTCTTAAAGGAGAAAGGGAGAGG + Intronic
1059537608 9:115097202-115097224 GGTTCAGAGGAGAAAGGGAATGG - Intronic
1059705328 9:116817469-116817491 GGTACAAAGGAGAAAGAGACAGG + Intronic
1059740326 9:117143827-117143849 TTATCAAAAGAGGAAGGGAGAGG - Intronic
1059946664 9:119415830-119415852 GTTAAAAAGTAGAAAGGGATGGG + Intergenic
1061214231 9:129211371-129211393 GCTTCAAAGCAAACAGGGAGAGG - Intergenic
1061702058 9:132423459-132423481 GTTGCAAAGATGTAAGGGAGAGG - Intronic
1062093687 9:134691793-134691815 GATTCAGATGAGAAAGGGACGGG + Intronic
1062178101 9:135175577-135175599 GTTTCACAGGTGAAAGGGGCTGG + Intergenic
1062407440 9:136403482-136403504 GGTTCCTGGGAGAAAGGGAGGGG + Intronic
1062500184 9:136848859-136848881 GGTGGAGAGGAGAAAGGGAGAGG + Intronic
1186265286 X:7825922-7825944 GTTGGACAGGAGAAATGGAGAGG + Intergenic
1186348333 X:8717625-8717647 ATGTCAAAATAGAAAGGGAGAGG + Intronic
1186936276 X:14453103-14453125 GTTGGAAAAGAGAAAGAGAGTGG + Intergenic
1187378796 X:18781346-18781368 TTCCCAAAGGAGAAAGTGAGGGG + Intronic
1187491867 X:19759721-19759743 GTTTCAGTGGAGAAGAGGAGGGG + Intronic
1187514485 X:19955142-19955164 CTTTCAAGTTAGAAAGGGAGAGG - Intronic
1188487908 X:30703486-30703508 ACTGCAGAGGAGAAAGGGAGGGG + Intronic
1188569226 X:31561944-31561966 TTTTCAAAGGAGAATGAAAGAGG - Intronic
1188823339 X:34800918-34800940 GTTTTAAAGGTGAAAGAGAGAGG - Intergenic
1189213907 X:39306995-39307017 GTTGAGAAGGAGAGAGGGAGGGG + Intergenic
1189447244 X:41092210-41092232 GGTGGAAAGGAAAAAGGGAGTGG + Intronic
1189557837 X:42163858-42163880 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1190757624 X:53414544-53414566 GTTTTAAGGAAAAAAGGGAGGGG + Intronic
1191125292 X:56947681-56947703 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic
1192182295 X:68923708-68923730 GAAAGAAAGGAGAAAGGGAGGGG - Intergenic
1192319561 X:70078596-70078618 GTTTGAAAGGAGGAAGGAAATGG + Intergenic
1192460316 X:71311475-71311497 GTATAAAAGGAGGTAGGGAGAGG - Intergenic
1192845661 X:74904725-74904747 GTTTCCAAGGAAAAAAAGAGCGG - Intronic
1193022603 X:76806585-76806607 GTTTAAAAAGCGAAAGTGAGTGG + Intergenic
1193694835 X:84695743-84695765 ACTTCAAAGGAGGAAGGGATGGG + Intergenic
1194079966 X:89449319-89449341 GTTTTAAAGGGGAAAGGGCTTGG + Intergenic
1194426770 X:93748400-93748422 ATTTCAGAGGAGACAGGAAGAGG + Intergenic
1194479598 X:94404445-94404467 TATTCAAAGAAGACAGGGAGGGG - Intergenic
1194577710 X:95634628-95634650 GTTACAAAGGAAAAAGGAAGTGG + Intergenic
1194670286 X:96723514-96723536 GTTTCAAAGGAGAATGGAGTTGG + Intronic
1195319942 X:103713475-103713497 AGTCCAAAGGAGAAAGGCAGTGG + Intronic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1199364479 X:146963615-146963637 CTTTCAAAGCAGAAATGGATAGG - Intergenic
1199370329 X:147040808-147040830 ATTTCAAGGAAGAAGGGGAGAGG + Intergenic
1199730580 X:150628327-150628349 GTTTCAAAAAAAAGAGGGAGAGG - Intronic
1199910487 X:152281551-152281573 GTTTCTAAGGAGAAAGTCAGAGG - Intronic
1200389425 X:155929278-155929300 TTTTTAAAGGAAAAAAGGAGAGG + Intronic
1200432588 Y:3104593-3104615 GTTTTAAAGGGGAAAGGGCTTGG + Intergenic
1200861187 Y:7994408-7994430 ATTTTAAAGGAGAAATGGAGAGG + Intergenic
1201475445 Y:14376431-14376453 GTCTTAAGGGAGACAGGGAGAGG + Intergenic
1201777810 Y:17685628-17685650 CCTTTAAAGAAGAAAGGGAGAGG - Intergenic
1201823748 Y:18220364-18220386 CCTTTAAAGAAGAAAGGGAGAGG + Intergenic
1202246985 Y:22830089-22830111 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1202399974 Y:24463837-24463859 GTTTTAAAGGAGAAAGGGAGAGG + Intergenic
1202470807 Y:25206249-25206271 GTTTTAAAGGAGAAAGGGAGAGG - Intergenic