ID: 1001529995

View in Genome Browser
Species Human (GRCh38)
Location 5:172454694-172454716
Sequence GCGGCTCAGCACCGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001529995_1001530006 -2 Left 1001529995 5:172454694-172454716 CCTTTGTCCCGGTGCTGAGCCGC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 1001530006 5:172454715-172454737 GCCGCGCCGGGGGAGGGGACTGG 0: 1
1: 1
2: 8
3: 82
4: 579
1001529995_1001530004 -7 Left 1001529995 5:172454694-172454716 CCTTTGTCCCGGTGCTGAGCCGC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 1001530004 5:172454710-172454732 GAGCCGCCGCGCCGGGGGAGGGG 0: 1
1: 0
2: 2
3: 45
4: 447
1001529995_1001530002 -9 Left 1001529995 5:172454694-172454716 CCTTTGTCCCGGTGCTGAGCCGC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 1001530002 5:172454708-172454730 CTGAGCCGCCGCGCCGGGGGAGG 0: 1
1: 0
2: 1
3: 24
4: 405
1001529995_1001530003 -8 Left 1001529995 5:172454694-172454716 CCTTTGTCCCGGTGCTGAGCCGC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 1001530003 5:172454709-172454731 TGAGCCGCCGCGCCGGGGGAGGG 0: 1
1: 0
2: 2
3: 45
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001529995 Original CRISPR GCGGCTCAGCACCGGGACAA AGG (reversed) Intergenic
904786562 1:32987425-32987447 GCTTCTCTGCACAGGGACAATGG - Intergenic
905632561 1:39526782-39526804 GGGGCTCAGCACTGAGACAGAGG + Intergenic
906637279 1:47417576-47417598 GCGAGTCAGCTCCGGGGCAAGGG - Exonic
907357714 1:53889920-53889942 GAGGCTCAGCCTCGGGAGAAGGG - Intergenic
908137304 1:61146380-61146402 GCAGCTCAGCCCAGGGACACTGG - Intronic
915534743 1:156528545-156528567 GCTGCTCAGCTCCTGGAAAAGGG - Exonic
916027002 1:160841655-160841677 GCAGCTCAGCAGCAGGACAGTGG - Exonic
921166548 1:212512144-212512166 GAGGCTCACCAACGGGACACAGG - Intergenic
1064027133 10:11857780-11857802 GCGGCACAGTTTCGGGACAAAGG - Intronic
1065487575 10:26249728-26249750 GCGGCTCATCATGGGAACAAGGG + Intronic
1066615988 10:37295402-37295424 GGTGCACAGCACCTGGACAATGG + Intronic
1068137218 10:52962838-52962860 GAGGCACAGCACCTGGCCAAAGG + Intergenic
1077020695 11:416020-416042 AAGGCTGAGTACCGGGACAAAGG - Intronic
1078496503 11:11822934-11822956 GTGGCTCAGCACTGTGATAAGGG - Intergenic
1078987775 11:16611856-16611878 GCGGCAGAGCACCGCCACAAAGG + Intronic
1085250744 11:75142070-75142092 GGGGCTCAGAACAGGGACCAGGG + Intronic
1086898055 11:92336188-92336210 GCTGCCAAGGACCGGGACAATGG + Intergenic
1091877218 12:3945379-3945401 GCAGCTCAGTACGGGGAAAAAGG - Intergenic
1092197121 12:6556133-6556155 GCGGCTCGGCAGCGGGGCAGAGG + Intergenic
1096787025 12:54022901-54022923 GCTGCTCTGCACTGGGTCAAAGG - Intronic
1105760137 13:23506656-23506678 GCGCCTCAGCAGAGGGATAAAGG - Intergenic
1122183879 14:99974694-99974716 GCCTCTCTGCACCGGGACAGTGG + Intronic
1130321697 15:82847819-82847841 GTGGCCCAGCAGCGGGATAAGGG - Intronic
1131143923 15:89999972-89999994 GCGGCTCAGGACCAGGTCACCGG - Intergenic
1135673533 16:24394796-24394818 GCGGCTCACCCCTGGGACAGTGG + Intergenic
1139632156 16:68237329-68237351 GCGGCCCGGCCCCTGGACAATGG + Intronic
1143775494 17:9196176-9196198 GGGGCACAGCACCCGGGCAATGG + Intronic
1146797243 17:35791202-35791224 GTGGCACAGCACCTGGCCAAGGG + Intronic
1148065031 17:44862823-44862845 GCCACTCAGCACCCGGCCAAAGG + Exonic
1148131389 17:45264506-45264528 CCGGCTCAGCAGTGGGACCAGGG - Exonic
1152656796 17:81523605-81523627 GGGGCTTGGCACGGGGACAAGGG + Intronic
1152690022 17:81713765-81713787 GGGGCTCAGACCCCGGACAAGGG - Intronic
1161210306 19:3062280-3062302 GCCGATCGGCGCCGGGACAAAGG - Intronic
1162424166 19:10583957-10583979 GTGGCTCAGCAGCGGGGCCAGGG + Exonic
1162803287 19:13122833-13122855 GCGGCCCAGCACGGGGCCAGGGG + Intronic
1162823116 19:13235336-13235358 GGGGCAGAGCACTGGGACAAGGG - Intronic
1166690383 19:44818832-44818854 GCGGCTGAGGACCGGGACTGTGG - Exonic
1167091722 19:47349043-47349065 GCGCCTCAGCTCCGGGACGCCGG - Intergenic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
925125250 2:1450061-1450083 GCGGGGCAGCAGCGGGACACGGG - Intronic
926672843 2:15591796-15591818 GGGACTCAGCCCCGGGAGAACGG - Exonic
929890874 2:45917903-45917925 GGGGCTTAGCACCGGGCCAGCGG - Intronic
935594432 2:104868049-104868071 GCGCCCCAGCACCGGGAGACTGG + Intergenic
937325587 2:120988171-120988193 AGGGGTCAGCACCGGGACAAGGG - Intronic
941861333 2:170283971-170283993 GCTGCTCAGCTATGGGACAAAGG - Intronic
944748145 2:202678840-202678862 GAGCCTCTGCACCCGGACAAGGG + Intronic
947057941 2:226128517-226128539 TCAGCTCAGCACCTGGACATTGG - Intergenic
947736753 2:232459193-232459215 GCGGCTCAGGACGGGGAACAGGG - Exonic
948883314 2:240871174-240871196 GCATCTCCGCTCCGGGACAAGGG - Intronic
1173927930 20:46794502-46794524 GCCACCCAGCACAGGGACAAGGG + Intergenic
1175312164 20:58019552-58019574 GGGGCTCCTCTCCGGGACAATGG - Intergenic
1179328328 21:40373053-40373075 GCGGCTCAGCTCCGTGACAATGG - Intronic
1180187404 21:46146316-46146338 CCGGCTCACCACCTGGAAAAGGG + Exonic
1181168085 22:20993952-20993974 GCGGCTCCGCGCTGTGACAATGG - Exonic
1182353992 22:29713963-29713985 GCAGCTGAGCCCTGGGACAAGGG + Intergenic
949878383 3:8641926-8641948 GCTGCTCAGCACTGGGTCAGGGG + Intronic
955632788 3:60992610-60992632 TCGGCTTAGCAGCAGGACAATGG + Intronic
961709674 3:128818387-128818409 GCTGGTCAGCACCAGGACAAGGG - Intergenic
969848961 4:9941980-9942002 AAGGCTCAGCAGCTGGACAACGG + Exonic
970326990 4:14936233-14936255 GGGGCTCAGCAGTGGGGCAAAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
1001529995 5:172454694-172454716 GCGGCTCAGCACCGGGACAAAGG - Intergenic
1004048484 6:12049356-12049378 GTGGGTCAGCACCTGGAGAAAGG + Intronic
1018939586 6:168300213-168300235 GCAGACCAGCACCAGGACAAGGG + Intronic
1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG + Intergenic
1024019142 7:45349286-45349308 GCGGTTCAGCATCTGGACAGTGG - Intergenic
1026194992 7:68164939-68164961 GCTGCCTAGCACAGGGACAAGGG - Intergenic
1026458816 7:70595865-70595887 GCGGCTCAGTACCGTGTGAAAGG - Intronic
1038150913 8:24942008-24942030 GCGGCCCAGCACCAGGCCACCGG - Intergenic
1049422773 8:142524294-142524316 GCGGGTCAGTACCAGCACAACGG - Exonic
1049551330 8:143261333-143261355 GCGCCTCTGCACCGGGAGAAAGG + Intronic
1049835679 8:144734169-144734191 TCGGCTCAGCGCTGGGACAAAGG - Intronic
1056126215 9:83538331-83538353 GCGGCTCAGCCCCGGGACATCGG + Exonic
1056350201 9:85741821-85741843 CCGGCTCAGCACCTGGATCACGG + Intronic
1057488974 9:95507547-95507569 GCGGCTCAAAACCTGGAAAACGG + Intronic
1060216643 9:121742512-121742534 GCGTCTCAGCACCTGGTCTACGG - Intronic
1061506521 9:131034729-131034751 GCAGCTCAGGACAGGGACAGTGG + Intronic
1061817685 9:133206498-133206520 ACGGCCCAGCACCAGGACAGGGG + Intronic
1061817708 9:133206579-133206601 ACTGCCCAGCACCAGGACAAGGG + Intronic
1062610419 9:137371040-137371062 GCGGCCCCGCTCGGGGACAATGG + Intronic
1189446312 X:41085001-41085023 TCGGCTCAGGAGCGGGACGAGGG - Intergenic
1198978410 X:142363750-142363772 GCAGCCCAGCATCGGGGCAAGGG - Intergenic