ID: 1001530642

View in Genome Browser
Species Human (GRCh38)
Location 5:172459123-172459145
Sequence GACAAGGCACAGTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001530642_1001530646 -7 Left 1001530642 5:172459123-172459145 CCCAGCTGCCACTGTGCCTTGTC No data
Right 1001530646 5:172459139-172459161 CCTTGTCCCAGCTGTCATTCTGG No data
1001530642_1001530647 -6 Left 1001530642 5:172459123-172459145 CCCAGCTGCCACTGTGCCTTGTC No data
Right 1001530647 5:172459140-172459162 CTTGTCCCAGCTGTCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001530642 Original CRISPR GACAAGGCACAGTGGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr