ID: 1001536708

View in Genome Browser
Species Human (GRCh38)
Location 5:172503177-172503199
Sequence CAGTGTGAGCAGAGGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001536702_1001536708 18 Left 1001536702 5:172503136-172503158 CCAGTACTCCTTGCTTCCCACAT No data
Right 1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG No data
1001536704_1001536708 2 Left 1001536704 5:172503152-172503174 CCCACATGACTAGTTTTCAGCAA No data
Right 1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG No data
1001536705_1001536708 1 Left 1001536705 5:172503153-172503175 CCACATGACTAGTTTTCAGCAAT No data
Right 1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG No data
1001536703_1001536708 10 Left 1001536703 5:172503144-172503166 CCTTGCTTCCCACATGACTAGTT No data
Right 1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG No data
1001536701_1001536708 19 Left 1001536701 5:172503135-172503157 CCCAGTACTCCTTGCTTCCCACA No data
Right 1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001536708 Original CRISPR CAGTGTGAGCAGAGGGATCC AGG Intergenic
No off target data available for this crispr