ID: 1001539292

View in Genome Browser
Species Human (GRCh38)
Location 5:172526181-172526203
Sequence AGCCACGCAGAGAGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539292_1001539299 28 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data
1001539292_1001539294 0 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539294 5:172526204-172526226 GAGAACTCTCCTGTCTTCCTCGG No data
1001539292_1001539295 3 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539295 5:172526207-172526229 AACTCTCCTGTCTTCCTCGGTGG No data
1001539292_1001539298 19 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539292 Original CRISPR AGCCACGCAGAGAGGACCAC AGG (reversed) Intergenic