ID: 1001539293

View in Genome Browser
Species Human (GRCh38)
Location 5:172526189-172526211
Sequence GAGTTCTCAGCCACGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539293_1001539295 -5 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539295 5:172526207-172526229 AACTCTCCTGTCTTCCTCGGTGG No data
1001539293_1001539300 27 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539300 5:172526239-172526261 TCCCTGGTAGTGAAGGAATCAGG No data
1001539293_1001539302 28 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539302 5:172526240-172526262 CCCTGGTAGTGAAGGAATCAGGG No data
1001539293_1001539299 20 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data
1001539293_1001539294 -8 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539294 5:172526204-172526226 GAGAACTCTCCTGTCTTCCTCGG No data
1001539293_1001539304 29 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
1001539293_1001539298 11 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539293 Original CRISPR GAGTTCTCAGCCACGCAGAG AGG (reversed) Intergenic