ID: 1001539296

View in Genome Browser
Species Human (GRCh38)
Location 5:172526213-172526235
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539296_1001539306 20 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539306 5:172526256-172526278 ATCAGGGGTGTGTTCCCGCTGGG No data
1001539296_1001539302 4 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539302 5:172526240-172526262 CCCTGGTAGTGAAGGAATCAGGG No data
1001539296_1001539299 -4 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data
1001539296_1001539305 19 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539296_1001539304 5 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
1001539296_1001539307 21 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539307 5:172526257-172526279 TCAGGGGTGTGTTCCCGCTGGGG No data
1001539296_1001539300 3 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539300 5:172526239-172526261 TCCCTGGTAGTGAAGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539296 Original CRISPR GAGCAGCCACCGAGGAAGAC AGG (reversed) Intergenic