ID: 1001539297

View in Genome Browser
Species Human (GRCh38)
Location 5:172526221-172526243
Sequence AGGGAGCAGAGCAGCCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539297_1001539302 -4 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539302 5:172526240-172526262 CCCTGGTAGTGAAGGAATCAGGG No data
1001539297_1001539307 13 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539307 5:172526257-172526279 TCAGGGGTGTGTTCCCGCTGGGG No data
1001539297_1001539305 11 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539297_1001539306 12 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539306 5:172526256-172526278 ATCAGGGGTGTGTTCCCGCTGGG No data
1001539297_1001539304 -3 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
1001539297_1001539300 -5 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539300 5:172526239-172526261 TCCCTGGTAGTGAAGGAATCAGG No data
1001539297_1001539310 29 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539310 5:172526273-172526295 GCTGGGGCCACCTCTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539297 Original CRISPR AGGGAGCAGAGCAGCCACCG AGG (reversed) Intergenic
No off target data available for this crispr